PatentDe  


Dokumentenidentifikation DE3854210T2 15.02.1996
EP-Veröffentlichungsnummer 0292435
Titel Zeamays-Pflanzen und transgenetische Zeamays-Pflanzen, die aus Protoplasten oder aus von Protoplasten erhaltenen Zellen regeneriert wurden.
Anmelder Ciba-Geigy AG, Basel, CH
Erfinder Rice, Douglas, Durham North Carolina 27705, US;
Carozzi, Nadine, Raleigh North Carolina 27612, US;
Lotstein, Richard, Durham North Carolina 27705, US;
Rothstein, Steven Jay, Chapel Hill North Carolina 27514, US;
Shillito, Raymond Douglas, Chapel Hill North Carolina 27514, US;
Carswell, Gleta, Cary North Carolina 27511, US;
Harms, Christian, Chapel Hill North Carolina 27514, US;
Bowman, Cindy Grimmer, Cary North Carolina 27511, US;
Chang, Yin-Fu, Hayward California 94545, US
Vertreter Zumstein & Klingseisen, 80331 München
DE-Aktenzeichen 3854210
Vertragsstaaten AT, BE, CH, DE, ES, FR, GB, GR, IT, LI, LU, NL, SE
Sprache des Dokument En
EP-Anmeldetag 11.05.1988
EP-Aktenzeichen 888103090
EP-Offenlegungsdatum 23.11.1988
EP date of grant 26.07.1995
Veröffentlichungstag im Patentblatt 15.02.1996
IPC-Hauptklasse A01H 4/00
IPC-Nebenklasse A01H 5/00   C12N 5/14   

Beschreibung[de]

Die Erfindung betrifft ein Verfahren zur Regenerierung von Maispflanzen (Zea mays) aus Protoplasten oder aus von Protoplasten abgeleiteten Zellen. Sie betrifft auch die einbryogenen Zellkulturen (Suspensionskulturen oder Kalluskulturen) und Kalli, die die Quelle der Maisprotoplasten darstellen, die zu Pflanzen regeneriert werden können. Sie betrifft weiterhin Verfahren zur Erzeugung der vorstehend erwähnten embryogenen Zellkulturen und der embryogenen Kalli. Sie betrifft weiterhin genetisch veränderte Protoplasten von Zea mays-Pflanzen, bevorzugt transgene Protoplasten von Zea mays-Pflanzen, umfassend chimäre Gene, die in Maiszellen (Zea mays) Insektizide exprimieren, die im wesentlichen die insektentoxischen Eigenschaften des von Bacillus thuringiensis produzierten kristallinen Proteins besitzen.

(TEIL A) REGENERATION VON ZEA MAYS-PFLANZEN AUS PROTOPLASTEN

Beschreibungen zur regeneration von Zea mays aus Kallus stammen hauptsächlich aus der Mitte der 1970er Jahre [beispielsweise: Green und Phillips, Crop Sc., 15 (1975) 417-421; Harms et al. Z. Pflanzenzüchtg., 77 (1976) 347- 351; Europäische Patentanmeldungen EP-0 160 390, Lowe und Smith (1985); EP-0 176 162, Cheng (1985); und EP-0 177 738, Close (1985)]. Über eine Zeitspanne von mehr als 12 Jahren wurden Versuche unternommen, eine Teilung und eine anschließende Regeneration der Pflanze aus Protoplasten von Zea mays zu erhalten [Potrykus et al., In: Cell Genetics in Higher Plants, Dudits et al., (Hrsg.), Akademiai Kiado, Budapest (1976) 129-140, und die genannten Literaturstellen; Harms, "Maize and Cereal Protoplasts-Facts an Perspectives", Maize for Biological Research,, W.F. Sheridan, Hrsg. (1982); Dale, in: Protoplasts (1983); Potrykus et al. (Hrsg.) Lecture Proceedings, Experientia Supplementum 46, Potrykus et al., Hrsg. Birkhauser, Basel (1983) 31-41, und die genannten Literaturstellen]. Jedoch führten Protoplasten von Zea mays immer nur zu Kulturen, die keine fertilen Pflanzen regenerieren konnten [Potrykus et al., Mol. Gen. Genet. 156 (1977) 347-350; Potrykus et al., Theor. Appl. Genet., 54 (1979) 209-214; Choury und Zurawski, Theor. Appl. Genet., 59 (1981) 341-344; Vasil, In: Proc. 5th Int. Cong. Plant Tissue and Cell Culture, Fujiwara (Hrsg.), Tokio, (1982) 101-104; Imbrie-Milligan und Hodges, Planta, 168 (1986) 395-401; Vasil und Vasil, Theor. Appl. Genet., 73 (1987) 793-798]. Jedoch bietet keine der genannten Druckschriften eine Beschreibung eines Verfahrens zur Erzeugung von Protoplasten mit der Fähigkeit, fertile Pflanzen zu regenerieren.

Die Fähigkeit, solche Protoplasten zu erzeugen, würde die genetische Manipulation dieser wichtigen Nutzpflanze, beispielsweise durch Transformation oder Fusion, oder die Verwendung von Protoplasten als Ausgangsmaterial für die Selektion wertvoller neuer Phänotypen ermöglichen.

Obwohl ein großes Interesse an der genetischen Transformation von Zea mays bestand, gab es bisher keine Beschreibung eines erfolgreichen in vitro-Verfahrens, das zu einer regenerierten, transformierten Pflanze führen kann, obwohl es Beschreibungen zur Transformation von Zea mays-Protoplasten gab, die zur Gewinnung eines nicht regenerierbaren Kallus führten [Fromm et al., Nature, 319, (1986) 791-793]. Ein Verfahren, transgene Zea mays-Pflanzen zu erzeugen, würde das Auffinden einer Methode, stabil Protoplasten mit der Fähigkeit zur Regeneration zu ganzen fertilen Pflanzen zu transformieren, sein. Doch es erschien keine Beschreibung eines Verfahrens, Zea mays-Protoplasten mit der Fähigkeit, sich in ganze fertile Pflanzen zu differenzieren, zu produzieren.

Diese und andere Aufgaben wurden erfindungsgemäß gelöst, indem ein Verfahren zur Erzeugung von Zea mays-Protoplasten, die sich unter Bildung von Kallus-Kolonien teilen können, aufgefunden wurde. Die Protoplasten können transformiert werden, und die Kalli können sich zu fertilen Zea mays-Pflanzen regenerieren. Das Verfahren zur Erzeugung von Zea mays-Protoplasten mit der Fähigkeit zur Teilung und zur Bildung eines Kallus, der dann zur kegeneration in ganze fertile Pflanzen induziert werden kann, benötigt einen speziellen Kallus-Typ. Ein solcher Kallus und Verfahren zur dessen Erzeugung und Identifizierung werden beschrieben und gelten als Teil der Erfindung.

Ein spezieller Kallus-Typ wird verwendet, um die Zellsuspensionen anzusetzen, die auch als Teil der Erfindung gelten. Diese Zellsuspensionen führen nach Subkultur zu Suspensionen, die zur Isolierung von Protoplasten verwendet werden können. Diese Protoplasten können sich teilen und einen Kallus bilden, der dann zur Regeneration von Pflanzen induziert werden kann. Die Zellteilung oder die Kallus-Bildung wird durch das Vorhandensein von bestimmten Mitteln, wie o-niedrig-Alkanoylsalicylsäure (o-Acetylsalicylsäure und deren Homologe), Pflanzenwachstumsregulatoren oder DMSO, oder Kombinationen dieser Mittel, gefördert.

Die Pflanzenregeneration aus von Protoplasten abgeleiteten Zea mays-Zellen in Kultur ist für die Anwendung der somatischen Hybridisierung und für die Produktion von verbesserten Zea mays-Sorten durch somaclonale Variation und für die Verwendung der Gentechnik zur Erzeugung neuer Zea mays- Pflanzen, Pflanzensorten, Züchtungsarten oder Inzuchten mit neuen phänotypischen Merkmalen wesentlich.

(TEIL B) INSEKTIZIDE MAISPFLANZEN (ZEA MAYS)

Bacillus thuringiensis (nachstehend als Bt abgekürzt) ist eine Bakterienart, die ein kristallines Protein erzeugt, das auch als delta-Endotoxin bezeichnet wird. Dieses kristalline Protein ist technich gesehen ein Protoxin, das nach Aufnahme durch die Larven von Lepidoptera-, Coleoptera- und Dipterainsekten in ein Toxin umgewandelt wird.

Das kristalline Protein aus Bt ist ein potentiell wichtiges Insektizid, das keine bekannten schädlichen Wirkungen auf Menschen, andere Säugetiere, Vögel, Fische oder andere Insekten als die Larven von Lepidoptera- , Coleoptera- und Dipterainsekten hat. Die Aktivität der Bt-Toxins ist extrem hoch, so daß nur Nanogramm-Mengen benötigt werden, um empfängliche Insektenlarven abzutöten. Andere Vorteile der Verwendung des kristallinen Proteins aus Bt als Insektizid umfassen sein breites Aktivitätsspektrum gegen Lepidoptera-, Coleoptera- und Dipterainsektenlarven und die offensichtliche Schwierigkeit solcher Larven, eine Resistenz gegen das kristalline Protein zu entwickeln, selbst wenn das kristalline Protein in großem Maßstab verwendet wird. Die genannten Larven sind ein Hauptproblem bei der Landwirtschaft und beim Gartenbau und insbesondere bei der Maiszucht.

Das kristalline Protein wirkt als Insektizid, wenn es auf Pflanzen aufgebracht wird, die das Ziel eines Befalls durch Lepidoptera-, Coleoptera- und Dipterlarven sind.

Bisher wurde das kristalline Bt-Protein (Protoxin) aus dem Bacillus isoliert und auf Pflanzen nach Standardverfahren, wie Verstäuben oder Versprühen, aufgebracht. Präparate, die das kristalline Bt-Protein enthalten, werden im Handel als biologische Insektizide verwendet. Beispielsweise: Bactospein, vertrieben von Biochem Products Ltd., Dipel, vertrieben von Abbot Laboratories; und Thurcid, vertrieben von Sandoz AG. Die Tatsache, daß Bt das kristalline Protein nur während der Sporulation erzeugt, stellt einen signifikanten Nachteil in Zusammenhang mit der Herstellung und der Verwendung dieses biologischen Insektizids dar. Eine solche durch die Wachstumsphase bedingte Beschränkung kann insbesondere in einem industriellen Prozeß zu Nachteilen und exzessiven Zeiterfordernissen während der Herstellung führen. Zusätzlich machten die mit der Herstellung verbundenen Kosten es schwierig, daß ein solches biologisches Insektizid effektiv mit anderen im Handel erhältlichen Produkten auf Chemikalienbasis, wie beispielsweise Pyrethroidderivaten, konkurrieren kann.

Ein weiterer Nachteil bezüglich der Verwendung des Bt-Toxins ist beispielsweise die Tatsache, daß das Protein üblicherweise auf der Oberfläche der behandelten Pflanzen bleibt, wo es nur gegen Larven, die sich auf der Oberfläche ernähren, wirksam ist, und wo es durch längere UV-Exposition inaktiviert wird. Diese Inaktivierung kann mindestens eine Ursache der allgemeinen fehlenden Persistenz des kristallinen Proteins in der Umwelt sein. Folglich ist eine häufige und teure Aufbringung des kristallinen Proteins notwendig.

Diese und andere Nachteile können dadurch überwunden werden, daß man ein Gen, das ein kristallines Bt-Protein oder ein anderes Protein, das im wesentlichen die insektentoxischen Eigenschaften eines kristallinen Bt-Proteins besitzt, codiert, in Pflanzen einschleust und exprimiert. Die Erfindung beschreibt, wie diese Nachteile durch Einschleusen und Exprimieren eines Gens, das ein kristallines Bt-Protein oder ein Protein mit im wesentlichen den irisektentoxischen Eigenschaften eines kristallines Bt-Proteins codiert, in Maisprotoplasten und Regeneration fertiler transgener Maispflanzen aus den transformierten Protoplasten und Züchten dieser insektenresistenten Maispflanzen überwunden werden können.

Durch Ausnützen der Gentechnik kann ein Gen, das für die Produktion eines nützlichen Polypeptids verantwortlich ist, aus einer Donorzelle, in der das Gen natürlicherweise vorkommt, in eine Wirtszelle, in der das Gen nicht natürlicherweise vorkommt, überführt werden; (Cohen und Boyer, U.S.-Patente 4 237 224 und 4 468 464). Es gibt in der Tat neue inhärente Grenzen für solche Transfers. Gene können zwischen Viren, Bakterien, Pflanzen und Tieren transferiert werden. In einigen Fällen ist das transferierte Gen funktionell oder kann in einer Wirtszelle funktionell gemacht werden. Wenn die Wirtszelle eine Pflanzenzelle ist, können ganze Pflanzen manchmal aus der Zellen regeneriert werden.

Gene enthalten typischerweise Regionen von DNA-Sequenzen einschließlich eines Promotors und einer transkribierten Region. Die transkribierte Region enthält normalerweise eine 5'-nichttranslatierte Region, eine codierende Sequenz und eine 3'-nichttranslatierte Region.

Der Promotor enthält die DNA-Sequenzen, die für die Initiation der Transkripton notwendig sind, während der die transkribierte Region in mRNA umgewandelt wird. In eukaryotischen Zellen umfaßt der Promotor vermutlich eine Region, die von der RNA-Polymerase erkannt wird, und eine Region, die RNA-Polymerase auf der DNA für die Initiation der Transkription positioniert. Diese zuletzt genannte Region wird als die TATA-Box bezeichnet, die üblicherweise etwa 30 Nukleotide stromaufwärts der Transkriptionsinitiationsstelle auftritt.

An die Promotorregion schließt sich eine Sequenz an, die in mRNA transkribiert wird, aber nicht in ein Polypeptid translatiert wird. Diese Sequenz stellt die sogenannte 5'- nichttranslatierte Region dar, und enthält vermutlich Sequenzen, die für die Initation der Translation verantwortlich sind, wie eine Ribosomenbindungsstelle.

Die codierende Region ist die Sequenz, die unmittelbar stromabwärts der 5'-nichttranslatierten Region der DNA oder der entsprechenden RNA folgt. Es ist die codierende Region, die in das Polypeptid gemäß dem genetischen Code translatiert wird. Bt beispielsweise besitzt ein Gen mit einer codierenden Sequenz, die in eine Aminosäuresequenz des insektiziden kristallinen Protoxinproteins translatiert wird.

An die codierende Region schließt sich stromabwärts eine Sequenz an, die in mRNA transkribiert wird, aber nicht in ein Polypeptid translatiert wird. Diese Sequenz wird als die 3'-nichttranslatierte Region bezeichnet, und man nimmt an, daß sie ein Signal enthält, das zur Termination der Transkription führt, und für eukaryotische mRNA ein Signal enthält, das die Polyadenylierung des transkribierten mRNA- Stranges verursacht. Die Polyadenylierung der mRNA besitzt vermutlich Processing- und Transportfunktionen.

Natürliche Gene können in ihrer Gesamtheit aus einer Donorzelle in eine Wirtszelle überführt werden. Es ist jedoch oft bevorzugt, ein Gen, das die gewünschte codierende Region mit einem Promotor und gegebenenfalls 5'- und 3'- nichttranslatierte Regionen enthält, zu konstruieren, das in der Natur nicht im gleichen Gen als codierende Region vorkommt. Solche Konstruktionen sind als chimäre Gene bekannt.

Gentechnische Methoden wurden für verbesserte Arten zur Produktion des kristallinen Proteins beschrieben. Beispielsweise beschreiben Schnepf et al., U.S. Patente 4 448 885 und 4 467 036, Plasmide zur Produktion des kristallinen Proteins in Bakterienstämmen außer Bt. Diese Verfahren erlauben die Produktion des kristallinen Proteins, aber überwinden nicht die Nachteile der Verwendung des kristallinen Proteins als handelsübliches Insektizid.

Es wurde vorgeschlagen, die Gene für das Bt-Toxin direkt in Pflanzen zu clonieren, um den Pflanzen zu ermöglichen, sich selbst zu schützen [Klausner, A., Biotechnology, 2 (1984) 409-413]. Adang et al., Europäische Patentanmeldung EP-0 142 924 (Agrigenetics) und DeGreve, H.M.J., et al., EP-0 193 259 (Plant Genetic Systems N.V.) beschreiben ein Verfahren zur Clonierung der Toxingene aus Bt in Tabak. In keiner dieser Druckschriften ist die Transformation von monokotylen Pflanzen beispielhaft aufgeführt.

Es besteht eine Notwendigkeit, neue Verfahren zur Produktion des kristallinen Bt-Proteins in Zellen von Maispflanzen und neue Verfahren zur Bekämpfung von Insektenlarven, die sich von Maispflanzen, die ein kristallines Bt-Protein oder ein ähnliches Polypeptid mit im wesentlichen den insektentoxischen Eigenschaften (insektizide Aktivität) eines kristallinen Bt-Proteins enthalten, ernähren, zu entwickeln. "Bekämpfung" sollte dahingehend verstanden werden, daß dieser Ausdruck entweder die Abtötung der Larven oder zumindest die Verringerung ihrer Futteraufnahme umfaßt. Weiterhin besteht eine Notwendigkeit nach einem Verfahren zum Schutz der Maispflanzen gegen durch Schädlinge oder Krankheitserreger hervorgerufene Schäden, umfassend die Erzeugung einer Menge eines pestiziden oder antipathogenen Proteins in der Pflanzenzelle bzw. der Pflanze, wobei die Menge ausreichend effektiv ist, den Schädling oder den Krankheitserreger abzutöten oder zu bekämpfen. Ferner besteht eine Notwendigkeit, bevorzugt nach einem Verfahren zum Schutz von Maispflanzen gegen Insektenschäden, umfassend die Erzeugung einer insektizid wirksamen Menge eines kristallinen Bt-Proteins oder eines Proteins mit im wesentlichen den insektentoxischen Eigenschaften eines kristallinen Bt-Proteins in der Pflanzenzelle. Ferner besteht eine Notwendigkeit nach einem Verfahren zum Schutz von Maispflanzen vor Schäden durch Chemikalien, wie beispielsweise Herbiziden, damit solche Chemikalien sicher auf Maispflanzen aufgebracht werden können.

Diese und andere Aufgaben wurden erfindungsgemäß gelöst. Die Erfindung betrifft ein Verfahren zur Produktion von Mais(Zea mays)-Protoplasten, die Zellen und Kallus-Kolonien bilden können. Die Protoplasten können gegebenenfalls transformiert werden, und die so erhaltenen Zellen und Kalli können zu transgenen Zea mays-Pflanzen regeneriert werden. Das Verfahren zur Produktion der Protoplasten mit der Fähigkeit zur Teilung und Bildung eines Kallus, der dann zu Pflanzen regeneriert werden kann, benötigt als Ausgangsmaterial eine neue embryogene Zellkultur (Suspensionskulturen oder Kallus-Kulturen). Solche embryogenen Zellkulturen und Verfahren zu deren Produktion und Identifizierung werden beschrieben und gelten als ein Teil der Erfindung. Der embryogene Kallus, aus dem sich Suspensionen ableiten, kann auch als Ausgangsmaterial für die Protoplasten verwendet werden. Ein solcher Kallus und solche Suspensionen, Embryonen und Verfahren zu deren Produktion und Identifizierung werden beschrieben und gelten auch als Teil der vorliegenden Erfindung.

Diese embryogenen Suspensionskulturen können zu ganzen fertilen Maispflanzen regeneriert werden und stellen einen bevorzugten Gegenstand der Erfindung dar.

Diese embryogenen Kulturen sind die Quelle der Protoplasten, die mit exogener DNA transformiert werden können und geteilt werden können und einen Kallus bilden können, der dann zu Pflanzen einschließlich ganzer fertiler Zea mays- Pflanzen regeneriert werden kann, die im Boden wachsen können.

Die Erfindung betrifft ferner Protoplasten von Zea mays- Pflanzen, umfassend chimäre Gene, die in Maiszellen ein Polypeptid mit im wesentlichen den insektentoxischen Eigenschaften des kristallinen Bt-Proteins (nachstehend als chimäres Bt-Toxingen bezeichnet) exprimieren können.

Ferner werden erfindungsgemäß das chimäre Bt-Toxingen in Vektoren, Bakterien, Pflanzenzellen in Kultur und Pflanzenzelle in lebenden Pflanzen sowie Verfahren zur Erzeugung eines Toxins mit im wesentlichen den insektentoxischen Eigenschaften des kristallinen Bt-Proteins in Maiszellen und Verfahren zur Bekämpfung oder Abtötung von Insekten durch deren Fütterung mit Maiszellen, die ein Gen enthalten, das ein solches Toxin exprimiert, offenbart.

Die Erfindung beschreibt weiterhin Verfahren zum Schutz von Zea mays vor Schäden durch krankheitserregende Pilze durch Einschleusen und Exprimieren eines Gens, das ein Polypeptid mit Chitinaseaktivität codiert, in Maiszellen und Pflanzen.

Die Erfindung beschreibt weiterhin Verfahren zur Einschleusung und Expression eines Gens, das ein Polypeptid codiert, das die Zellen und die Pflanzen gegenüber herbiziden Chemikalien tolerant macht, in Maiszellen und Pflanzen.

Aus dem Stand der Technik konnte zum Zeitpunkt, zu dem die Erfindung durchgeführt wurde, nicht vorhergesagt werden, daß Mais (Zea mays-)Pflanzen, insbesondere fertile Maispflanzen aus Protoplasten, aus von Protoplasten abgeleiteten Zellen oder aus von Protoplasten abgeleiteten Kalli regeneriert werden konnten. Noch weniger vorhersagbar war die Tatsache, daß Zea mays-Protoplasten, die in stabiler Inkorporation exogene DNA enthalten, auch zu transgenen Pflanzen, insbesondere zu fertilen transgenen Zea mays-Pflanzen regeneriert werden können.

AUFGABEN DER ERFINDUNG

Die Erfindung betrifft embryogene Zellkulturen (Suspensionskulturen oder Kalluskulturen), abgeleitet von Zea mays-Pflanzen, aus denen Protoplasten isoliert werden können, wobei die Protoplasten Zellwände regenerieren, sich teilen und einen Kallus bilden, der zu Pflanzen einschließlich fertiler Zea mays-Pflanzen regeneriert werden kann.

Die Erfindung betrifft auch Zea mays-Protoplasten und die so erhaltenen von Protoplasten abgeleiteten Pflanzenzellen (nach Regeneration der Zellwände), die zu Pflanzen regeneriert werden können, die bevorzugt fertil sind, bevorzugt solche Protoplasten, die von Zellkulturen oder aus embryogenen Zellsuspensionen abgeleitet sind.

Die Erfindung betrifft auch embryogene Zellsuspensionskulturen, die zu fertilen Maispflanzen regeneriert werden können. Die Zea mays-Protoplasten können transformiert werden oder anderweitig genetisch verändert und dann zu Zea mays- Pflanzenzellen, Kalli, embryogenen Suspensionen, Embryos, Setzlingen und Pflanzen regeneriert werden.

Ferner können die regenerierten Zea mays-Pflanzen, die von den embryogenen Zellsuspensionskulturen oder gezüchteten Protoplasten abgeleitet sind, zu Fortpflanzungseinheiten oder Nachkommen führen. Fortpflanzungseinheiten umfassen jedes Material, das sexuell oder asexuell vermehrt oder in vivo oder in vitro vermehrt werden kann. Unter diesem vermehrungsfähigem Material sind Protoplasten, Zellen, Kalli, Gewebe oder Samen bevorzugt. Die Nachkommen der regenerierten Zea mays-Pflanzen umfassen Mutanten und Varianten davon. Mutanten und Varianten umfassen beispielsweise diejenigen Pflanzen, die durch Zellfusion oder Mutantenselektion erhalten wurden.

Die Erfindung betrifft bevorzugt transgene Protoplasten von Zea mays-Pflanzen, in die stabil exogene DNA, bevorzugt exogene DNA, die in Zea mays exprimierbar ist, bevorzugter ein chimäres Gen, das der transformierten Pflanze eine wertvolle Eigenschaft verleiht, inkorporiert ist. Die wertvollen Eigenschaften werden nachfolgend beschrieben.

Die Erfindung betrifft auch ein Verfahren zur Erzeugung von Zea mays-Protoplasten und Zea mays-Pflanzenzellen, die zu Pflanzen, insbesondere fertilen Pflanzen, regeneriert werden können, und ferner ein Verfahren zur Produktion von Zea mays-Kalli, die von den Protoplasten oder den Protoplasten abgeleiteten Zellen abgeleitet sind und die zu Pflanzen, bevorzugt zu fertilen Pflanzen, regeneriert werden können. Zusätzlich betrifft sie ein Verfahren zur Regeneration von Zea mays-Pflanzen und transgenen Zea mays-Pflanzen aus diesen Zellen (Kallus) oder Suspensionskulturzellen.

Diese Verfahren werden nachstend ausführlich beschrieben.

Es ist eine weitere Aufgabe der Erfindung, ein Verfahren zur Produktion eines kristallinen Bt-Proteins oder eines Proteins, das im wesentlichen die insektentoxischen Eigenschaften eines kristallinen Bt-Proteins besitzt, in Zea mays-Pflanzen zu produzieren. Besonders bevorzugt ist ein Verfahren zur Produktion eines Polypeptids mit im wesentlichen den insektentoxischen Eigenschaften eines kristallinen Bacillus thuringiensis-Proteins in Zea mays, das dadurch gekennzeichnet ist, daß man

(a) in Zea mays-Zellen ein Gen, das ein Polypeptid mit im wesentlichen den insektentoxischen Eigenschaften eines kristallinen Bt-Proteins codiert, einschleust, wobei der Promotor, die 5'-nichttranslatierte Region und gegebenenfalls die 3'-nichttranslatierte Region des Gens von einem Pflanzengen oder einem Pflanzenvirusgen abgeleitet sind, und

(b) das Polypeptid exprimiert.

Die Erfindung beschreibt weiter ein Verfahren zum Schutz von Zea mays-Pflanzen vor Schäden, die durch einen Krankheitserreger, der Zea mays-Pflanzen angreift, hervorgerufen werden, das dadurch gekennzeichnet ist, daß man in der Pflanzenzelle eine antipathogen wirksame Menge oder eine zur Kontrolle der Krankheitserregers ausreichende Menge eines Proteins mit antipathogenetischer oder den Krankheitserreger kontrollierender Eigenschaft erzeugt.

Die Erfindung beschreibt weiter ein Verfahren zum Schutz von Zea mays-Pflanzen gegen Schäden durch Schädlinge, umfassend die Erzeugung einer pestizid wirksamen Menge oder einer zur Kontrolle des Schädlings ausreichenden Menge eines Proteins mit pestizider oder schädlingsbekämpfender Eigenschaft in der Pflanzenzelle. Besonders bevorzugt ist ein Verfahren, bei dem der Schädling ein Insekt ist.

Die Erfindung beschreibt weiter ein Verfahren zur Kontrolle von Insektenlarven, bevorzugt von Lepidoptera-, Coleopteraund Dipteralarven, durch deren Fütterung fit Maispflanzenzellen, die chimäre Gene enthalten, die eine insektizide Menge eines kristallinen Bt-Toxins oder eines Toxins mit im wesentlichen den insektentoxischen Eigenschaften des kristallinen Btuß-Proteins exprimieren.

Die Erfindung beschreibt weiter ein Verfahren zum Schutz von Maispflanzen vor Insektenschäden, umfassend die Produktion einer bekämpfenden oder insektizid wirksamen Menge eines kristallinen Bt-Proteins oder eines Proteins mit im wesentlichen den insektentoxischen Eigenschaften eines kristallinen Bt-Proteins in der Pflanzenzelle. Die insektiziden Maispflanzenzellen umfassen solche aus ganzen Pflanzen und Pflanzenteilen sowie gezüchtete Maiszellen.

Die Erfindung beschreibt weiter ein Verfahren, bei dem ein Protein in einer Menge produziert wird, die ausreicht, die Pflanzen für die Insekten unattraktiv zu machen, so daß sie aufhören, sich von der Pflanze zu ernähren.

Diese und weitere Aufgaben gehen aus der folgenden aus führlichen Beschreibung hervor.

KURZE BESCHREIBUNG DER FIGUREN

Die Figur 1 zeigt einen Kallus, der für die Verwendung zur Ansetzung von embryogenen Zea mays-Suspensionen geeignet ist (Vergrößerung etwa 7fach). (Stufe a).

Die Figuren 2 und 3 zeigen dichte zytoplasmatische, sich teilende Zellen, die in den Kulturen von Stufen b bis d beibehalten werden. (Vergrößerung etwa 20fach).

Die Figur 4 zeigt Kalli, die sich aus Protoplasten, die in einem festen Medium gezüchtet wurden, entwickeln. (Vergrößerung etwa 7fach).

Die Figur 5 zeigt einen von den Protoplasten gemäß Stufe f abgeleiteten Kallus. (Vergrößerung etwa 7fach).

Die Figur 6 zeigt die weitere Differenzierung des Kallus unter Bildung eines Pflänzchens gemäß Stufe g. (Vergrößerung etwa 7fach).

Die Figur 7 zeigt Kolonien, die aus Zea mays-Protoplasten aufgehen, welche auf einem KM-Medium mit und ohne 2,4-D und Acetylsalicylsäure plattiert wurden. Links oben: kein 2,4-D oder Acetylsalicylsäure. Rechts oben: 1 mg/l 2,4-D und keine Acetylsalicylsäure. Links unten: 100 mg/1 Acetylsalicylsäure und kein 2,4-D. Rechts unten: 100 mg/l Acetylsalicylsäure und 1 mg/1 2,4-D.

Die Figur 7a zeigt die Konstruktion von pCIB5.

Die Figur 7b zeigt die Konstruktion von pCIB4.

Die Figur 7c zeigt die Konstruktion von pCIB2.

Die Figur 7d zeigt die Konstruktion von pRK252Km.

Die Figur 7e zeigt die Konstruktion von pCIB10.

Die Figur 7f zeigt die Konstruktion von pRK290Km.

Die Figur 7g zeigt die Konstruktion von pCIB10a.

Die Figur 8 zeigt Setzlinge, die aus einem von Protoplasten abgeleiteten Kallus von Zea mays regeneriert wurden.

Die Figur 9 zeigt eine Zea mays-Pflanze, die aus einem von einem Protoplasten abgeleiteten Kallus regeneriert wurde.

Die Figur 10 zeigt die Konstruktion des Plasmids pCIB710.

Die Figur 11 zeigt die Konstruktion des Plasmid pCIB10/710.

Die Figur 12 zeigt die Konstruktion des Plasmids pCIB10/35SBt.

Die Figur 13 zeigt die Nukleotidsequenz des Endotoxingens von Bacillus thuringiensis var. kurstaki HD1.

Eine bevorzugte Nukleotidsequenz, die ein kristallines Protein codiert, ist diejenige, die als Nukleotide 156 bis 3623 in der Sequenz gezeigt ist, oder eine kürzere Sequenz, die ein insektizides Fragment eines solchen kristallinen Proteins codiert; Geiser et al., Gene 48 (1986) 109-118.

Die Figur 14 zeigt die Southern-Blot-Analyse von verschiedenen Zea mays-Kalli, die nach Transformation von Zea mays- Protoplasten mit pCIB712 gewonnen wurden und mit dem EcoRI- Fragment von pCIB712 abgesucht wurden.

Bahnen 1-4: 0,5, 1, 2 und 5 Kopie(n) pro Genomrekonstruktionen von pCIB712, gespalten mit der Restriktionsendonuklease EcoRI.

Bahnen 5-25: DNA aus Zea mays-Kalluskulturen, gewonnen nach Transformation von Protoplasten mit pCIB712, gespalten mit der Restriktionsendonuklease EcoRI.

Die DNA in Bahn 10 zeigt klar das Vorhandensein von in das Genom von Zea mays-Zellen integrierter Fremd-DNA, wie durch die Dunkelfärbung des Films gezeigt wird. Der Pfeil weist auf das 975 bp lange Fragment, das aus der EcoRI-Spaltung des integrierten APH-IV-Gens von pCIB712 erwartet wird, das den transgenen Zellen Hygromycinresistenz verleiht.

Die Figur 15 zeigt die Konstruktion von pCIB10/35SBt (KpnI).

Die Figur 16 zeigt die Konstruktion von pCIB10/35SBt (BclI)

Die Figur 17 zeigt die Konstruktion von pCIB10/35SBt (607).

DEFINITIONEN

Zea mays/Mais: In der vorliegenden Beschreibung oder den Patentansprüchen bezeichnen diese Ausdrücke jede Pflanze oder einen Teil einer Pflanze (Protoplasten, Zellen, Gewebe, Organe, Organellen, Embryonen, Kalli, Fortpflanzungseinheiten etc.), die der Art Zea mays angehören. Die hier verwendeten Ausdrücke umfassen Rassen, Züchtungssorten, Varietäten, Inzuchtlinien und Hybride von Zea mays. Die Erfindung umfaßt, ohne darauf beschränkt zu sein, die Maisinzuchtlinien, wie beispielsweise Funk 5N984, Funk 5N986, Funk 2717, Funk 211D, Funk 2N217A, B73, A632, CM105, B37, B84, B14, Mo17, R168, MS71, A188, FA91, A641 und W117. Bevorzugt sind alle Elitegenotypen (Varietäten, Züchtungsarten, Inzuchtlinien, Hybride etc.) einschließlich der Eliteinzuchtlinien Funk 5N984, Funk 5N986, Funk 2717, Funk 211D und Funk 2N217A, am meisten bevorzugt die Eliteinzuchtlinie Funk 2717.

BMS:

"Black Mexican Sweet Corn". Eine alte Süßmaisvarietät mit kleinen Ähren und mit einer dunkelblauen Färbung des Kernpericarps, was den Kernen ein "schwarzes" Aussehen verleiht.

Pflanzenzelle:

Die strukturelle und physiologische Eigenheit der Pflanzen, bestehend aus einem Protoplasten und der Zellwand.

Der Ausdruck "Pflanzenzelle" bezeichnet jede Zelle, die entweder ein Teil einer Pflanze ist oder davon abgeleitet ist. Einige Beispiele von erfindungsgemäß umfaßten Zellen umfassen differenzierte Zellen, die Teil einer lebenden Pflanze sind; differenzierte Zellen in Kultur; undifferenzierte Zellen in Kultur; die Zellen von undifferenziertem Gewebe, wie Kallus oder Tumore; Samen; Embryonen; Fortpflanzungseinheiten und Pollen.

Pflanzengewebe: Eine Gruppe von Pflanzenzellen, die zu einer strukturellen und funktionellen Einheit organisiert ist. Jedes Gewebe einer Pflanze in Pflanzen oder in Kultur. Dieser Ausdruck umfaßt ohne Beschränkung ganze Pflanzen, Pflanzenzellen, Pflanzenorgane, Pflanzensamen, Protoplasten, Zellkultur und alle Gruppen von Pflanzenzellen, die zu strukturellen und/oder funktionellen Einheiten organisiert sind. Die Verwendung dieses Ausdrucks zusammen mit oder ohne einen speziellen Typ von Pflanzengewebe, wie vorstehend aufgeführt oder in sonstiger Weise von dieser Definition umfaßt, soll keinen anderen Typ von Pflanzengewebe ausschließen.

Pflanzenorgan:

Ein getrennter und sichtbar strukturierter und differenzierter Teil einer Pflanze, wie Wurzel, Stamm, Blatt, Blume, Knospe oder Embryo. Ein Pflanzenorgan kann aus verschiedenen Typen von Pflanzenzellen oder Pflanzengeweben bestehen.

Protoplast:

Isolierte Pflanzenzelle ohne eine Zellwand.

Transgene Pflanze:

Eine Pflanze, bei der exogene DNA in deren genetisches Material stabil inkorporiert ist. Der Ausdruck umfaßt exogene DNA, die in die Protoplasten in verschiedenen Formen eingeschleust werden kann, einschließlich beispielsweise nackter DNA in kreisförmiger, linearer oder supergecoilter Form, DNA, die in Nukleosomen oder Chromosomen oder Kernen oder Teilen davon enthalten ist, DNA, die mit anderen Molekülen komplexiert oder assoziiert ist, in Liposome, Sphäroplasten, Zellen oder Protoplasten eingeschlossene DNA. Verschiedene unterschiedliche Methoden, exogene DNA in Protoplasten einzuschleusen, sind auf dem Fachgebiet bekannt und können verwendet werden, um transgene Protoplasten, transgene Zellen oder transgene Pflanzen erfindungsgemäß zu erzeugen.

Kultur:

Eine proliferierende Zellmasse in einem undifferenzierten oder teilweise differenzierten Zustand. Der Ausdruck "Zellkultur" umfaßt Kallus-Kulturen, bestehend aus Zellmassen, die auf einem verfestigten Kulturmedium wachsen, und Suspensionskulturzellen, die in einem dispersen Zustand in einem gerührten Flüssigkulturmedium wachsen.

Embryo:

Ein winziges frühes Entwicklungsstadium einer Pflanze, abgeleitet entweder von einer Zygote (dann als sexueller Embryo bezeichnet) oder von einer embryogenen somatischen Zelle (dann als somatischer Embryo bezeichnet) mit Stadien erkennbarer Morphologie, Struktur und zellulärer Organisation, umfassend zelluläre bis globuläre bis cotyledonäre Stadien. [Die Entwicklung des Maisembryos ist beispielsweise in Randolph, L.F., J. Agric. Research, 53 (1936) 881-916; die des Grasembryos im allgemeinen beispielsweise in Brown, W.V., Phytomorphology, 10 (1960) 215- 223 beschrieben.]

Setzling:

Eine vielzellige Struktur, bestehend aus einem Schößling und einer Wurzel in Form einer kleinen Pflanze.

Chimäre Sequenz oder chimäres Gen:

Eine DNA-Sequenz, die mindestens zwei heterologe Teile enthält, z.B. Teile, abgeleitet von oder mit wesentlicher Sequenzhomologie zu vorher existierenden DNA-Sequenzen, die in ihren vorher existierenden Zuständen nicht miteinander verknüpft sind. Die vorher existierenden DNA-Sequenzen können natürlichen oder synthetischen Ursprungs sein.

Codierende DNA-Sequenz.

Eine DNA-Sequenz, die bei Transkription und Translation zur Bildung eines zellulären Polypeptid führt.

Gen:

Eine getrennte chromosomale Region, umfassend eine regulatorische DNA-Sequenz, die für die Kontrolle der Expression verantwortlich ist, d.h. die Transkription und die Translation, und eine codierende Sequenz, die unter Erhalt eines getrennten Polypeptid transkribiert und translatiert wird.

Abgeleitet von:

Im Kontext dieser Anmeldung umfassen Gene, Teile von Genen oder andere DNA-Sequenzen, die von anderen DNA-Quellen "abgeleitet sind", Gene, Teile von Genen oder andere DNA-Sequenzen, die mit dem ursprünglichen DNA-Material identisch oder im wesentlichen homolog sind.

Phänotypische Eigenschaft:

Eine beobachtbare Eigenschaft als Ergebnis der Expression eines oder mehrerer Gene.

Vorher existierende DNA-Sequenz:

Eine DNA-Sequenz, die vor ihrer Verwendung als ganzes oder in Teilen in einem Produkt oder einem erfindungsgemäßen Verfahren vorhanden ist. Während eine derartige Vorexistenz typischerweise einen natürlichen Ursprung widerspiegelt, können vorher existierende Sequenzen synthetischen oder anderen Ursprungs sein.

Wesentliche Sequenzhomologie:

Wesentliche funktionelle und/oder strukturelle Äquivalenz zwischen Nukleotid- oder Aminosäuresequenzen. Funktionelle und/oder strukturelle Unterschiede zwischen Sequenzen mit wesentlicher Sequenzhomologie sind minimiert.

Dicamba: 3,6-Dichlor-2-methoxybenzoesäure.

MES: 2-[N-Morpholino]ethansulfonsäure

2,4-D: 2,4-Dichlorphenoxyessigsäure.

Picloram: 4-Amino-3,6,6-trichlorpicolinsäure.

Tris-HCl: α,α,α-Tris (hydroxymethyl)methylaminhydrochlorid.

EDTA: 1-Ethylendiamin-N,N,N',N' -TEtraessigsäure.

PEG: Polyethlyenglykol.

Agarose:

Die Herstellung und Reinigung von Agarose sind beispielsweise von Guiseley und Renn ["The Agarose Monograph", Marine Colloids Division FMC Corp. (1975)] beschrieben. Agarose ist einer der Agarbestandteile. Im Handel erhältlicher Agar besteht normalerweise aus einem Gemisch aus neutraler Agarose und ionischem Agaropectin mit einer großen Anzahl von Seitengruppen. Im Handel erhältliche Agarose wird normalerweise aus Agar nach herkömmlichen Methoden gewonnen. Üblicherweise bleibt eine bestimmte Anzahl von Seitenketten intakt und bestimmt die physikalischchemischen Eigenschaften der Agarose, wie Gelbildung und Schmelztemperatur. Niedrig schmelzende Agarose, insbesondere SeaPlaque -Agarose ist ein bevorzugtes Verfestigungsmittel bei dem nachstehend beschriebenen Verfahren.

SH-Medium:

Medium von Schenk, R.U. et al., Can. J. Bot., 50 (1972), 199-204; ohne Wachstumsregulatoren. (SH-Medium kann flüssig oder mit 0,8% (Gew./Vol.) Agar oder mit 0,5% (Gew./Vol.) GelRite verfestigt sein). Das Medium wird normalerweise nach auf dem Fachgebiet bekannten Methoden sterilisiert, beispielsweise durch Hitze oder durch Sterilisation mittels Autoklavieren bei 121ºC und einem Druck von 15 lb/in² [1,2 kg/cm²] für etwa 15 bis 20 Minuten.

MS-Medium:

Murashige, T., und Skoog, F., Physiol. Plant, 15 (1962), 473.

B5-Medium:

Gamborg, O. et al., Ex-. Cell Res., 50 (1968) 151.

N6-Medium:

Chu et al., Scientia Sinica, 18 (1975), 659. Die Zusammensetzung ist in der nachstehenden Tabelle 1 angegeben.

KM-Medium:

Kao, K.N., et al., Planta, 126 (1975), 105-110. Dieses Medium kann flüssig oder mit Agar, Agarose oder Gel- Rite verfestigt sein und kann auch ohne Ascorbinsäure, Vitamin D und Vitamin A hergestellt und verwendet werden. Die Komponenten des Mediums mit Ausnahme des Verfestigungsmittels werden normalerweise durch Filtration durch ein 0,2-um-Filter sterilisiert. (Die Zusammensetzung ist in der nachstehenden Tabelle 1 angegeben).

Tabelle 1: Zusammensetzung der verwendeten Medien
Makroelemente und Mikroelemente der Medien sind wie in der Literatur angegeben MEDIUM
In den Kulturmedien verwendete Vitaminee: mg/l Biotin Pyridoxin HCl Thiamin HCl Nicotinamid Nicotinsäure Folsäure D-Ca-Pantothenat p-Aminobenzoesäure Cholinchlorid Riboflavin Vitamin Glycin Zucker und Zuckeralkohole: g/l Saccharose Glucose Mannit Sorbit Cellobiose Fructose Mannose Rhamnose Ribose Xylose m-Inosit End-pH

Fußnoten:

a: Die Makroelemente werden üblicherweise als 10fach konzentrierte Stammlösung und die Mikroelemente als 1000fach konzentrierte Stammlösung angesetzt.

b: Citronen-, Fumar- und Äpfelsäure (jeweils 40 mg/l Endkonzentration) und Natriumpyruvat (20 mg/l Endkonzentration) werden als 100fach konzentrierte Stammlösung hergestellt, mit NH&sub4;OH auf einen pH-Wert von 6,5 eingestellt und diesem Medium zugesetzt.

c: Adenin (0,1 mg/l Endkonzentration) und Guanin, Thymin, Uracil, Hypoxanthin und Cytosin (je 0,03 mg/l Endkonzentration) werden als 1000fach konzentrierte Stammlösung hergestellt, auf einen ph-Wert von 6,5 wie vorstehend eingestellt und diesem Medium zugesetzt.

d: Die folgenden Aminosäuren werden diesem Medium unter Verwendung einer 10fachen Stammlösung (ph 6,5 mit NH&sub4;OH) zugesetzt, wodurch die angegebenen Endkonzentrationen erhalten werden: Glutamin (5,6 mg/l), Alanin, Glutaminsäure (jeweils 0,6 mg/1), Cystein (0,2 mg/l), Asparagin, Asparaginsäure, Cystin, Histidin, Isoleucin, Leucin, Lysin, Methionin, Phenylalanin, Prolin, Serin, Threonin, Tryptophan, Tyrosin und Valin (je 0,1 mg/l).

e: Die Vitamin-Stammlösung wird normalerweise als 100faches Konzentrat hergestellt.

Cellulase RS:

Cellulase RS, Yakult Honsha Co. Ltd., 1.1.19 Higashi-Shinbashi, Minato-ku, Tokio 105, Japan.

Pectolyase Y-23:

Seishin Pharmaceutical Co. Ltd., 4-13 Koami-cho, Nihonbashi, Tokio, Japan.

Nalgen -Filter:

Nalge Co., Division of Sybron Corp. Rochester, New York, 14602, USA.

BGlII:

Restriktionsenzym BGlII; New England Biolabs, 32 Tozer Road, Beverly, MA, 01915, USA oder jeder andere Handelslieferant.

BamHI:

Restriktionsenzym BamHI; New England Biolabs, 32 Tozer Road, Beverly, MA, 01915, USA oder jeder andere Handelslieferant.

Hygromycin B:

Cytotoxin: Hygromycin B, gereinigt; Cat Nr. 400050 Calbiochem Behring Diagnostica, La Jolla, CA 92307, USA, Charge-Nr. 702296.

Gelrite :

Gelrite Gellnan Gum, Scott Laboratories Inc., Fiskersville, RI 02823.

PRIME TIME random primer kit oder IBI Random primer kit:

International Biotechnologies Inc., PO. Box 1565, New Haven, CT 07606, USA (Katalognr. 77800; Charge-Nr. F630-01).

GA7R-Behälter:

Kleiner steriler Behälter (etwa 7 x 7 x 10 cm) aus durchscheinendem Kunststoff mit einem durchscheinenden Deckel. Er wird verwendet, um Setzlinge, Setzlingskulturen etc. zu züchten. Hersteller: Magenta Corp., 3800 N. Milwaukee Avenue, Chicago, IL, 60641, USA. Er kann durch jeden ähnlichen sterilen durchscheinenden Behälter (z.B. Glas oder Plastik) ersetzt werden.

Umwandlung von u-Einstein in lux:
lux

Hinterlegungen der Plasmide in Mikroorganismen oder von Pflanzenzellen:

In Zusammenhang mit der vorliegenden Erfindung wurden die nachstehend aufgeführten Plasmide (in Mikroorganismen) und Pflanzenzellen gemäß den Erfordernissen der Budapester Vertrags hinterlegt.

(1) Zea mays-Suspensionszellkultur 6-2717 CG von Funk 2717, hinterlegt bei der American Type Culture Collection (ATCC), Rockville, USA, unter der Hinterlegungsnr. ATCC 40326 [Hinterlegungsdatum: 20. Mai 1987].

(2) Plasmid pCIB712 [in dem E. coli-Stamm MC1061], hinterlegt bei der ATCC unter der Hinterlegungsnr. ATCC 67407 [Hinterlegungsdatum: 18. Mai 1987].

(3) Plasmid pSCH1 [in dem E. coli-Stamm K12], hinterlegt bei der Deutschen Sammlung von Mikroorganismen (DSM) in Göttingen, Bundesrepublik Deutschland, unter der DSM-Hinterlegungsnr. 4129 [Hinterlegungsdatum: 29. Mai 1987].

(4) Plasmid pcIB10/35SBt [in dem E. coli-Stamm MC1061], hinterlegt bei der ATCC unter der ATCC-Hinterlegungsnr. 67329 [Hinterlegungsdatum: 27. Februar 1987].

(5) Plasmid pE16/8-c4 [in dem E. coli-Stamm HB101], hinterlegt bei der ATCC unter der ATCC-Hinterlegungsnr. 67420 [Hinterlegungsdatum: 29. Mai 1987].

(6) Plasmid pCIB1O/19SBt [in dem E. coli-Stamm HB101], hinterlegt bei der ATCC unter der ATCC-Hinterlegungsnr. 67330 [Hinterlegungsdatum: 27. Februar 1987].

(TEIL A) REGENERATION VON MAIS (ZEA MAYS)-PFLANZEN AUS PROTOPLASTEN

Der erfindungsgemäß verwendete Kallus kann aus jedem Gewebe von Zea mays-Pflanzen entstammen. Das Gewebe ist bevorzugt unreifes Gewebe, wie unreife Narbenfäden, unreife Embryonen, der Basalteil von jungen Blättern und im Prinzip jedes andere Gewebe von Zea mays mit der Fähigkeit zur Kallus- Bildung. Ein besonders nützliches Gewebe ist das Schildchen von unreifen Zea mays-Embryonen.

Im Prinzip sind alle Zea mays-Genotypen (Varietäten, Züchtungssorten, Inzuchtlinien, Hybride etc.) erfindungsgemäß nützlich. Am wertvollsten sind Genotypen von kommerziellem Interesse. Bevorzugt sind alle Elitegenotypen, insbesondere alle Inzuchtlinien, bevorzugter Eliteinzuchtlinien. Geeignete Inzuchtlinien sind beispielsweise Funk 2717, Funk 211D, Funk 2N217A, B73, A632, CM105, B37, B84, B14, Mo17, R168, MS71, A188, FA91, A641 und W117. Funk 5N984 und Funk N986 sind weitere Beispiele für nützliche Zea mays-Genotypen. Besonders bevorzugt sind die Eliteinzuchtlinien Funk 2717, Funk 211D, Funk 5N984 oder Funk 2N217A und am meisten bevorzugt ist der Elitegenotyp Funk 2717.

In der nachstehenden Beschreibung wird ein Verfahren zur Produktion von embryogenen Suspensionen von Funk 2717, aus denen Protoplasten isoliert werden können, die sich zu fertilen Pflanzen regenerieren können, beschrieben. Es ist jedoch zu verstehen, daß andere Maisgenotypen bei dem beschriebenen Verfahren mit höchstens Routinemodifikationen, die einem Fachmann auf dem Gebiet bekannt sind, verwendet werden können.

Stufe (a) Kallus-Bildung

Zea mays-Pflanzen des Genotyps Funk 2717 werden bis zur Blütebildung gezüchtet und bestäubt. Unreife Embryonen werden den Körnern entnommen und in ein Initiationsmedium gegeben. Embryonen haben typischerweise eine Länge zwischen 1 und 4 mm, bevorzugt zwischen 1,5 und 3 mm, und am meisten bevorzugt zwischen 2 und 2,5 mm. Das Initiationsmedium kann flüssig oder verfestigt sein. Jedes Initiationsmedium mit der Fähigkeit zur Kallus-Induktion kann verwendet werden. Einige geeignete Beispiele umfassen ohne Beschränkung diejenigen auf der Grundlage von MS-Medium [Murashige, T., und Skoog, F., Physiol. Plant. 15, (1962) 473], N6-Medium [Chu et al., Scientia Sinica 18 (1975) 659], B5-Medium [Gamborg, O., et al., Exp. Cell. Res., 50 (1968) 151], SH-Medium oder KM-Medium, mit geeigneten Konzentrationen von Zuckern und Pflanzenwachstumsregulatoren. Andere geeignete Kombinationen sind in 'Plant Culture Media' George, E.F., et al. (Hrsg.) Exegetics Ltd., Edington, Westbury, Wiltshire, England (1987) beschrieben.

Der Kallus wird den gezüchteten unreifen Embryonen entnommen und in ein Erhaltungsmedium gegeben. Jedes Erhaltungsmedium mit der Fähigkeit zur Erhaltung einer Kallus-Proliferation kann verwendet werden. Einige geeignete Beispiele umfassen ohne Beschränkung diejenigen auf der Basis von MS- Medium, N6-Medium, B5-Medium oder KM-Medium mit geeigneten Konzentrationen an Zuckern oder Pflanzenwachstumsregulatoren. Das Material wird in frisches Erhaltungsmedium in geeigneten Intervallen, beispielsweise alle 1 bis 120 Tage, bevorzugt 3 bis 21 Tage, und am bevorzugtesten 5 bis 14 Tage, subkultiviert. Die Initiation und die Erhaltung können im Licht oder im Dunkeln, bevorzugt im Dunkeln, durchgeführt werden. Die Temperatur kann zwischen 0ºC und 50ºC, bevorzugt zwischen 20ºC und 32ºC, am bevorzugtesten zwischen 25ºC und 28ºC, liegen.

Die Subkultur wird unter den gleichen Bedingungen fortgesetzt, bis der Kallus als spezieller Kallus-Typ vorliegt. Dieser spezielle Kallus-Typ, der sich zur Verwendung zur Initiierung von Suspensionen gemäß der Erfindung eignet, ist relativ wenig schleimig und ist körnig und zerreibbar. Die Figur 1 zeigt einen Kallus, der für die Verwendung zur Initiierung von embryogen Suspensionen gemäß der Erfindung geeignet ist. Der geeignete Kallus wird in geeigneten Intervallen, beispielsweise alle 1 bis 120 Tage, bevorzugt 3 bis 21 Tage, am bevorzugtesten 5 bis 14 Tage, subkultiviert. Dieser spezielle Kallus-Typ, der sich zu fertilen Zea mays-Pflanzen regenerieren kann, und aus dem Protoplasten mit der Fähigkeit, zu fertilen Pflanzen regeneriert zu werden, isoliert werden kann, stellt eine der bevorzugten Ausführungsformen der Erfindung dar.

Daher betrifft die Erfindung einen Zea mays-Kallus, der Suspensionskulturen erzeugen kann, aus dem Pflanzen, bevorzugt fertile Pflanzen regeneriert werden können und aus dem Protoplasten, mit der Fähigkeit zur Regeneration von Pflanzen, bevorzugt fertile Pflanzen, regeneriert werden können.

Die Erfindung betrifft auch ein Verfahren zur Produktion einer Kallus-Kultur von Zea mays, aus der Protoplasten isoliert werden können, wobei die Protoplasten zu fertilen Pflanzen regeneriert werden können, das dadurch gekennzeichnet ist, daß man in Stufen

(a) ein Gewebe, das aus Zea mays-Pflanzen stammt, in einem geeigneten Medium mit der Fähigkeit zur Initiierung eines Kallus und/oder zur Unterhaltung der Kallus-Proliferation züchtet, bis ein spezieller Kallus-Typ, der relativ wenig schleimig, körnig und zerreibbar ist, identifiziert werden kann,

(b) den speziellen Kallus-Typ auswählt, und

(c) den speziellen Kallus-Typ auf einem geeigneten, einen Kallus unterhaltenden Medium züchtet.

Stufe (b) bis (d) Suspensionskulturen

Der spezielle Kallus-Typ aus Stufe (a) wird in ein flüssiges Medium gegeben, wodurch eine Suspensionen aus Zellen und Zellaggregaten gebildet wird. Einige geeignete Beispiele von flüssigen Medien umfassen ohne Beschränkung diejenigen auf der Basis von MS-Medium, N6-Medium, B5-Medium und KM-Medium mit geeigneten Konzentrationen von Zuckern und Pflanzenwachstumsregulatoren. Bevorzugt ist das Medium das N6-Medium.

Die Kulturen werden mit einer Häufigkeit subkultiviert, die ausreicht, die Zellen und Zellaggregate in einem lebensfähigen und proliferierenden Stadium zu erhalten, beispielsweise alle 1 bis 120 Tage, bevorzugt 3 bis 21 Tage, am bevorzugtesten 5 bis 10 Tage. Kulturen, die Aggregate aus dichtem cytoplasmatischen, sich teilenden Zellen enthalten, werden beibehalten. Diejenigen mit einem hohen Anteil an expandierten Zellen werden verworfen. Der Anteil der Zellen, die dicht cytoplasmatisch sind, kann mit der Zeit zunehmen; vergleiche Figuren 2 und 3. Der gewünschte Typ der Suspensionskultur ist einer, der bevorzugt einen Anteil von mindestens 50%, und bevorzugter mindestens 70% der Zellen in Aggregaten von dichten cytoplasmatischen sich teilenden Zellen enthält. Der gewünschte Typ der Suspensionskultur wird nach einer geeigneten Zeitspanne, üblicherweise nach etwa 7 Tagen, bevorzugt nach etwa 30 Tagen, erhalten. Die Bedingungen bezüglich Temperatur und Licht sind die gleichen wie für Stufe (a). Die Suspensionskultur wurde bei der ATCC, Rockville, Maryland, USA, hinterlegt und besitzt die Hinterlegungsnr. 40326 [Hinterlegungsdatum: 20. Mai 1987].

Daher betrifft die Erfindung ein Verfahren zur Erzeugung von Suspensionskulturen von Zea mays-Zellen und Zellaggregaten, aus denen Protoplasten isoliert werden können, wobei die Protoplasten sich zu fertilen Pflanzen regeneriert können, das dadurch gekennzeichnet ist, daß man in Stufen:

(a) Gewebe, das aus Zea mays-Pflanzen stammt, in einem geeigneten Medium mit der Fähigkeit, einen Kallus zu initiieren und/oder die Kallus-Proliferation zu unterhalten, bis ein spezieller Kallus-Typ, der relativ wenig schleimig, körnig und zerreibbar ist, identifiziert werden kann, züchtet;

(b) den speziellen Kallus-Typ auswählt;

(c) gegebenenfalls den speziellen Kallus-Typ auf einem geeigneten, einen Kallus unterhaltenden Medium subkultiviert;

(d) den speziellen Kallus-Typ in ein flüssiges Medium überführt, wodurch eine Suspension aus Zellen oder Zellaggregaten gebildet wird;

(e) die Suspension für eine geeignete Zeitspanne und mit einer Häufigkeit, die ausreicht, die Zellen und Zellaggregate in einem lebensfähigen Zustand zu erhalten, subkultiviert; und

(f) die Kulturen aus dem Produkt der Stufe (e), die Aggregate von dicht cytoplasmatischen sich teilenden Zellen enthalten, auswählt und zurückhält.

Die Protoplastenisolation wird durch Inkubieren des Kallus oder der Suspensionskulturen, Zellen und Zellaggregate (erhalten gemäß den vorstehenden Stufen (a) bis (d)) mit einem Enzympräparat, das die Zellwände entfernt, durchgeführt. Geeignete Enzympräparate sind auf dem Fachgebiet bekannt. Ein besonders geeignetes Enzympräparat ist beispielsweise ein Präparat, das 4% Gew./Vol. RS-Cellulase (Yakult Pharmaceutical Ind. Co. Ltd., Shingikan Cho, Nishimomiya, Japan) mit 1% Gew./Vol. Rhozym (Rohm und Haas, Philadelphia, PA., USA) in KMC-Salzlösung (8,65 g/l KCl; 12,5 g/l CaCl&sub2;.2H&sub2;O; 16,47 g/l MgSO&sub4;.7H&sub2;O; 5 g/l MES; pH 5,6) enthält. Die Spaltung wird zwischen 0ºC und 50ºC, bevorzugt zwischen 10ºC und 35ºC, am bevorzugtesten zwischen 26ºC und 32ºC, durchgeführt. Die Spaltung wird bis zur Freisetzung der Protoplasten fortgeführt. Die Zeit, die für die Spaltung benötigt wird, liegt typischerweise zwischen 30 Minuten und 5 Tagen, bevorzugt zwischen 1 Stunde und 1 Tag, am bevorzugtesten zwischen 3 und 5 Stunden.

Daher betrifft die Erfindung weiter ein Verfahren zur Erzeugung von Zea mays-Protoplasten mit der Fähigkeit zur Regeneration zu fertilen Pflanzen, das dadurch gekennzeichnet ist, daß man in Stufen

(a) Gewebe, das aus Zea mays-Pflanzen stammt, in einem geeigneten Medium mit der Fähigkeit, einen Kallus zu initiieren und/oder die Kallus-Proliferation zu unterhalten, bis ein spezieller Kallus-Typ, der relativ wenig schleimig, körnig und zerreibbar ist, identifiziert werden kann, züchtet;

(b) den speziellen Kallus-Typ auswählt;

(c) gegebenenfalls den speziellen Kallus-Typ auf einem geeigneten, einen Kallus unterhaltenden Medium subkultiviert;

(d) den speziellen Kallus-Typ in ein flüssiges Medium überführt, wodurch eine Suspensionen aus Zellen oder Zellaggregaten gebildet wird;

(e) die Suspension für eine geeignete Zeitspanne und mit einer Häufigkeit, die ausreicht, die Zellen und Zellaggregate in einem lebensfähigen Zustand zu erhalten, subkultiviert; und

(f) die Kulturen aus dem Produkt der Stufe (e), die Aggregate von dicht cytoplasmatischen, sich teilenden Zellen enthalten, auswählt und zurückhält; und

(i) den gemäß den vorstehenden Stufen (a) bis (c) erhältlichen Kallus entnimmt; oder

(ii) die gemäß den vorstehenden Stufen (d) bis (f) erhältlichen Kulturen entnimmt, wobei die Kulturen aus Aggregaten von dicht cytoplasmatischen, sich teilenden Zellen bestehen; und

(iii) die Zellwände mit geeigneten Enzympräparaten entfernt und die so erhaltenen Protoplasten sammelt und reinigt.

Stufe (e2) Behandlung der Protoplasten mit exogener DNA

Die Protoplasten können mit exogener DNA behandelt werden, um Zellen zu ergeben, die die gesamte exogene DNA oder einen Teil davon in stabiler Inkorporation in ihr genetisches Material enthalten. Exogene DNA ist jede DNA, die einem Protoplasten zugesetzt wird. Die exogene DNA kann einen in Zea mays aktiven Promotor enthalten oder kann einen bereits im Zea mays-Genom vorhandenen Promotor verwenden. Die exogene DNA kann ein chimäres Gen oder ein Teil davon sein. Die Behandlung der Protoplasten mit exogener DNA kann gemäß den in den folgenden Publikationen beschriebenen Methoden durchgeführt werden. [Paszkowski, J., et al., The EMBO Journal 3, Nr. 12 (1984) 2717-2722; Europäische Patentanmeldung EP-0 164 575, (Paszkowski, J., et al.); Shillito, R.D., et al., Bio/Technology, 3 (1985) 1099-1103; Potrykus, I., et al., Mol. Gen. Genet., 199 (1985) 183-188; Loerz, H., et al., Mol. Gen. Genet., 199 (1985) 178-182; Fromm, M.E., et al., Nature, 319 (1986) 791-793; Britische Patentanmeldung GB-2 140 822 (Mettler, I.J.); und Negrutiu, I., et al., Plant Mol. Biology, 8 (1987) 363-373].

Auf diese Publikationen wird hiermit Bezug genommen.

Die exogene DNA kann in jeder beliebigen Form, wie beispielsweise als nackte lineare oder kreisförmige DNA, in Liposome verkapselte DNA, Sphäroplasten-DNA, DNA in anderen Pflanzenprotoplasten, mit Salzen komplexierte DNA, DNA in Form von Nukleosomen, Chromosomen oder Zellkernen, oder Teile davon, etc. zugesetzt werden. Die Aufnahme der Fremd- DNA kann durch jedes geeignete auf dem Fachgebiet bekannte Verfahren einschließlich der in den vorstehend zitierten Literaturstellen beschriebenen Methoden stimuliert werden.

In erster Linie sind die erfindungsgemäß in Betracht gezogenen chimären Gene solche, die den transformierten Pflanzenprotoplasten, den von den Protoplasten abgeleiteten Geweben und schließlich den von den Protoplasten abgeleiteten Pflanzen neue phänotypische Eigenschaften (wertvolle Eigenschaften), wie erhöhte Resistenz gegenüber Schädlingen (z.B. Arthropoden einschließlich Insekten und Milben, Nematoden etc); erhöhte Resistenz gegenüber Krankheitserregern (z.B. gegenüber phytopathogenen Pilzen, Bakterien, Viren etc.); erhöhte Resistenz gegenüber Chemikalien [z.B. gegen Herbizide (wie Triazine, Carbamate, Harnstoffe, Dinitroanilide, Sulfonylharnstoffe, Imidazolinone, Triazolopyrimidine, Bialaphos, Glyphosat etc.), Insektizide oder andere Biozide]; erhöhte Resistenz gegenüber Cytotoxinen (z.B. Hygromycin, Kanamycin, Chloramphenicol etc.); erhöhte Resistenz gegenüber ungünstigen Umwelt-(edaphische oder atmosphärische) Einflüssen, z.B. gegenüber Hitze, Kälte, Wind, Bodenbedingungen, Feuchtigkeit, Dürre etc.); erhöhte Bildung von erwünschten Substanzen [z.B. in Blättern, Samen, Knollen, Wurzeln, Stielen etc. Erwünschte Substanzen, die von einer genetisch veränderten Pflanze produziert werden umfassen Proteine, Stärke, Zucker, Aminosäuren, Alkaloide, Geschmacks- und Geruchsstoffe, Farbstoffe, Fette etc.]; erniedrigte Bildung von unerwünschten Substanzen (z.B. Toxinen, Proteaseinhibitoren, unerwünschten Geschmacks- und Aromastoffen, unerwünschten Proteinen, Fetten, Kohlenhydraten oder sekundären Metaboliten etc.); oder veränderte morphologische oder entwicklungsbedingte phänotypische Eigenschaften (z.B. veränderte Höhe, Wachstumsgestalt, Form, Farbe, Robustheit, Blütezeit etc.) verleihen.

Die Resistenz gegenüber Cytotoxinen kann durch ein Gen verliehen werden, das in den Pflanzenzellen ein Enzym exprimiert, das das Cytotoxin detoxifiziert, beispielsweise Neomycin-Phosphotransferase-Typ-II oder Aminoglycosid-Phosphotransferase-Typ-IV zur Detoxifikation von Kanamycin, Hygromycin oder anderen Aminoglycosid-Antibiotika, oder eine Glutathion-S-Transferase oder Cytochrom-P-450 oder ein anderes kataboles Enzym, das bekanntlich Triazin, Sulfonylharnstoff oder andere Herbizide detoxifiziert. Die Resistenz gegenüber Cytotoxinen kann auch durch ein Gen verliehen werden, das in einer Pflanze eine Form eines "Zielenzyms" (Wirkstelle des Cytotoxins) exprimiert, das gegenüber dem Cytotoxin resistent ist, beispielsweise eine Form der Acetohydroxysäuresynthase, die gegenüber der Hemmung durch Sulfonylharnstoffe oder Imidazolinone oder ein anderes Herbizid, das auf diesen Stoffwechselweg einwirkt, unempfindlich ist, oder eine Form von 5-Enolpyruvylshikimat-3-phosphat-(EPSP)-Synthase, die gegenüber der Hemmung durch Glyphosphat unempfindlich ist. Es kann vorteilhaft sein, diese veränderten Zielenzyme in einer Form zu exprimieren, die ihren Transport in der Pflanzenzelle in das richtige celluläre Kompartment, z.B. den Chloroplasten in den vorstehenden Beispielen, erlauben.

In bestimmten Fällen ist es vorteilhaft, die Genprodukte zielgerecht in die Mitochondrien, die Vakuolen, in die endoplasmatischen Vesikel oder andere Zellteile oder selbst in die intercellulären (apoplastischen) Räume zu schleusen.

Die Resistenz gegenüber bestimmten Pilzklassen kann durch die Einschleusung eines Gens, das Chitinase in den Pflanzengeweben exprimiert, verliehen werden. Viele pflanzenpathogene Pilze enthalten Chitin als einen integralen Teil der Hyphen- und Sporenstruktur einschließlich Basidiomyceten (Rost- und Brandpilze) und Ascomyceten und imperfekten Pilze (einschließlich Alternaria und Bipolaris, Exerohilum turcicum, Celletotricum, Gleocercospora und Cercospora). Chitinase kann das Wachstum der Myzelien von bestimmten Krankheitserregern ffn vitro hemmen. Ein Pflanzenblatt oder eine Wurzel, die Chitinase exprimiert, ist vor vielen Typen von Angriffen durch Pilze geschützt.

Die Resistenz gegenüber Schädlingen kann durch ein Gen, das ein pestizides Polypeptid codiert, verliehen werden.

Die Resistenz gegenüber Arthropoden kann beispielsweise durch ein Gen, das ein Polypeptid codiert, das für die Larven- oder Imagostadien toxisch ist, oder die Pflanze für die Larven unattraktiv macht, da sie ihre Futteraufnahme einstellen, verliehen werden. Ein geeignetes Gen in diesem Zusammenhang ist das kristalline Protein von Bt. Eine zweite Klasse von Proteinen, die Insektenresistenz verleihen, sind die Proteaseinhibitoren. Proteaseinhibitoren sind übliche Bestandteile der pflanzlichen Speicherstrukturen [Ryan, C., Ann. Rev. Plant Physiol., 24 (1973) 173-196]. Die Hemmung der Insektenentwicklung wurde dem Vorhandensein von Trypsininhibitoren im Futter zugeschrieben [Lipke, H., Fraenkel, G.S. und Liener, I.E., J. Agr. Food Chem. 2 (1954) 410-414]. von dem gereinigten Bowman-Birk-Proteaseinhibitor, der aus Sojabohnen isoliert wurde, wurde gezeigt, daß er die Proteasen des Verdauungskanals von Tenebrio-Larven hemmt [Birk, Y., Gertler, A., und Khalef, S., Biochem. Biophys. Acta, 67 (1963) 326-328]. Das Gen, das den Cowpea-Trypsininhibitor codiert, wurde von Hilder et al. [Nature, 330 (1987) 160-163] beschrieben.

Ein Gen, das einen Proteaseinhibitor codiert, kann unter die Kontrolle eines Pflanzenpromotors, bevorzugt eines konstitutiven Promotors, wie des Blumenkohl-Mosaikvirus- (CaMV)35S-Promotors, in einem geeigneten Vektor, wie in dem pCIB710-Vektor, der nachstehend beschrieben wird, gegeben werden.

Das Gen, beispielsweise die codierende Sequenz für den Sojabohnen-Bowman-Birk-Proteaseinhibitor, kann unter Verwendung von cDNA-Clonierungsmethoden, die von Hammond et al., [J. Biol. Chem., 259 (1984) 9883-9890] beschrieben wurden, erhalten werden. Der geeignete Clon kann entweder durch Immunpräzipitation von ausgewählter Hybrid-mRNA, wie von Hammond et al. beschrieben, oder durch Absuchen mit einem synthetischen Oligonukleotid, das 50 oder mehr Basen vom 5'- Ende der aus der Aminosäuresequenz vorhergesagten codierenden Sequenz enthält, unter wenig stringenten Bedingungen identifiziert werden [die Aminosäuresequenzen sind in Fasman, G., Handbook of Biochemistry and Molecular Biology, 2 (1976) 611-620] zusammengestellt. Beispielsweise wird zur Clonierung des Gens für den Sojabohnen-Kunitz-Trypsininhibitor das folgende Oligonukleotid als Sonde verwendet:

Sonde

Das clonierte DNA-Fragment kann unter Verwendung beispielsweise des Maxam-und-Gilbert-Verfahrens [Methods Enzymol., 65 (1980) 499-560] und der identifizierten Translations- Startstelle sequenziert werden. Wenn das clonierte DNA- Fragment länger als die codierende Sequenz ist, dann werden die zusätzlichen 5'- und 3'-Sequenzen mit Bal31 gespalten. Wenn das clonierte DNA-Fragment kürzer als die codierende Sequenz ist, dann wird die clonierte DNA als Primer für die Primerextension mit mRNA verwendet [Maniatis et al., Molecular Cloning: A Laboratory Manual, (1982), Cold Spring Harbor, N.Y.] und die extendierte DNA wird recloniert..

Geeignete Linker werden an die das Protein codierende DNA angefügt, und das Fragment wird in den gewählten Vektor (Kassette), beispielsweise pCIB710 , insertiert, so daß das Gen unter der Kontrolle des gewünschten Promotors steht (CaMV35S in pCIB710).

Ein alternatives Verfahren zum Erhalt eines Gens für Proteaseinhibitoren mit weniger als 100 Aminosäuren, wie den Limabohnen-Trypsininhibitor, ist dessen Synthese. Die codierende Sequenz wird durch Rücktranslation vorhergesagt und für den gewünschten Vektor geeignete Restriktionsspaltstelle werden an jedem Ende aufgenommen. Das synthetische Gen wird durch Synthese von überlappenden Oligonukleotiden von 30 bis 60 Basen hergestellt. Diese Fragmente werden kinasiert, ligiert [Maniatis et al, a.a.O.] und in den geeigneten Vektor cloniert.

Ein Clon, dessen Insertion in der korrekten Orientierung ist, kann durch Sequenzieren identifiziert werden. Die Plasmid-DNA wird isoliert und zur Einschleusung in die Maisprotoplasten verwendet.

Daher betrifft die Erfindung auch ein Verfahren, bei dem das unter Stufen (a) bis (g) beschriebene Verfahren weiterhin die Stufe:

(e2) Behandlung der Protoplasten der Stufe (e1) mit der Fähigkeit, zu fertilen Pflanzen regeneriert zu werden, mit exogener DNA, um Zellen zu produzieren, die die ganze exogene DNA oder einen Teil davon in stabiler Inkorporation in ihr genetisches Material enthalten, umfaßt.

Zea mays-Protoplasten oder von Protoplasten abgeleitete Zellen (nach Regeneration der Zellwand) mit der Fähigkeit zur Regenerierung zu fertilen Pflanzen und insbesondere Zea mays-Protoplasten und Zellen, in die stabil exogene DNA, bevorzugt in Zea mays exprimierbare exogene DNA inkorporiert ist, sind weiter bevorzugte Gegenstände der Erfindung.

Besonders bevorzugt sind Zea mays-Protoplasten oder von Protoplasten abgeleitete Zellen (nach Regeneration der Zellwand), in denen die exogene DNA, normalerweise ein chimäres Gen, der transformierten Pflanze eine wertvolle Eigenschaft, wie eine erhöhte Resistenz gegenüber Schädlingen (z.B. Arthropoden einschließlich Insekten und Milben, Nematoden etc.); erhöhte Resistenz gegenüber Krankheitserregern (z.B. gegenüber phytopathogenen Pilzen, Bakterien, Viren etc.); erhöhte Resistenz gegenüber Chemikalien [z.B. gegenüber Herbiziden (wie Triazine, Carbamate, Harnstoffe, Dinitroanilide, Sulfonylharnstoffe, Imidazolinone, Triazolipyrimidine, Bialaphos, Glyphosat etc.), Insektiziden oder anderen Bioziden]; erhöhte Resistenz gegenüber Cytotoxinen (z.B. gegen Hygromycin, Kanamycin, Chloramphenicol etc.); erhöhte Resistenz gegenüber umweltbedingten (edaphischen oder atmosphärischen) Einflüssen (z.B. gegenüber Hitze, Kälte, Wind, Bodenbedingungen, Feuchtigkeit, Dürre etc.); £rhöhte Bildung von erwünschten Substanzen [beispielsweise in den Blättern, Samen, Knollen, Wurzeln, Stengeln etc. Erwünschte Substanzen, die von einer genetisch veränderten Pflanze produziert werden, umfassen Proteine, Stärken, Zucker, Aminosäure, Alkaloide, Geschmacks- und Aromastoffe, Farbstoffe, Fette etc.]; erniedrigte Bildung unerwünschter Substanzen (beispielsweise Toxine, Proteaseinhibitoren, unerwünschte Duft- und Aromastoffe, unerwünschte Proteine, Fette, Kohlehydrate oder sekundäre Metaboliten etc.); oder modifizierte morphologische oder entwicklungsbedingte phänotypische Eigenschaften (z.B. veränderte Größe, Wachstumszustand, Form, Farbe, Robustheit, Blütezeit etc.) verleiht.

Besonders bevorzugt innerhalb der transgenen Zea mays-Protoplasten oder der von den Protoplasten abgeleiteten Zellen sind diejenigen Protoplasten oder Zellen, in denen die stabil inkorporierte exogene DNA ein chimäres Gen ist, das ein Polypeptid codiert, das im wesentlichen die insektentoxischen Eigenschaften (insektizide Aktivität) eines kristallinen Bt-Proteins codiert.

Stufe (f) Plattierung der Protoplasten

Die Protoplasten werden zur Kultur entweder mit oder ohne Behandlung mit DNA in einem flüssigen oder einem verfestigten Kulturmedium plattiert. Einige Beispiele für geeignete Kulturmedien umfassen ohne Beschränkung diejenigen auf der Basis von KM-Medium N6-Medium, B5-Medium und NS-Medium mit geeigneten Konzentrationen an Zucker und Pflanzenwachstumsregulatoren. Das bevorzugte Medium ist das KM-Medium, das ein Verfestigungsmittel enthält. Das bevorzugte Verfestigungsmittel ist Agarose, insbesondere SeaPlaque -Agarose [Europäische Patentanmeldung EP-0 129 668, Shillito, R.D., et al., (1984)]. Sofern verwendet, kann die Konzentration an SeaPlaque -Agarose zwischen 0,1% und 2,5% (Gew./Vol.), bevorzugt zwischen 0,6% und 1,5% (Gew./Vol.) liegen. Die optimale Konzentration der anderen Verfestigungsmittel kann variieren, aber kann leicht bestimmt werden.

Das Medium, in dem die Protoplasten üblicherweise gezüchtet werden, enthält geeignete Pflanzenwachstumsregulatoren (Auxine und/oder Cytokinine etc.), um die Teilung und die Koloniebildung der Protoplasten zu unterstützen. Geeignete Pflanzenwachstumsregulatoren umfassen ohne Beschränkung 2,4-Dichlorphenoxyessigsäure (2,4-D), 3,6-Dichlor-2-methoxybenzoesäure (Dicamba), 4-Amino-3,6,6-trichlorpicolinsäure (Picloram) und para-Chlorphenoxyessigsäure (pCPA). Die Menge des Wachstumsregulators ist eine für die Regulation des Wachstums effektive nichttoxische Menge. Die Konzentration solcher Pflanzenwachstumsregulatoren liegt üblicherweise im Bereich von 0,01 bis 100 mg/l, bevorzugt 0,1 bis 100 mg/l, bevorzugter 0,1 bis 10 mg/m, am bevorzugtesten 0,3 bis 3 mg/l.

Überraschenderweise wurde gefunden, daß o-niedrig-Alkanoylsalicylsäure (o-Acetylsalicylsäure und ihre Homologe) allein oder in Kombination mit Pflanzenwachstumsregulatoren und/oder DMSO die Teilung von oder die Koloniebildung aus Pflanzenprotoplasten, bevorzugt Protoplasten von Zea mays, fördert. Der Ausdruck "Niedrigalkanoyl" bedeutet Alkanoylgruppen mit 1 bis 7, bevorzugt 1 bis 4, bevorzugter 2 bis 3, Kohlenstoffatome.

Bevorzugte o-niedrig-Alkanoylsalicylsäuren sind o-Acetylsalicylsäure und o-Propionylsalicylsäure, bevorzugt o-Acetylsalicylsäure.

Die Menge an o-niedrig-Alkanoylsalicylsäure ist eine Menge, die ausreicht, die Zellteilung oder die Koloniebildung zu fördern. Es ist bevorzugt eine zur Wachstumsregulatation effektive nichttoxische Menge. Geeignete Konzentrationen der o-niedrig-Alkanoylsalicylsäure liegen im Bereich von 0,1 bis 3000 mg/l, bevorzugt im Bereich von 10 bis 300 mg/l, bevorzugter 10 bis 100 mg/l, und am bevorzugtesten etwa 100 mg/l.

Die Menge an DMSO ist eine Menge, die ausreicht, die Zellteilung oder Koloniebildung zu fördern. Geeignete Konzentrationen an DMSO sind im Bereich von 0 bis 3%, bevorzugt 0,01 bis 2%, bevorzugter 0,01 bis 1%.

Daher wurde im Rahmen der Erfindung gefunden, daß die Teilung von oder Koloniebildung aus Pflanzenprotoplasten, bevorzugt Zea mays-Protoplasten, dadurch erhöht werden kann, daß man die Protoplasten in Gegenwart einer zur Wachstumsregulation effektiven nichttoxischen Menge einer o-niedrig- Alkanoylsalicylsäure züchtet, die ausreicht, um die Zellteilung oder Koloniebildung zu fördern.

Gemäß einer bevorzugten Ausführungsform der Erfindung umfaßt das Verfahren weiterhin das Vorhandensein von 0,01 bis 100 mg/l, bevorzugt 0,1 mit 100 mg/l, bevorzugter 0,1 bis 10 mg/l, am bevorzugtesten 0,3 bis 3 mg/l, eines Pflanzenwachstumsregulators.

In einer weiteren bevorzugten Ausführungsform der Erfindung umfaßt das Verfahren weiter das Vorhandensein einer Menge von DMSO, die ausreicht, um die Zellteilung oder Koloniebildung zu fördern. Bevorzugte Mengen an DMSO liegen zwischen 0 und 3%, bevorzugt 0,01 und 2%, bevorzugt zwischen 0,1 und 1%.

Dieses Verfahren zur Erhöhung der Teilung von oder Koloniebildung aus Protoplasten eignet sich für alle Pflanzenprotoplasten und ist nicht auf Zea mays beschränkt. Es ist besonders geeignet für die Angiospermae und Gymnospermae, beispielsweise die folgenden Pflanzenfamilien: Solanaceae, Cruciferae, Compositae, Liliaceae, Vitaceae, Chenopodiaceae, Rutaceae, Bromeliaceae, Rubidiaceae, Theaceae, Musaceae oder Graminaceae und die Ordnung der Leguminosen, insbesondere der Familie der Papilionaceae. Bevorzugte Pflanzen sind Vertreter der Solanaceae, Cruciferae und Gramineae.

Das Mediuin, in dem die Protoplasten gezüchtet werden, kann ein Medium enthalten, das zuvor durch das Wachstum geeigneter Zellen, beispielsweise Zea inavs oder Dactylis glomerata konditioniert wurde.

Die Protoplasten können in dein festen oder dem flüssigen Medium ohne Subkultur für eine Zeitspanne von bis zu 12 Wochen, bevorzugt bis zu 6 Wochen, bevorzugter im Bereich von 3 bis 4 Wochen, gezüchtet werden. Alternativ kann ein festes Medium anstelle des flüssigen Mediums verwendet werden, wie in der Europäischen Patentanmeldung EP-0 129 668, Shillito, R.D., et al., (1984) beschrieben, oder es kann auf irgendeine andere Art behandelt werdend um die Teilung von und/oder Koloniebildung aus den Protoplasten zu unterstützen. Ein geeignetes Verfahren ist die Züchtung zusammen mit Nährzellen, wie von Shneyour et al. [Plant Science Lett., 33 (1984) 293] und Smith et al. [Plant Science Lett., 36 (1984) 67] und in Beispiel 8 beschrieben.

Die Protoplasten werden in Licht oder bevorzugt bei Dunkelheit bei einer Temperatur zwischen 0ºC und 50ºC, bevorzugt zwischen 20ºC und 32ºC, am bevorzugtesten zwischen 25ºC und 28ºC, gezüchtet. Die Lichtintensität liegt typischerweise zwischen 0,1 und 200 uE/m²sec (mikroEinstein/m²Sekunde), bevorzugt zwischen 0,1 und 100 uE/m²sec, bevorzugt zwischen 30 und 90 uE/m²sec, am bevorzugtesten zwischen 10 und 40 uE/m² sec.

Die Figur 4 zeigt Kalli, die sich aus in festem Medium gezüchteten Protoplasten entwickeln, und die Figur 5 zeigt einen Kallus, der aus Protoplasten gemäß Stufe (f) abgeleitet ist. Dieser Kallus kann auf einem Erhaltungsmedium, wie für den Kallus in Stufe (a) beschrieben, subkultiviert werden und dann auf einem Regenerationsmedium gemäß Stufe (e) subkultiviert werden oder kann direkt auf einem Regenerationsmedium gemäß Stufe (e) subkultiviert werden.

Stufe (g) Regeneration eines Setzlings

Ein Kallus, der sich aus Protoplasten gemäß Stufe (f) bildet, wird ein oder mehrmals auf geeigneten Medien subkultiviert, um eine fertile Pflanze zu regenerieren. Einige Beispiele für geeignete Kulturmedien umfassen ohne Beschränkung diejenigen auf der Basis von N6-Medium, B5-Medium, MS- Medium oder KM-Medium mit geeigneten Konzentration an Zuckern, Pflanzenwachstumsregulatoren und gegebenenfalls DMSO. Ein bevorzugtes Medium ist das N6-Medium ohne Wachstumsregulatoren oder unter Einschluß eines Cytokinins und/oder anderer Pflanzenwachstumsregulatoren, die die Regeneration von Setzlingen stimulieren und/oder unter Einschluß einer o-niedrig-Alkanoylsalicylsäure, gegebenenfalls in weiterer Kombination mit DMSO, wie vorstehend in Stufe (f) beschrieben. Der Kallus scheint differenzierte Zellen und Zellaggregate (Figur 6) nach einer geeigneten Zeitspanne, typischerweise 1 Woche bis 6 Monaten, noch typischerweise 1 bis 3 Monaten, zu enthalten. Der Kallus differenziert sich weiter unter Bildung eines Pflänzchens nach einer geeigneten weiteren Zeitspanne, typischerweise 1 Wocüe bis 6 Monaten, noch typischerweise 1 bis 3 Monaten.

Der Kallus wird in diesem Stadium im Licht gezüchtet. Die Lichtintensität liegt typischerweise zwischen 0,1 und 100 uE/m²sec, bevorzugt zwischen 30 und 80 uE/m²sec.

Besonders bevorzugt ist ein Verfahren, bei dem die Zellen oder Kallus Embryonen oder Proembryonen vor der Regeneration zu Setzlingen bildet.

Stufe (h) Erhalt einer fertilen Pflanze aus einem Setzling

Die Setzlinge werden in ein geeignetes Medium, beispielsweise N6-Medium ohne Pflanzenwachstumsregulatoren überführt, Alternativ kann ein Wachstumsregulator, der das Wachstum der Wurzel oder des Schößlings stimuliert, zugesetzt werden. Die Setzlinge werden auf diesem Medium bis zur Wurzelbildung gezüchtet. Die Zeit, die für die Wurzelbildung benötigt wird, ist typischerweise 1 bis 6 Wochen, noch typischerweise etwa 2 Wochen. Wenn die Wurzel und der Schößling ausreichend gewachsen sind, werden die Pflanzen in Boden überführt und sanft abgehärtet. Eine aisreichende Länge der Wurzeln zu diesem Zeitpunkt liegt im Bereich von 1 bis 10 cm, typischerweise 2 bis 5 cm, und für den Schößling im Bereich von 1 bis 15 cm, typischerweise 2 bis 10 cm.

Die Pflanzen werden bis zur Blütebildung gezüchtet, und sexuelle Nachkommen oder vegetative Vermehrungseinheiten werden auf übliche Weise erhalten.

Die transgenen Maispflanzenzellen, die exogene DNA enthalten, können in Kultur gehalten werden oder zu Pflanzen regeneriert werden Maispflanzenzellen, in die exogene DNA eingeschleust werden kann, umfassen jede Maispflanzenzelle mit der Fähigkeit zur Aufnahme, Replikation und Expression von Fremdgenen in einer geeigneten Menge. Einige geeignete Maispflanzenzellen umfassen beispielsweise Zellen, die aus den Inzuchtlinien von Funk 5N984, Funk 5N986, Funk 2717, Funk 211D, Funk 2N217A, B73, A632, CM105, B37, B84, B14, Mo17, R168, MS71, A188, FA91, A641 und W117 isoliert wurden. Bevorzugt sind alle Elitegenotypen. Noch bevorzugter sind alle Inzuchtlinien. Am meisten bevorzugt sind alle Eliteinzuchtlinien, insbesondere die Eliteinzuchtlinien Funk 5N984, Funk 5N986, Funk 2717, Funk 211D oder Funk 2N217A, und am meisten bevorzugt Funk 2717.

Das Kulturmedium mit der Fähigkeit, eine spezielle Pflanzenzelle in Kultur aufrechtzuerhalten, kann von dem Genotyp der verwendeten Maispflanzenzelle abhängen. Beispielsweise umfassen einige geeignete Medien ohne Beschränkung diejenigen auf dar Basis von MS- [Murashige und Skoog (1962)], N6- [chu et al. (1975)]; B5- [Gamborg et al. (1968)]; und KM- (Kao und Michayluk (1975)] Medien mit geeigneten Konzentrationen an Zuckern und Pflanzenwachstumsregulatoren.

So betrifft die Erfindung ein Verfahren zur Regeneration von Zea mays-Pflanzen aus Protoplasten, das dadurch gekennzeichnet ist, daß man in Stufen:

(e1) Protoplasten mit der Fähigkeit, zu fertilen Pflanzen aus dem Kallus der Stufe (c) oder aus Zellen und Zellaggregaten aus Stufe (d) regeneriert zu werden, erzeugt,

(f) die Protoplasten in ein geeignetes Medium plattiert, in dem sich die Protoplasten teilen und Zellen bilden,

(g) die aus Stufe (f) hervorgehenden Zellen subkultiviert, um Setzlinge zu regenerieren, und

(h) die Setzlinge auf einem Wachstummedium züchtet, um fertile Pflanzen zu erhalten.

Bevorzugt ist ein Verfahren, bei dem die Zea mays-Protoplasten in stabiler Inkorporation exogener DNA, bevorzugt in Zea mays-Pflanzen exprimierbare exogene DNA, enthalten. Bevorzugter ist ein Verfahren, bei dein die Zea mays-Protoplasten in Gegenwart von 0,01 bis 100 mg/l eines Pflanzenwachstumsregulators (bevorzugt 2,4-D, Dicamba, Picloram oder pCPA, am meisten bevorzugt 2,4-D) und in Gegenwart einer Menge an o-niedrig-Alkanoylsalicylsäure (bevorzugt o- Acetylsalicylsäure oder o-Propionylsalicylsäure, am meisten bevorzugt o-Acetylsalicylsäure), die ausreicht die Zellteilung oder Koloniebildung zu fördern, gezüchtet werden. Am meisten bevorzugt ist ein Verfahren, das weiterhin die Anwesenheit einer Menge an DMSO, die ausreicht, die Zellteilung oder Koloniebildung zu fördern, umfaßt.

Die Erfindung betrifft auch ein Verfahren zur Erzeugung von transgenen Zea mays-Protoplasten mit der Fähigkeit, zu fertilen transgenen Pflanzen regeneriert zu werden, bei dem man Zea mays-Protoplasten, mit der Fähigkeit, zu fertilen Pflanzen regeneriert zu werden, mit exogener DNA behandelt, um Zellen zu erzeugen, die die Gesamtheit oder einen Teil der exogenen DNA in ihr genetisches Material inkorporiert enthalten.

Als Ergebnis des erfindungsgemäßen Verfahrens können Zea mays-Pflanzen und Vermehrungseinheiten davon als Protoplasten oder von Protoplasten abgeleiteten Zellen erhalten werden. Bevorzugt sind diejenigen regenerierten Pflanzen, Vermehrungseinheiten oder Nachkommen davon, in die stabil exogene DNA, bevorzugt exogene DNA, die in Zea mays exprimierbar ist, eingebaut ist. Geeignete exogene DNAs sind beispielsweise die vorstehend oder nachstehenden beschriebenen chimären Gene. Der Ausdruck "Vermehrungseinheiten" umfaßt jedes Pflanzenmaterial, das sexuell oder asexuell vermehrt werden kann, oder in vivo oder in vitro vermehrt werden kann. Solche Vermehrungseinheiten bestehen bevorzugt aus den Protoplasten, Zellen, Kalli, Geweben, Embryonen oder Samen der regenerierten Pflanzen. Die Nachkommen der regenerierten Pflanzen und der regenerierten transgenen Pflanzen umfassen Mutanten und Varianten.

(TEIL B) INSEKTIZIDE MAIS-(ZEA MAYS)PFLANZEN

Die Erfindung betrifft Zea mays-Protoplasten mit der Fähigkeit, zu fertilen Pflanzen zu regenerieren, in die stabil exogene DNA, bevorzugt ein chimäres Bt-Toxingen, inkorporiert ist. Die betrachteten Maispflanzenzellen umfassen Zellen von allen Genotypen (Varietäten, Züchtungssorten, Inzuchtlinien, Hybriden etc.) von Maispflanzen, in die Fremd-DNA eingeführt, repliziert und exprimiert werden kann. Einige Beispiele für geeignete Maispflanzen-Genotypen umfassen ohne Beschränkung Inzuchtlinien, wie Funk 2717, Funk 211D, Funk 2N217A, B73, A632, CM105, B37, B84, B14, Mo17, R168, MS71, A188, FA91, A641 und W117. Funk 5N984 und Funk 5N986 sind weitere Beispiele von nützlichen Zea mays- Genotypen. Bevorzugt ist der Genotyp ein Elitegenotyp, noch bevorzugter eine Eliteinzuchtlinie, ausgewählt aus der Gruppe, bestehend aus Funk 5N984, Funk 5N986, Funk 2717, Funk 211D oder Funk 2N217A, und am meisten bevorzugt ist die Eliteinzuchtlinie Funk 2717.

Das erfindungsgemäße chimäre Gen enthält eine Promotorregion, die effizient in Maispflanzen funktioniert und eine codierende Region, die das kristalline Protein aus Bt oder ein Polypeptid mit im wesentlichen den insektiziden Eigenschaften des kristallinen Proteins von Bt codiert. Die codierende Sequenz des chimären Gens ist bekanntlich mit dem Promotor in natürlichen Genen nicht verknüpft.

Die 5'- und/oder 3'-nichttranslatierten Regionen können unabhängig voneinander in der Natur mit entweder dem Promotor oder der codierenden Region oder weder mit dem Promotor noch der codierenden Region verknüpft sein. Bevorzugt ist entweder die 5'- oder die 3'-nichttranslatierte Region mit dem Promotor in natürlichen Genen verknüpft und am meisten bevorzugt sind sowohl die 5'- als auch die 3'-Regionen mit dem Promotor in natürlichen Genen verknüpft.

Aufgrund des Stands der Technik zur Zeit der Konzeption der Erfindung konnte man nicht vorhersagen, daß Maiszellen ein insektizides Polypeptid in irgendeinem Gehalt und insbesondere in ausreichenden Gehalten, um den Zellen insektizide Eigenschaften zu verleihen&sub1; exprimieren würden. Insbesondere wurde erwartet, daß ein Polypeptid von der Größe und Unlöslichkeit des Polypeptids mit den insektentoxischen Eigenschaften des kristallinen Bt-Proteins besonders schwierig in Pflanzenzellen zu exprimieren sein würde.

Um als insektizid zu gelten, muß die Pflanzenzelle ein insektizide Menge des Toxins mit im wesentlichen der insektiziden Aktivität des kristallinen Proteins von Bt enthalten. Eine insektizide Menge ist eine Menge, die bei Vorhandensein in Pflanzenzellen Insektenlarven abtötet oder mindestens ihre Nahrungsaufnahme wesentlich verringert.

Das Gen Die Transkriptions-Kontrollsequenz

Das erfindungsgemäße zu verwendende chimäre Gen enthält Transkriptions-Kontrollsequenzen, die einen Promotor und 5'- und 3'-nichttranslatierte Sequenzen umfassen, die in Maispflanzen funktionell sind. Diese Sequenzen können unabhängig voneinander aus jeder beliebigen Quelle, wie Viren-, Pflanzen- oder Bakteriengenen abgeleitet sein.

Die Viruspromotoren und die 5'- und 3'-nichttranslatierten Sequenzen, die sich für die Verwendung eignen, sind in Maispflanzen funktionell und werden beispielsweise aus Pflanzenviren, wie Blumenkohl-Mosaikviren (CaMV) erhalten. Das Blumenkohl-Mosaikvirus wurde von Hohn et al. in Current Topics in Microbiology and Immunology, 96, (1982) 194-220 und den Anhängen A bis G charakterisiert und beschrieben. Auf diese Beschreibung wird hiermit Bezug genommen.

CaMV ist ein atypisches Pflanzenvirus dahingehend, daß es doppelsträngige DNA enthält. Mindestens zwei CaMV-Promotoren sind in Pflanzen funktionell, d.h. der 19S-Promotor, der zur Transkription des Gens VI von CaMV führt, und der Promotor des 35S-Transkripts. Der 19S-Promotor und der 35S- Promotor sind die bevorzugten Pflanzenviruspromotoren zur erfindungsgemäßen Verwendung.

Die CaMV-195-Promotoren und die 5'-nichttranslatierten Regionen können mittels einer Restriktionskarte, wie der in Figur 4 auf Seite 199 des vorstehend erwähnten Artikels von Hohn et al. beschrieben, oder aus der Sequenz, die in Anhang C des Artikels von Hohn et al. angegeben ist, erhalten werden.

Um den CaMV-19S-Promotor und gegebenenfalls die benachbarte 5'-nichttranslatierte Region zu erhalten, wird ein Restriktionsfragment des CaMV-Genoms, das die gewünschten Sequenzen enthält, ausgewählt. Ein geeignetes Restriktionsfragment, das den 195-Promotor und die 5'-nichttranslatierte Region enthält, ist das Fragment zwischen der PstI-Spaltstelle, beginnend mit Position 5386, und der HindIII-Spaltstelle, beginnend mit Position 5850, von Figur 4 und Anhang C des Artikels von Hohn et al.

Nach analogen Verfahren kann der 35S-Promotor aus CaMV wie in Beispiel nachstehend beschrieben erhalten werden.

Unerwünschte Nukleotide in dem Restriktionsfragment können gegebenenfalls durch Standardmethoden entfernt werden. Einige geeignete Methoden zur Deletion unerwünschter Nukleotide umfassen die Verwendung von Exonukleasen [Maniatis et al., Molecular Cloning, Cold Spring Harbor Laboratory, (1982) 135-139] und die Oligonukleotid-gerichtete Mutagenese [Zoller und Smit, Meth. Enzymol., 100 (1983) 468-500].

Ein ähnliches Verfahren kann verwendet werden, um eine gewünschte 3'-nichttranslatierte Region zu erhalten. Beispielsweise kann eine geeignete 3'-nichttranslatierte Sequenz des CaMV-195-Gens durch Isolieren der Region zwischen der EcoRV-Spaltstelle in Position 7342 und der BglII-Spaltstelle in Position 7643 des CaMV-Genoms, wie in Figur 4 und Anhang C des Artikels von Hohn et al. beschrieben, erhalten werden.

Beispiele der Pflanzengenpromotoren und der 5'- und 3'- nichttranslatierten Region mit der Eignung zur Verwendung gemäß der Erfindung umfassen auch diejenigen des Gens, das die kleine Untereinheit der Ribulosebisphosphat-Carboxylase und des Chlorophyll-a/b-bindenen Proteins codiert. Diese Pflanzengenregionen können aus Pflanzenzellen auf Arten isoliert werden, die denjenigen vergleichbar sind, die vorstehend zur Isolierung der entsprechenden Regionen aus CaMV beschrieben wurden; vergleiche Morelli et al., Nature, 315 (1985) 200-204.

Geeignete Promotoren und 5'- und 3'-nichttranslatierte Regionen aus bakteriellen Genen umfassen diejenigen, die in der T-DNA-Region von Agrobacterium-Plasmiden vorhanden sind. Einige Beispiele von geeigneten Agrobacterium-Plasmiden umfassen das Ti-Plasmid von A. tumefaciens und das Ri- Plasmid von A. rhizogenes. Die Agrobacterium-Promotoren und die 5'- und 3'-nichttranslatierten Regionen, die erfindungsgemäß nützlich sind, sind insbesondere diejenigen, die in den Genen, die die Octopinsynthase und Nopalinsynthase codieren, vorhanden sind. Diese Sequenzen können nach Methoden erhalten werden, die denjenigen ähnlich sind, die vorstehend zur Isolierung von CaMV- und Pflanzenpromotoren und nichttranslatierten Sequenzen beschrieben wurden; vergleiche Bevan et al., Nature 304 (1983) 184-187.

Die codierende Region

Die codierende Region des chimären Gens enthält eine Nukleotidsequenz, die ein Polypeptid mit im wesentlichen den Toxizitätseigenschaften eines kristallinen Bt-delta-Endotoxin-Proteins codiert. Ein Polypeptid besitzt für die Zwecke der Erfindung im wesentlichen die Toxizitätseigenschaften eines kristallinen Bt-delta-Endotoxin-Proteins, wenn es gegenüber einem ähnlichen Insektenlarvenspektrum, wie das kristalline Protein aus eine Unterart von Bt insektizid ist. Einige geeignete Unterarten umfassen beispielsweise Bt var. kurstaki; Bt var. berliner; Bt var. alesti; Bt var. tolworthi; Bt var. sotto; Bt var. dandrolimus; Bt var. tenebrionis; Bt var. san diego; und Bt var. aizawai. Die bevorzugte Unterart ist Bt var. kurstaki und insbesondere Bt var. kurstaki HD1.

Die codierende Region kann natürlicherweise in Bt vorkommen. Alternativ kann die codierende Region eine Sequenz enthalten, die sich von der Sequenz unterscheidet, die in Bt vorkommt, aber wegen der Degeneriertheit des genetischen Codes äquivalent ist.

Die codierende Sequenz des chimären Gens kann auch ein Polypeptid codieren, das sich von einem natürlich vorkommenden kristallinen delta-Endotoxin-Proteins unterscheidet, aber immer noch im wesentlichen die insektentoxischen Eigenschaften des kristallinen Proteins besitzt. Eine solche codierende Sequenz ist üblicherweise eine Variante einer natürlichen codierenden Region. Eine "Variante" einer natürlichen DNA-Sequenz ist eine modifizierte Form der natürlichen Sequenz, die die gleiche Funktion erfüllt. Die Variante kann eine Mutation oder eine synthetische DNA-Sequenz sein und ist im wesentlichen der entsprechenden natürlichen Sequenz homolog. "Wesentliche Sequenzhomologie" sollte so verstanden werden, daß sie entweder ein DNA-Fragment mit einer Nukleotidsequenz, die einem anderen DNA-Fragment ausreichend ähnlich ist, um ein Protein mit ähnlichen Eigenschaften zu erzeugen, oder ein Polypeptid mit einer Aminosäuresequenz, die einem anderen Polypeptid ausreichend ähnlich ist, um ähnliche Eigenschaften zu zeigen, umfaßt. Normalerweise ist eine DNA-Sequenz einer zweiten DNA-Sequenz im wesentlichen homolog, wenn mindestens 70%, bevorzugt mindestens 80% und am meisten bevorzugt mindestens 90% der aktiven Teile der DNA-Sequenz homolog sind. Zwei verschiedene Nukleotide gelten in einer DNA-Sequenz einer codierenden Region zur Bestimmung einer wesentlichen Homologie als homolog, wenn der Austausch der einen gegen die andere eine stumme Mutation darstellt.

Erfindungsgemäß kann jedes chimäre Gen verwendet werden, das eine Sequenz von Aminosäuren codiert, die die insektiziden Eigenschaften besitzt, die die offenbarten und beanspruchten Erfordernisse erfüllt. Es ist bevorzugt, daß die Nukleotidsequenz mindestens dem Teil oder den Teilen der natürlichen Sequenz, die für die insektizide Aktivität verantwortlich sind, homolog ist.

Das durch das erfindungsgemäße chimäre Gen exprimierte Polypeptid teilt im allgemeinen auch mindestens einige immunologische Eigenschaften mit einem natürlichen kristallinen Bt-Protein, da es mindestens einige der gleichen antigenen Determinanten besitzt.

Folglich ist das von dem erfindungsgemäßen chimären Gen codierte Polypeptid bevorzugt strukturell mit dem delta-Endotoxin des von Bt produzierten kristallinen Proteins verwandt. Bt produziert ein kristallines Protein mit einer Untereinheit, die ein Protoxin mit einem MG von etwa 130.000 bis 140.000 ist. Diese Untereinheit kann durch Proteasen oder durch Alkali unter Bildung von insektiziden Fragmenten mit einem MG von nur 50.000 und möglicherweise noch niedriger gespalten werden. Chimäre Gene, die solche Fragmente des Protoxins oder sogar kleinere Teile davon codieren, können erfindungsgemäß konstruiert werden, solange das Fragment oder die Teile der Fragmente die benötigte insektizide Aktivität besitzen. Das Protoxin, die insektiziden Fragmente des Protoxins und die insektiziden Teile dieser Fragmente können an andere Moleküle, wie Polypeptide, fusioniert werden.

Codierende Regionen, die sich für die erfindungsgemäße Verwendung eignen, können aus kristallinen Protein-Toxingenen, die aus Bt isoliert wurden, erhalten werden, vergleiche beispielsweise Whiteley et al., PCT-Anmeldung WO 86 01536 und U.S. Patente 4 448 885 und 4 467 036. Eine bevorzugte Nukleotidsequenz, die ein kristallines Protein codiert, ist diejenige, die als Nukleotide 156 bis 3623 in der Sequenz der Formel (I) gezeigt ist, oder ein kürzere Sequenz, die ein insektizides Fragment eines solchen kristallinen Proteins codiert; Geiser et al., Gene, 48 (1986) 109-118 [vergleiche die Nukleotidsequenz der Formel (I) in Figur 13].

Die von den Nukleotiden 156 bis 3623 der Sequenz (I) definierte codierende Region codiert das Polypeptid der Sequenz der Formel (II).

SEQUENZ DER FORMEL (II)

Ferner wurde gezeigt, daß einige Bt-Stämme gegenüber anderen Insekten als den Lepidoptera toxisch sind. Insbesondere ist Bt var. tenebrionis gegenüber Coleoptera-Insekten toxisch. Die Toxizität des Bt-Stammes san diego gegenüber Coleoptera-Insekten und die Sequenz des assoziierten Toxingens wird von Herrnstadt und Soares in der EP-0 202 739 und der EP-0 213 818 diskutiert.

Vektoren

Um das erfindungsgemäße chimäre Gen in Pflanzenzelle einzuschleusen, wird das Gen zuerst in einen Vektor insertiert. Wenn das Gen in einer für die Transformation ausreichenden Menge nicht verfügbar ist, kann der Vektor durch Replikation in einer Wirtszelle amplifiziert werden. Die geeignetsten Wirtszellen für die Amplifikation sind Bakterien- oder Hefezellen. Wenn eine ausreichende Menge des chimären Gens verfügbar ist, wird es in die Maisprotoplasten gemäß der Erfindung eingeschleust. Die Einschleusung des Gens in die Maispflanzen kann mittels des gleichen Vektors, der für die Replikation verwendet wurde, oder mittels eines anderen Vektors durchgeführt werden.

Einige Beispiele von bakteriellen Wirtszellen, die für die Replikation des chimären Gens geeignet sind, umfassen diejenigen der Gattung Escherichia, wie E. coli und Agrobacterium, wie A. tumefaciens oder A. rhizoaenes. Verfahren zur Clonierung heterologer Gene in Bakterien wurden von Cohen et al., U.S. Patente 4 237 224 und 4 468 464, beschrieben.

Die Replikation der Gene, die das kristalline Protein von Bt in E. coli codieren, ist in Wong et al., J. Biol. Chem. 258 (1983) 1960-1967, beschrieben.

Einige Beispiele von Hefewirtszellen, die für die Replikation der erfindungsgemäßen Gene geeignet sind, umfassen diejenigen der Gattung Saccharomyces.

Jeder Vektor, in den das chimäre Gen insertiert werden kann und der sich in einer geeigneten Wirtszelle, wie in Bakterien oder Hefen repliziert, kann verwendet werden, um die erfindungsgemäßen Gene zu amplifizieren. Der Vektor kann beispielsweise von einem Phagen oder einem Plasmid abgeleitet sein. Einige Beispiele der von Phagen abgeleiteten Vektoren, die erfindungsgemäß nützlich sind, umfassen diejenigen, die von M13 und von lambda abgeleitet sind. Einige geeignete Vektoren, die von M13 abgeleitet sind, umfassen M13mp18 und M13mp19. Einige geeignete Vektoren, die von lambda abgeleitet sind, umfassen lambda-gt11, lambda-gt7 und lambda-Charon 4.

Einige Vektoren, die von Plasmiden, die für die Replikation in Bakterien besonders geeignet sind, abgeleitet sind, umfassen pBR322 [Bolivar et al., Gene, 2 (1977) 95-113]; pUC18 und pUC19 [Narrander et al., Gene, 26 (1983) 101- 104]; und Ti-Plasmide [Bevan et al. Nature, 304 (1983) 184- 187]. Die bevorzugten Vektoren für die Amplifikation der Gene in Bakterien sind pBR322, pUC18 und pUC19.

Konstruktion von Vektoren für die Replikation

Um ein chimäres Gen, das sich für die Replikation in Bakterien eignet, zu konstruieren, werden eine Promotorsequenz, eine 5'-nichttranslatierte Sequenz, eine codierende Sequenz und eine 3'-nichttranslatierte Sequenz in der richtigen Reihenfolge in einen geeigneten Vektor, wie einen vorstehend beschriebenen Vektor, insertiert oder zusammengefügt. Um geeignet zu sein, muß der Vektor sich in der Wirtszelle replizieren können.

Der Promotor, die 5'-nichttranslatierte Region, die codierende Region und die 3'-nichttranslatierte Region, die das vorstehend beschriebene chimäre Gen umfassen, können zuerst zu einer Einheit außerhalb des Vektors vereinigt werden und dann in den Vektor insertiert werden. Alternativ können Teile des chimären Gens in den Vektor getrennt insertiert werden. Der Vektor enthält bevorzugt auch ein Gen, das der Wirtszelle eine Eigenschaft verleiht, die die Selektion der den Vektor enthaltenden Zellen erlaubt. Eine bevorzugte Eigenschaft ist die Antibiotikaresistenz. Einige Beispiele für nützliche Antibiotika umfassen Ampicillin, Tetracyclin, Hygromycin, G418 und Neomycin.

Die Insertion oder der Zusammenbau des Gens in dem Vektor wird nach Standardverfahren, wie durch die Verwendung von rekombinanter DNA [Maniatis et al., (1982)] und homologer Rekombination [Hinnen et al., Proc. Natl. Acad. Sci, 75 (1978) 1929-1933] durchgeführt.

Unter Verwendung bekannter rekombinanter DNA-Methoden wird der Vektor gespalten, die gewünschte DNA-Sequenz zwischen die gespaltenen Stücke des Vektors insertiert, und die Enden der gewünschten DNA-Sequenz werden an die entsprechenden Enden des Vektors ligiert.

Der Vektor wird äußerst zweckdienlich mit geeigneten Restriktionsendonukleasen gespalten. Einige geeignete Restriktionsendonukleasen umfassen solche, die glatte Enden erzeugen, wie SmaI, HpaI und EcoRV, und solche, die cohäsive Enden erzeugen, wie EcoRI, SacI und BamHI.

Die gewünschte DNA-Sequenz liegt normalerweise als Teil eines größeren DNA-Moleküls, wie als ein Chromosom, Plasmid, Transposon oder Phage, vor. Die gewünschte DNA-Sequenz wird aus ihrer Quelle herausgeschnitten und gegebenenfalls so modifiziert, daß die Enden an die Enden des gespaltenen Vektors angefügt werden können. Wenn die Enden der gewünschten DNA-Sequenz und des gespaltenen Vektors glatte Enden sind, werden sie durch glatte Enden erzeugende Ligasen, wie T4-DNA-Ligase, aneinandergefügt.

Die Enden der gewünschten DNA-Sequenz können auch an die Enden des gespaltenen Vektors in Form von cohäsiven Enden angefügt werden. In diesem Falle wird eine Ligase für cohäsive Enden, die auch eine T4-DNA-Ligase sein kann, verwendet. Andere geeignete Ligasen für cohäsive Enden umfassen beispielsweise die E. coli-DNA-Ligase.

Cohäsive Enden werden äußerst zweckdienlich durch Spalten der gewünschten DNA-Sequenz und des Vektors mit der gleichen Restriktionsendonuklease gebildet. In einem solchen Fall besitzen die gewünschte DNA-Sequenz und der gespaltene Vektor cohäsive Enden, die einander komplementär sind. Die cohäsiven Enden können auch durch Anfügung von homopolymeren Schwänzen an die Enden der gewünschten DNA-Sequenz und an den gespaltenen Vektor unter Verwendung der terminalen Desoxynucleotidyltransferase oder durch Anfügen einer synthetischen Oligonukleotidsequenz, die von einer speziellen Restriktionsendonuklease, die als Linker bekannt ist, erkannt wird, und Spalten der Sequenz mit der Endonuklease erzeugt werden; vergleiche beispielsweise Maniatis et al., (1982)

Konstruktion von Vektoren für die Transformation von Pflanzen

Zusätzlich zu dem chimären Gen, das ein Bt-Toxin oder ein Bt-artiges Toxin codiert, umfassen die Vektoren bevorzugt weiterhin eine DNA-Sequenz, die die Selektion oder das Absuchen von Maispflanzenzellen, enthaltend den Vektor, in Gegenwart von Zellen, die den Vektor nicht enthalten, erlaubt. Solche selektierbaren oder absuchbaren Marker können natürlicherweise in dem Vektor vorhanden sein, in den das erfindungsgemäße chimäre Gen eingeschleust wird, oder können in den Vektor entweder vor oder nach der Einschleusung des chimären Gens eingeschleust werden. Alternativ kann das selektierbare oder absuchbare Markergen oder ein Teil davon zuerst an das gewünschte chimäre Gen oder irgendeinen Teil davon angefügt werden und die rekombinanten Gene oder Gensegmente können als eine Einheit in den Vektor eingeschleust werden. Der selektierbare oder absuchbare Marker kann selbst chimär sein.

Ein bevorzugter selektierbarer Marker ist ein Gen, das Antibiotikaresistenz codiert. Das Gen muß in den zu tranformierenden Zellen exprimiert werden können. Die Zellen können in einem Medium, das das Antibiotikum enthält, gezüchtet werden, und solche Zellen, die den Vektor enthalten und die eine erhöhte Fähigkeit, in dem Medium zu überleben, besitzen, werden ausgewählt. Gene, die Resistenz gegenüber Maistoxinen, wie Hygromycin oder G418, verleihen, können als selektierbare Marker nützlich sein.

Einige Beispiele von Genen, die Antibiotikaresistenz verleihen, umfassen beispielsweise die Neomycin-Phosphotransferase [Kanamycin- und G418-Resistenz, Velten et al., EMBO 3 (1984) 2723-2730]; Hygromycin-Phosphotransferase [Hygromycinresistenz, van den Elzen et al., Plant Molec. Biol., 5 (1985) 299-302].

Bevorzugte Vektoren für die Transformation von Maispflanzen umfassen einen CaMV-35S-Promotor, der funktionell an eine codierende Region des Bt-Toxins gebunden ist, und einen CaMV-35S-Promotor, der funktionell an ein selektierbares Markergen, wie G418-Resistenz und Hygromycinresistenz, gebunden ist. Beispiele für solche Vektoren sind pCIB710/35S (G418-Resistenz) und pIRV (Hygromycinresistenz), wie vorstehend beschrieben.

Die Erfindung umfaßt auch Protoplasten von Zea mays-Pflanzen, die zu fertilen Maispflanzen regeneriert werden können, die das chimäre Gen enthalten, das ein kristallines Bt-Toxin oder ein Polypeptid mit im wesentlichen den insektentoxischen Eigenschaften des kristallinen Bt-Toxins exprimiert.

Insektizide

Die erfindungsgemäßen Pflanzenzellen enthalten das chimäre Gen und können verwendet werden, um das Polypeptid mit im wesentlichen den insektentoxischen Eigenschaften eines kristallinen Bt-Proteins zu erzeugen. Die Pflanzenzellen an sich stellen das Insektizid dar. Die als Insektizide direkt verwendeten Pflanzenzellen können gezüchtete Pflanzenzellen sein oder können Komponenten einer lebenden Pflanzen sein.

Das Toxin kann auch aus den Pflanzenzellen nach bekannten Methoden, beispielsweise durch Extraktion oder Chromatographie, isoliert werden. Der Extrakt kann der Pflanzenzellen- Gesamtextrakt, ein teilgereinigter Extrakt oder ein reines Präparat des Polypeptids sein. Jeder derartige Extrakt oder chromatographisches Isolat kann wie das kristalline Protein aus Bt verwendet werden; vergleiche beispielsweise Deacon, Aspects of Microbiology, 7 (1983), Cole et al., Hrsg., American Society for Microbiology und Miller et al., Science, 219 (1983) 715.

Die insektiziden Zellen, die nach einem erfindungsgemäßen Verfahren erhältlich sind, sind gegenüber Lepidoptera-Insekten, die Maiszellen und Pflanzen angreifen, toxisch, wie beispielsweise der Maiswurm (corn earworm, Heliothis zea) und der europäische Maisbohrer (European corn borer, Ostrinia nubilalis). Ferner sind Maiszellen, die das kristalline Toxingen von Bt var. tenebrionis tragen, gegenüber Coleoptera-Insektenschädlingen toxisch. Wichtige Insektenschädlinge, die der Ordnung Coleoptera angehören, sind beispielsweise der Colorado-Kartoffelkäfer (Colorado potato beetle), der Getreidekäfer (boll weevil) und der Maiswurzelwurm (corn root worm).

Daher beschreibt die Erfindung ein Verfahren zur Erzeugung eines Polypeptid mit im wesentlichen den insektentoxischen Eigenschaften eines kristallines Bacillus thuringiensis- Proteins in Zea mays, das dadurch gekennzeichnet ist, daß man:

(a) in Zea mays-Zellen ein Gen, das ein Polypeptid mit im wesentlichen den insektentoxischen Eigenschaften eines kristallinen Bt-Proteins codiert, einschleust, wobei der Promotor, die 5'-nichttranslatierte Region und gegebenenfalls die 3'-nichttranslatierte Region des Gens von einem Pflanzen- oder Pflanzenvirusgen abgeleitet sind, und

(b) das Polypeptid exprimiert.

Die Erfindung beschreibt auch ein Verfahren zur Bekämpfung von Insektenlarven, bei dem man die Larven mit einer insektiziden Menge von transgenen Zea mays-Zellen füttert, die ein Gen enthalten, das ein kristallines Bacillus thuringiensis-Toxin oder ein Polypeptid mit im wesentlichen den insektentoxischen Eigenschaften eines kristallinen Bacillus thuringiensis-Proteins codiert.

Die Erfindung beschreibt auch ein Verfahren zur Abtötung oder Bekämpfung von Lepidoptera-Larven, bei dem man die Larven mit einer insektiziden Menge von transgenen Maispflanzenzellen, die das erfindungsgemäße chimäre Gen enthalten, füttert. Die Pflanzenzellen können gezüchtete Pflanzenzellen oder Komponenten von lebenden Pflanzen sein. Ferner umfaßt die Erfindung auch ein Verfahren zur Abtötung von Coleoptera-Larven, indem man ihnen eine insektizide Menge von Zellen, die das chimäre Gen mit der codierenden Sequenz des kristallinen Bt var. tenebrionis-Toxins oder einem insektiziden Teil davon enthält, füttert.

Die Erfindung beschreibt weiter Maissamen von Pflanzen, die erfindungsgemäß gentechnisch hergestellt wurden, solange die Samen das insertierte chimäre Gen und die daraus abgeleitete erwünschte Eigenschaft erhalten. Ebenfalls offenbart sind die Nachkommen von Pflanzen, die nach dem erfindungsgemäßen Verfahren erzeugt wurden, einschließlich sexueller und vegetativer Nachkommen. Sexuelle Nachkommen können aus Selbstbestäubung oder kreuzweiser Bestäubung hervorgehen.

Anwendbarkeit

Das erfindungsgemäße Verfahren erlaubt die Regeneration von Zea mays-Protoplasten zu fertilen Pflanzen. Diese Möglichkeit ermöglicht die stabile Einschleusung exogener DNA (beispielsweise eines Gens, das ein kristallines Bt-Protein codiert) in das Genom von solchen Pflanzen und die Veränderung ihres Phänotyps. Zusätzlich können die Protoplasten mit Protoplasten aus der gleichen oder einer anderen Art fusioniert werden, um neue Kombinationen von nukleärer DNA oder neue Kombinationen von nukleärer oder Organellen-DNA zu erzeugen. Diese zuletzt genannte Möglichkeit erlaubt beispielsweise die Konstruktion einer männlichen sterilen Pflanze für Züchtungszwecke. Ferner können die Protoplasten als Quelle für clonales Material verwendet werden, an dem die Mutagenese und/oder Selektion für einen gewünschten Phänotyp durchgeführt werden kann. Beispiele für erwünschte Phänotypen sind beispielsweise eine erhöhte Resistenz gegenüber phytotoxischen Chemikalien, Krankheitserregern, Schädlingen, ungünstigen Umweltbedingungen, modifizierte morphologische oder Entwicklungseigenschaften, und veränderte Gehalte an metabolischen Substanzen.

BEISPIELE Beispiel 1a: Herstellung eines speziellen Kallus-Typs aus Zea mays, Genotyp Funk 2717

Zea mays-Pflanzen des Genotyps Funk 2717 werden bis zur Blütenbildung im Treibhaus gezüchtet und mit Pollen von dem gleichen Phänotyp bestäubt. Unreife Kolben, die die Embryonen in der Länge von 1,5 bis 2,5 mm enthalten, werden aus den Pflanzen entnommen und in einer 10%igen Clorox -Lösung 20 Minuten lang sterilisiert. Die Embryonen werden aus den Kernen entnommen und mit der Embryonalachse nach unten in ein Murashige-und-Skoog-Medium [Physiol. Plant, 15 (1962) 473-497], das 0,1 mg/l 2,4-D, 6% Gew./Vol. Saccharose und 25 mM L-Prolin enthält, und mit 0,24% Gew./Vol. Gelrit verfestigt wurde (Initiationsmedium) gegeben. Nach zweiwöchiger Kultur im Dunkeln bei 27ºC wird der sich auf dem Schildchen entwickelnde Kallus von dem Embryo entnommen und in ein mit Gelrit verfestigtes B5-Medium (0,5 mg/l 2,4-D) gegeben. Das Material wird alle 2 Wochen in frisches Medium subkultiviert. Nach etwa 8 Wochen von der Gabe des Embryonen auf das Initiationsmedium wird der spezielle Kallus-Typ durch charakteristische Morphologie identifiziert. Dieser Kallus wird auf dem gleichen Medium weiter subkultiviert. Nach einer weiteren Zeitspanne von 2 Monaten wird der Kallus in N6-Medium, das 2 mg/l 2,4-D enthält und mit Gelrit verfestigt worden ist, überführt und stufenweise darin subkultiviert.

Beispiel 1b: Herstellung eines speziellen Kallus-Typs von Zea mays, Genotyp Funk 5N984 .

Zea mays-Pflanzen des Genotyps Funk 5N984 werden bis zur Blütenbildung in einem Treibhaus gezüchtet und mit Pollen vom gleichen Genotyp bestäubt. Unreife Kolben, die Embryonen mit einer Länge von 1,5 bis 2,5 mm enthalten, werden den Pflanzen entnommen und in einer 15%igen Clorox -Lösung 15 Minuten lang sterilisiert. Die Embryonen werden den Kernen entnommen und mit der Embryonalachse nach unten auf dem Medium von Schenk und Hildebrandt [Can. J. Biol., 50 (1972) 199-204], das 1,0 mg/l 2,4-D, 2% Gew./Vol. Saccharose, 100 mg/l Caseinhydrolysat, 100 mg/l Myoinosit und 25 mM L-Prolin enthält, und mit 0,8% Gew./Vol. Phytagar verfestigt wurde (Initiationsmedium), gegeben. Nach einer zweiwöchigen Züchtung im Dunkeln bei 27ºC wird ein bevorzugter Kallus durch das Vorhandensein von gut gebildeten globulären somatischen Embryonen, die sich auf dem Schildchen bestimmter Explantate entwickeln, erkannt. Diese Kalli werden entnommen und entweder auf B5-Medium (0,5 mg/l 2,4-D plus 2% Gew./Vol. Saccharose, 100 mg/l Caseinhydrolysat, 100 mg/l Myoinosit und 25 mM L-Prolin) oder auf Schenk-und-Hildebrandt-Medium (wie vorstehend beschrieben) gegeben. Das Material wird alle 2 Wochen in frischem Medium subkultiviert. Nach einem Minimum von 8 Wochen vom Ausbringen der Embryonen auf dem Initiationsmedium wird der spezielle Kallus-Typ durch seine charakteristische Morphologie identifiziert. Der spezielle Kallus-Typ kann weiter auf dem gleichen Medium subkultiviert werden, wird aber bevorzugt auf N6-Medium, das 2 mg/l 2,4-D enthält, und mit 0,24% Gew./Vol. Gelrit verfestigt wurde, überführt und dort stufenweise subkultiviert. Die embryogenen Suspensionskulturen können aus diesen Kallus-Kulturen nach der in Beispiel 2 dargestellten Methode hergestellt werden.

Beispiel 2: Herstellung einer Suspension des Zea-mays-Genotyps Funk 2717

Der in Beispiel 1a beschriebene Kallus bleibt insgesamt mindestens 6 Monate in Kultur. Der für die Subkultur gewählte Kallus-Typ ist relativ wenig schleimhaltig und ist körnig und sehr krümelig, so daß er sich in einzelne Zellaggregate beim Einbringen in ein Flüssigmedium auftrennt. Kulturen, die Aggregate mit großen expandierten Zellen enthalten, werden nicht beibehalten.

Etwa 500 mg Aliquote des speziellen Kallus von Zea mays, der in der vorstehenden Stufe (a) beschrieben ist, des Elitegenotyps Funk 2717, werden in 30 ml N6-Medium, enthaltend 2 mg/l 2,4-D in 125 ml Delong-Kolben gegeben. Nach einwöchiger Kultur bei 26ºC im Dunkeln auf einem kreisenden Schüttler (130 UpM, 2,5 cm Durchmesser) wird das Medium durch frisches Medium ersetzt. Die Suspensionen werden so erneut nach einer weiteren Wochen subkultiviert.

Zu diesem Zeitpunkt werden die Kulturen besichtigt, und diejenigen, die keine große Anzahlen von expandierten Zellen zeigen, werden beibehalten. Suspensionskulturen, die Aggregate mit großen expandierten Zellen enthalten, werden verworfen. Das bevorzugte Gewebe besteht aus dicht cytoplasmatischen, sich teilenden Zellaggregaten, die eine charakteristisch glattere Oberfläche als die meisten der Zellaggregate besitzen. Bei den zurückgehaltenen Kulturen liegen mindestens 50% der Zellen in diesen kleinen Aggregaten vor. Dies ist die gewünschte Morphologie. Diese Suspensionen zeigen auch eine rasche Wachstumsgeschwindigkeit mit einer Verdoppelungszeit von weniger als 1 Woche. Die Suspensionskulturen werden wöchentlich durch Überführen von 0,5 ml gepacktem Zellvolumen (PCV: abgesetztes Zellvolumen in einer Pipette) in 25 ml frisches Medium subkultiviert. Nach 4- bis 6wöchiger Subkultur auf diese Art nehmen die Kulturen auf das 2- bis 3fache pro wöchentlicher Subkultur zu. Kulturen, in denen mehr als 75% der Zellen die gewünschte Morphologie besitzen, werden für die weitere Subkultur zurückgehalten. Diese Kulturen werden aufrechterhalten, indem für die Subkultur immer der Kolben gewählt wird, dessen Inhalt die beste Morphologie zeigt. Die periodische Filtration durch Siebe aus rostfreiem Stahl mit einer Porengröße von 630 um (alle 2 Wochen) wird in einigen Fällen verwendet, um die Dispersion der Kulturen zu erhöhen, ist aber nicht notwendig.

Die Zea mays-Suspensionskultur 6-2717-CG (Funk 2717) wurde bei der ATCC unter der Hinterlegungsnr. 40326 hinterlegt.

Diese Hinterlegung erfolgte gemäß dem Budapester Vertrag [Hinterlegungsdatum: 20. Mai 1987].

Beispiel 3: Herstellung von Protoplasten aus Suspensionskulturen von Zea mays

1 bis 1,5 ml PCV der Suspensionskulturzellen, die gemäß Beispiel 2 hergestellt wurden, werden in 10 bis 15 ml eines Gemisches, bestehend aus 4% Gew./Vol. RS-Cellulase mit 1% Gew./Vol. Rhozym in KMC-Salzlösung (8,65 g/l KCl, 16,47 g/l MgCl&sub2;.6H&sub2;O und 12,5 g/l CaCl&sub2;.2H&sub2;O, 5 g/l MES pH 5,6) inkubiert. Die Spaltung wird bei 30ºC auf einem Schaukeltisch für eine Zeitspanne von 3 bis 4 Stunden durchgeführt. Das Präparat wird unter einem Umkehrmikroskop bezüglich der Protoplastenfreisetzung überwacht.

Die freigesetzten Protoplasten werden wie folgt gewonnen. Das Präparat wird durch ein Sieb mit einer Maschenweite von 100-um-Mesh und anschließend ein Sieb mit einer Maschenweite von 50-um-Mesh filtriert. Die Protoplasten werden durch die Siebe mit einem Volumen an KMC-Salzlösung, das dem ursprünglichen Volumen der Enzymlösung gleich ist, gewaschen. 10 ml des Protoplastenpräparats wird in jeweils eines von mehreren Einwegplastikzentrifugenröhrchen gegeben und 1,5 bis 2 ml einer 0,6 M Saccharoselösung (gepuffert auf ph 5,6 mit 0,1% Gew./Vol. Morpholinoethansulfonsäure [MES] und KOH) wird unterschichtet. Das Röhrchen wird bei 60 bis 100 g 10 Minuten lang zentrifugiert, und die Protoplastenbanden an der Grenzfläche werden gewonnen und in ein frisches Röhrchen gegeben.

Das Protoplastenpräparat wird in 10 ml frischer KMC-Salzlösung resuspendiert und 5 Minuten lang bei 60 bis 100 g zentrifugiert. Der Überstand wird entnommen und verworfen, und die Protoplasten werden sanft in dem verbleibenden Tropfen resuspendiert, und dann werden 10 ml einer 13/14-starken KMC-Lösung stufenweise zugesetzt. Nach erneuter 5minütiger Zentrifugation wird der Überstand erneut entfernt, und die Protoplasten in einer 6/7-starken KMC-Lösung resuspendiert. Ein Aliquot wird zum Zählen entnommen und die Protoplasten werden erneut durch Zentrifugation sedimentiert Die Protoplasten werden in einer Konzentration von 10- pro ml in KM- Medium (Tabelle 1) oder in einer Mannitlösung mit der gleichen Osmolalität wie das KM-Medium, die 6 mM MgCl&sub2; enthält, oder einem anderen geeigneten Medium zur Verwendung zur Transformation, wie in den vorstehenden Beispielen beschrieben, resuspendiert. Diese Protoplastensuspension wird für die Züchtung wie in Beispiel 3a beschrieben, oder, sofern durchgeführt, für die Transformation der Protoplasten wie in den Beispielen 8 und 9 beschrieben, verwendet.

Beispiel 4: Allgemeine rekombinante DNA-Techniken

Da viele der bei der Erfindung verwendeten rekombinanten DNA-Techniken für einen Fachmann auf dem Gebiet eine Routine sind, wird eine kurze Beschreibung dieser allgemein verwendeten Techniken hier, statt in jenem Fall, in dem sie nachstehend auftreten, aufgenommen. Außer anders angegeben sind alle diese Routineverfahren in der Druckschrift von Maniatis et al., (1982) beschrieben.

A. Spaltungen mit Restriktionsendonukleasen

Typischerweise ist in dem Reaktionsgemisch DNA in einer Menge von etwa 50 bis 500 ug/ml in der vom Hersteller, New England Biolabs, Beverly, MA, empfohlenen Pufferlösung vorhanden. 2 bis 5 Einheiten der Restriktionsendonukleasen werden für jedes ug DNA zugesetzt, und das Reaktionsgemisch wird bei der vom Hersteller empfohlenen Temperatur 1 bis 3 Stunden lang inkubiert. Die Reaktion wird durch 10minütiges Erhitzen auf 65ºC oder durch Extraktion mit Phenol und anschließende Fällung der DNA mit Ethanol beendet. Diese Technik ist auch auf den Seiten 104 bis 106 der Druckschrift von Maniatis et al. beschrieben.

B. Behandlung der DNA mit Polymerase, um glatte Enden zu erzeugen

Die DNA-Fragmente werden dem Reaktionsgemisch in einer Menge von 50 bis 500 ug/ml in dem vom Hersteller, New England Biolabs, empfohlenen Puffer zugesetzt. Das Reaktionsgemisch enthält alle 4 Desoxynukleotidtriphosphate in einer Konzentration von 0,2 mM. Der Reaktionsansatz wird 30 Minuten lang bei 15ºC inkubiert und dann durch 10minütiges Erhitzen auf 65ºC beendet. Für Fragmente, die durch Spaltung mit Restriktionsendonukleasen, die 5'-überstehende Enden erzeugen, wie EcoRI und BamHI, gebildet werden, wird das große Fragment oder das Klenow-Fragment der DNA-Polymerase verwendet. Für Fragmente, die durch Endonukleasen, die 3'- überstehende Enden produzieren, wie PstI und SacI, erzeugt werden, wird T4-DNA-Polymerase verwendet. Die Verwendung dieser zwei Enzyme ist auf den Seiten 113 bis 121 der Druckschrift von Maniatis et al. beschrieben.

C. Agarosegelelektrophorese und Reinigung der DNA-Fragmente von den Gelen

Die Agarosegelelektrophorese wird in einer horizontalen Vorrichtung, wie auf den Seiten 150 bis 163 der Druckschrift von Maniatis et al. beschrieben, durchgeführt. Der verwendete Puffer ist der darin beschriebene Tris-Boratpuffer. Die DNA-Fragmente werden durch Anfärben mit 0,5 ug/ml Ethidiumbromid, das entweder in dem Gel und dem Vorratspuffer während der Elektrophorese vorhanden ist oder nach der Elektrophorese zugesetzt wird, sichtbar gemacht. Die DNA wird durch Beleuchtung mit ultraviolettem Licht mit kurzer oder langer Wellenlänge sichtbar gemacht. Wenn die Fragmente von dem Gel isoliert werden sollen, ist die verwendete Agarose eine mit niedriger Gelbildungstemperatur, erhalten von Sigma Chemical, St Louis, Missouri. Nach der Elektrophorese wird das gewünschte Fragment herausgeschnitten, in ein Kunststoffröhrchen gegeben, etwa 15 Minuten lang auf 65ºC erhitzt, dann mit Phenol dreimal extrahiert und zweimal mit Ethanol gefällt. Dieses Verfahren stellt eine leichte Modifikation gegenüber dem in der Druckschrift von Maniatis et al. auf Seite 170 beschriebenen dar.

D. Addition von synthetischen Linkerfragmenten an die DNA- Enden

Wenn eine neue Restriktionsspaltstelle an das Ende eines DNA-Moleküls angefügt werden soll, wird dieses Molekül zuerst mit der DNA-Polymerase behandelt, um, sofern notwendig, glatte Enden wie in dem vorstehenden Abschnitt beschrieben zu erzeugen. Etwa 0,1 bis 1,0 ug dieses Fragments wird zu etwa 100 mg phosphorylierter Linker-DNA, erhalten von New England Biolabs, in einem Volumen von 20 bis 30 ul, enthaltend 2 ul T4-DNA-Ligase, von New England Biolabs, und 1 mM ATP in dem vom Hersteller empfohlenen Puffer zugesetzt. Nach der Inkubation über Nacht bei 15ºC wird die Reaktion durch lominütiges Erhitzen des Gemisches auf 65ºC beendet. Das Reaktionsgemisch wird dann auf etwa 100 ul in einem Puffer, der sich für die Restriktionsendonuklease, die bei der synthetischen Linkersequenz spaltet, eignet, verdünnt, und etwa 50 bis 200 Einheiten dieser Endonuklease werden zugesetzt. Das Gemisch wird bei der geeigneten Temperatur 2 bis 6 Stunden lang inkubiert, dann wird das Fragment einer Agarosegelelektrophorese unterworfen, und das Fragment wird wie vorstehend beschrieben gereinigt. Das so erhaltene Fragment besitzt nun Enden mit Endstellen, die durch Spaltung mit der Restriktionsendonuklease erzeugt wurden. Diese Endstellen sind üblicherweise cohäsiv, so daß das so erhaltene Fragment nun leicht an andere Fragmente mit den gleichen cohäsiven Endstellen ligiert wird.

E. Entfernung der 5'-terminalen Phosphate von den DNA-Fragmenten

Während der Stufen der Plasmidclonierung verringert die Behandlung des Vektorplasmids mit Phosphatase die Rezirkularisation des Vektors (diskutiert auf Seite 13 der Druckschrift von Maniatis et al.). Nach der Spaltung der DNA mit der geeigneten Restriktionsendonuklease wird eine Einheit alkalische Kälberdarmphosphatase, erhalten von Boehringer Mannheim, Indianapolis, IN, zugesetzt. Die DNA wird eine Stunde lang bei 37ºC inkubiert, dann zweimal mit Phenol extrahiert und mit Ethanol gefällt.

F. Ligierung der DNA-Fragmente

Wenn Fragmente mit komplementären cohäsiven Enden aneinandergefügt werden sollen, werden etwa 100 ng jedes Fragments in einem Reaktionsgemisch von 20 bis 40 ul, das etwa 0,2 Einheiten T4-DNA-Ligase von New England Biolabs in dem vom Hersteller empfohlenen Puffer enthält, inkubiert. Die Inkubation wird 1 bis 20 Stunden lang bei 15ºC durchgeführt. Wenn DNA-Fragmente mit glatten Enden aneinandergefügt werden sollen, werden sie wie vorstehend inkubiert, außer daß die Menge der T4-DNA-Ligase auf 2 bis 4 Einheiten erhöht wird.

G. Transformation von E. coli mit der DNA

Der E. coli-Stamm HB101 wird für die meisten Versuche verwendet. Die DNA wird in E. coli unter Verwendung des von Maniatis et al. auf den Seiten 250 bis 251 beschriebenen Calciumchloridverfahrens eingeschleust.

H. Absuchung von E. coli auf Plasmide

Nach der Transformation werden die so erhaltenen Kolonien von E. coli auf das Vorhandensein des gewünschten Plasmid durch ein rasches Plasmidisolierungsverfahren abgesucht. Zwei geeignete Verfahren sind auf den Seiten 366 bis 369 der Druckschrift von Maniatis et al. (1982) beschrieben.

I. Isolierung der Plasmid-DNA in großem Umfang

Verfahren zur Isolierung großer Mengen von Plasmiden in E. coli finden sich auf den Seiten 88 bis 94 der Druckschrift von Maniatis et al. (1982).

J. Clonierung in M13-Phagenvektoren

Bei der folgenden Beschreibung ist zu verstehen, daß die doppelsträngige Replikationsform der Phagen-M13-Derivate für Routineverfahren, wie Spaltungen mit Restriktionsendonuklease, Ligierungen etc., verwendet wird.

Beispiel 5: Konstruktion des chimären Gens im Plasmid pBR322

Um den CaMV-Gen-VI-Promotor und die für das Protoxin codierende Sequenz miteinander zu fusionieren, wird ein Derivat des Phagenvektors mp19 [Yanisch-Perron et al., (1985)] konstruiert. Zuerst werden ein DNA-Fragment, das etwa 155 Nukleotide 5' der für das Protoxin codierenden Region enthält, und die benachbarten etwa 1346 Nukleotide der codierenden Sequenz in mp19 insertiert. Die Phagen mp19dsrf-DNA (doppelsträngige replikative Form) wird mit den Restriktionsendonukleasen SacI und SmaI gespalten und das etwa 7,2 kbp lange Vektorfragment wird nach der Elektrophorese durch eine Agarose mit einer niedrigen Gelbildungstemperatur nach Standardverfahren gereinigt. Das Plasmid pKU25/4, das etwa 10 kpb (Kilobasenpaare) der Bacillus thuringiensis-DNA einschließlich des Protoxingens enthält, wird von Dr. J. Nuesch, CIBA-GEIGY Ltd., Basel, Schweiz erhalten. Die Nukleotidsequenz des in dem Plasmid pKU25/4 vorhandenen Gens ist in der Sequenz (I) gezeigt. Die DNA des Plasmids pKU25/4 wird mit den Endonukleasen Hpal und SacI gespalten, und ein 1503 bp langes Fragment (enthaltend die Nukleotide 2 bis 1505 in der Sequenz (I)) wird wie vorstehend gereinigt. (Dieses Fragment enthält etwa 155 bp der bakteriellen Promotorsequenzen und etwa 1346 bp des starts der für das Protoxin codierenden Sequenz). Etwa 100 ng jedes Fragments werden dann vermischt, T4-DNA-Ligase wird zugesetzt und es wird bei 15ºC über Nacht inkubiert. Das so erhaltene Gemisch wird in den E. coli-Stamm HB101 transformiert, mit dem Indikatorbakterium E. coli JM 101 vermischt und wie beschrieben plattiert [Messing, J., Meth. Enzymol, 101 (1983) 20]. Ein Phage mit der Bezeichnung mp19/bt wird für die weitere nachstehende Konstruktion verwendet.

Als nächstes wird ein DNA-Fragment, das den CaMV-Gen-VI- Promotor und einige der codierenden Sequenzen für das Gen VI enthält, in mp19/bt insertiert. Die Phagen mp19/btdsrf- DNA wird mit BamHI gespalten, mit dem großen Fragment der DNA-Polymerase behandelt, um glatte Enden zu erzeugen und erneut mit der Endonuklease Psti gespalten. Das größere Vektorfragment wird durch Elektrophorese, wie vorstehend beschrieben, gereinigt. Das Plasmid pABD1 ist in Paszkowski et al., Embo J., 3 (1984) 2717-2722 beschrieben. Die DNA des Plasmids pABDL wird mit PstI und HindIII gespalten. Das etwa 465 bp lange Fragment, das den CaMV-Gen-VI-Promotor und etwa 75 bp der codierenden Sequenz für das Gen VI enthält, wird gereinigt. Die zwei Fragmente werden ligiert und plattiert, wie vorstehend beschrieben. Einer der so erhaltenen rekombinanten Phagen mit der Bezeichnung mp19/btca wird in dem folgenden Versuch verwendet:

Der Phage mp19/btca enthält die CaMV-Gen-VI-Promotorsequenzen, einen Teil der codierenden Sequenz des Gens VI, etwa 155 bp der Bacillus thuringiensis-DNA stromaufwärts der für das Protoxin codierenden Sequenz und etwa 1346 bp der für das Protoxin codierenden Sequenz. Um die CaMV-Promotorsequenzen präzise an die für das Protoxin codierenden Sequenzen zu fusionieren, wird die dazwischenliegende DNA unter Verwendung der Oligonukleotid-gerichteten Mutagenese der mp19/btca-DNA deletiert. Ein DNA-Oligonukleotid mit der Sequenz (5') TTCGGATTGTTATCCATGGTTGGAGGTCTGA (3') wird nach Routineverfahren unter Verwendung eines DNA-Synthesegeräts von Applied Biosystems synthetisiert. Dieses Oligonukleotid ist den Sequenzen in der Phagen-mp19/btca-DNA am 3'-Ende des CaMV-Promotors [Nukleotide 5762 bis 5778 in Hohn, (1982)] und dem Beginn der für das Protoxin codierenden Sequenz (Nukleotide 156 bis 172) in der vorstehenden Formel I komplementär. Das allgemeine Verfahren zur Mutagenese ist das in Zoller und Smith (1983) beschriebene. Etwa 5 ug der einzelsträngigen Phagen-mp19/btca-DNA werden mit 0,3 g des phosphorylierten Oligonukleotids in einem Volumen von 40 ul vermischt. Das Gemisch wird 5 Minuten lang auf 65ºC erhitzt, auf 50ºC abgekühlt und langsam auf 4ºC abgekühlt. Dann werden Puffer, Nukleotidtriphosphate, ATP, T4-DNA-Ligase und das große Fragment der DNA-Polymerase zugesetzt, und es wird über Nacht bei 15ºC wie beschrieben [vergleiche Zoller und Smith (1983)] inkubiert. Nach der Agarosegelelektrophorese wird die zirkuläre doppelsträngige DNA gereinigt und in den E. coli-Stamm JM101 transfiziert. Die so erhaltenen Plaques werden nach Sequenzen, die mit dem ³²P-markierten Oligonukleotid hybridisieren, abgesucht, und der Phage wird durch Analyse mittels einer DNA-Restriktionsendonuklease analysiert. Unter den so erhaltenen Phagenclonen finden sich solche mit einer korrekten Deletion der unerwünschten Sequenzen zwischen dem CaMV-Gen-VI-Promotor und der für das Protoxin codierenden Sequenz. Dieser Phage wird als mp19/btca/de1 bezeichnet.

Als nächstes wird ein Plasmid konstruiert, in dem die 3'- codierende Region des Protoxingens an CaMV-Transkriptionsterminationssignale fusioniert ist. Zuerst wird die DNA des Plasmids pABD1 mit den Endonukleasen BamHI und BglII gespalten, und ein 0,5 kbp langes Fragment, das die CaMV- Transkriptionsterminationssequenzen enthält, wird isoliert. Als nächstes wird das Plasmid pUC19, Yanisch-Perron et al., Gene, 33 (1985) mit BamHI gespalten, mit dem 0,5 kbp langen Fragment vermischt und mit T4-DNA-Ligase inkubiert. Nach der Transformation der DNA in den E. coli-Stamin HB101 wird einer der so erhaltenen Clone mit der Bezeichnung Plasmid p702 erhalten.

Als nächstes wird die DNA des Plasmids p702 mit den Endonukleasen Saci und Sinai gespalten, und das größere, etwa 3,2 kbp lange, Fragment wird durch Gelektrophorese isoliert. Die DNA des Plasmids PKU25/4 wird mit den Endonukleasen AhaIII und SacI gespalten, und das 2,3 kbp lange Fragment (Nukleotide 1502 bis 3773 der vorstehenden Formel I), das den 3'-Teil der für das Protoxin codierenden Sequenz enthält (nt 1504 bis 3773 der in Formel I gezeigten Sequenz) wird durch Gelektrophorese isoliert. Diese zwei DNA-Fragmente werden vermischt, mit T4-DNA-Ligase inkubiert und in den E. coli-Stamm transformiert. Das so erhaltene Plasmid ist p702/bt.

Schließlich werden Anteile der DNA des Phagen mp19/btca/de1dsrf und des Plasmids p702/bt aneinandergefügt, um ein Plasmid zu erzeugen, das die für das Protoxin codierende Sequenz, flankiert durch CaMV-Promotor und Terminatorsequenzen, enthält. Die DNA des Phagen mp19/btca/del wird mit den Endonukleasen SacI und SplI gespalten, und ein Fragment von etwa 1,75 kbp wird durch Agarosegelelektrophorese gereinigt. Auf ähnliche Weise wird die DNA des Plasinids p702/bt mit den Endonukleasen SacI und SalI gespalten, und ein Fragment von etwa 2,5 kpb wird isoliert. Schließlich wird die DNA des Plasmids pBR322 [Bolivar et al., (1977)] mit SalI und SphI gespalten, und das größere 4,2 kbp lange Fragment wird isoliert. Alle drei DNA-Fragmente werden vermischt und mit T4-DNA-Ligase inkubiert und in den E. coli-Stamm HB101 transformiert. Das so erhaltene Plasmid pBR322/bt14 ist ein Derivat von pBR322, das den CaMV-Gen- VI-Promotor und Translations-Startsignale in Fusion an die codierende Sequenz für das kristalline Bt-Protein, gefolgt von der CaMV-Transkriptionstermination, enthält.

Beispiel 6a: Konstruktion von pTOX, enthaltend ein chimäres Gen. das das Gen für das insektizide Toxin von Bacillus thuringiensis var. tenebrionis codiert

Ein Gen, das das Gen für das insektizide kristalline Protein von Bacillus thuringiensis var. tenebrionis codiert, wurde charakterisiert und sequenziert [Sekar, V. et al., Proc. Natl. Acad. Sci. USA, 84 (1987) 7036-7040]. Diese codierende Sequenz wird auf einem geeigneten Restriktionsfragment, wie dem HindIII-Fragment, mit einer Größe von etwa 3 kb isoliert und in einen geeigneten Pflanzenexpressionsvektors, wie das Plasmid pCIB770 [Rothstein, S. et al., Gene, 53 (1987) 153-161] insertiert. Das Plasmid pCIB770 enthält ein chimäres Kanamycingen für die Expression in Pflanzen sowie den Promotor und Terminator des 35S- RNA-Transkripts von CaMV [Blumenkohl-Mosaikvirus], getrennt durch eine einzige BamHI-Spaltstelle. Das Restriktionsfragment, das die für Toxin codierende Sequenz trägt, wird der einzigen BamHI-Spaltstelle von pCIB770 durch Verwendung des geeigneten molekularen Adapters kompatibel gemacht und aneinander ligiert.

Beispiel 6b: Konstruktion des pSAN, enthaltend ein chimäres Gen. das das Gen für das insektizide Toxin des Bacillus thuringiensis-Stammes san diego codiert

Ein Gen, das das insektizide Protein von Bacillus thuringiensis-Stamm san diego codiert, wurde von Herrnstadt et al., EP-0 202 739 und EP-0 213 818, charakterisiert und sequenziert. Diese codierende Sequenz wird auf einem geeigneten Restriktionsfragment isoliert und in den geeigneten Pflanzenexpressionsvektor, wie pCIB700, insertiert. Das Plasmid pCIB770 enthält ein chimäres Kanamycingen für die Expression in Pflanzen sowie den Promotor und Terminator des 35S-RNA-Transkripts von CaMV [Blumenkohl-Mosaikvirus], getrennt durch eine einzigartige BamHI-Spaltstelle. Das Restriktionsfragment, das die für das Toxin codierende Sequenz trägt, wird mit der einzigartigen BamHI-Spaltstelle pCIB770 durch Verwendung des geeigneten molekularen Adapters kompatibel gemacht und aneinander ligiert.

Beispiel 7a: Konstruktion des Plasmids pCIB710

Das Plasmid pLW111 (erhältlich von S. Howell, University of California, San Diego) besteht aus den drei kleineren EcoRI-Fragmenten des BJI-Stammes des Blumenkohl-Mosaikvirus (CaMV) [Franck et al. (1980) Cell, 21: 285-294], cloniert in pMB9. pLW11 wird mit BglII gespalten, und ein 1150 bp langes Fragment [Basenpaarnrn. 6494-7643, Hohn et al., Current Topics in Microbiology and Immunology, 96 (1982) 193- 236] wird isoliert. Dieses Fragment wird in die BamHI- Spaltstelle von pUC19 ligiert. Dieses Restriktionsfragment codiert sowohl den Promotor für die CaMV-35S-RNA als das polyA-Additionssignal (d.h. der Terminator) für dieses Transkript.

In vitro-Mutagenese

Eine einzigartige BamHI-Spaltstelle wird zwischen diesen Promotor und den Terminator über in vitro-Mutagenese insertiert. Ein 36 Basen langes Oligonukleotid wird synthetisiert, das der CaMV-Sequenz in dieser Region identisch ist, außer, daß eine BamHI-Restriktionsspaltstelle bei Basenpaar Nr. 7483 in die Sequenz insertiert wird.

Das 1150 bp lange BglII-Fragment aus dem vorstehenden Beispiel wird in M13mp19 cloniert, und die einzelsträngige Phagen-DNA wird isoliert.

Diese einzelsträngige DNA wird mit dem synthetischen Oligonukleotid assoziiert, ein neuer Strang wird unter Verwendung des Oligonukleotids als Primer synthetisiert, und die DNA wird in den Stamm JM101 [Zoller und Smith, DNA, 3 (1984) 479-488] transfiziert.

M13-Phagen, bei denen die BamHI-Spaltstelle insertiert ist, werden wie in Zoller und Smith, a.a.O. beschrieben, isoliert.

Selektion des gewünschten mutierten Phagen

Das 36 Basen lange Oligonukleotid wird durch Kinasierung mit 32-P-ATP markiert.

Eine Anzahl der transfizierten M13-Phagen-Plaques wird auf einem Mikrocellulosefilter lokalisiert. Dieser Filter wird mit dem markierten 36-meren hybridisiert. Der Filter wird bei ansteigenden Temperaturen gewaschen. Die-mutierten Phagen sind bei höherer Waschtemperatur stabil. Einer dieser Phagen, der bei höherer Temperatur stabil ist, wird isoliert und sequenziert, um das Vorhandensein der BamHI- Spaltstelle zu bestätigen.

Abschließender Zusammenbau von pCIB710

Doppelsträngige DNA, die aus diesem Phagen isoliert wurde, wird mit HindIII und EcoRI gespalten. pUC19 wird mit HindIII und EcoRI gespalten. Diese zwei gespaltenen DNAS werden ligiert. Die Transformanten werden durch ihre Ampicillinresistenz selektioniert. Ein Transformant aus dieser Ligierung ist pCIB710.

Das Plasmid pCIB710 besitzt keine ATG-Startcodons zwischen dieser BamHI-Spaltstelle, die insertiert wurde, und dem Startpunkt der Transkription.

Beispiel 7b: Konstruktion von pCIB712

Das Hygromycinresistenzgen [Gritz, L. und Davies, J. Gene, 25 (1983) 179-188] ist auf einem ca. 1150 Basenpaar langen BamHI-Fragment des Plasmids pLG90 vorhanden. Das Plasmid pLG90 ist von Dr. Linda Gritz, Applied Biotechnology, 80 Rogers St., Cambridge, Massachusetts 02142 erhältlich. Dieses Fragment wurde mit BglII-Linkern verknüpft und dann in die einzige BamHI-Spaltstelle von pCIB70 insertiert, wodurch die BamHI-Spaltstelle zerstört wurde und das Plasmid pCIB712 konstruiert wurde. Das Plasmid pCIB712 wurde bei der ATCC, Rockville, Maryland, USA unter der Hinterlegungsnr. 67407 hinterlegt. Diese Hinterlegung erfolgte gemäß dem Budapester Vertrag [Hinterlegungsdatum: 18. Mai 1987].

Das Plasmid pCIB712 wird unter Verwendung eines geeigneten Enzyms, beispielsweise SmaI, linearisiert.

Beispiel 7c: Konstruktion von pCIB10/35SBt

Das Plasmid pCIB710 ist vorstehend beschrieben.

Konstruktion von pCIB10 (vergleiche Figuren 7a bis 7g)

15. Ein T-DNA-Fragment, das die linke Grenze von pTiT37 enthält, wird aus pBR325 (EcorI29) [Yadav et al., Proc. Natl. Acad. Sci. USA, 79 (1982) 6322-6326] isoliert. pBR325 (EcoRI29) wird mit EcoRI gespalten, und das 1,1 kb lange Fragment wird mit HindIII-Linkern verknüpft (New England Biolabs).

16. Das Plasmid pBR322 [Bolivar et al., Gene, 2 (1977) 95- 103] wird mit HindIII gespalten.

17. Das die linke Grenze enthaltende Fragment, das in Stufe 15 beschrieben wurde, wird in die HindIII-Spaltung von pBR322 ligiert.

18. Das die linke Grenze enthaltende Plasmid, das in Stufe 17 konstruiert wurde, wird mit ClaI und HindIII gespalten, und das 1,1 kb lange HindIII-Fragment/ClaI-Fragment wird isoliert [Hepburn et al., J. Mol. Appl. Genet., 2 (1983) 315-329].

19. Das Plasmid pUC18 [Norrander et al., Gene, 26 (1983) 101-106] wird mit HindIII und EcorI gespalten; der 60 bp lange Polylinker wird am Ende unter Verwendung von T4-Polynukleotidkinase und gamma-³²p-dATP markiert und aus einem Acrylamidgel isoliert.

20. Das Plasmid pBR322 wird mit EcoRI und ClaI gespalten, und das größere Fragment wird isoliert.

21. Der 60 bp lange HindIII/EcoRI-Polylinker und das 1,1 kb lange HindIII/Clal-Fragment von EcoRI29 werden in pBR322, das mit ClaI und EcoRI gespalten wurde, ligiert, wodurch pCIB5 konstruiert wird.

22. Das chimäre Gen, das Kanamycinresistenz verleiht (nosneo) wird aus Bin 6 [Bevan, Nuc. Acid Res., 12 (1984) 8711-8721] als SalI/EcoRI-Fragment entnommen.

23.Das Plasmid pUC18 wird mit EcoRI und SalI gespalten.

24.Das SalI/EcoRI-Fragment, das das chimäre Gen der Stufe 22 enthält, wird in pUC18, der mit EcoRI und SalI gespalten worden war, ligiert.

25. Die BamHI-Erkennungsstelle in der Terminationssequenz dieses chimären Gens wird durch Spalten mit BamHI und Auffüllen unter Verwendung von T4-DNA-Polymerase und Ligieren zerstört.

26. Das so erhaltene Plasmid wird mit SstII (Bethesda Research Laboratories) und HindIII gespalten.

27. Ein Fragment, das den 5'-Teil des nos-Promotors und die rechte Grenze von pTiT37 enthält, wird durch Spalten von pBR325 (Hind23) mit HindIII und SstII und Isolieren des 1,0 kb langen Fragments isoliert.

28. Dieses 1,0 kb lange HindIII/SstII-Fragment wird in den pUC18-Vektor der Stufe 26 ligiert, wodurch pCIB4 konstruiert wird.

29. pCIB5, welches eine linke T-DNA-Grenze enthält, wird mit AatII gespalten, durch Behandlung mit T4-DNA-Polymerase glattendig gemacht und dann mit EcoRI gespalten.

30. pCIB4 wird mit HindIII gespalten, durch Behandlung mit dem Klenow-Fragment der E. coli-DNA-Polymerase glattendig gemacht und mit EcoRI gespalten.

31.Der Vektor von Stufe 29 wird mit dem großen Fragment von Stufe 30 ligiert, wodurch pCIB2, ein ColE1-Replikon, enthaltend die linken und rechten T-DNA-Grenzen, flankierend ein chimäres Kmr-Gen, und einen Polylinker konstruiert wird.

32. Das Plasmid pRZ102 [Jorgensen, et al., Mol. Gen. Genet., 177 (1979) 65-72] wird mit BamHI gespalten und unter Verwendung von Klenow aufgefüllt

33. Eine AluI-Teilspaltung des Plasmids pA03 [Oka, et al., Nature, 276 (1978) 845-847 und Oka et al., J. Mol. Biol., 147 (1981) 217-226] wird durchgeführt.

34. Die AluI-Spaltung wird in das restriktionsgespaltene pRZ102 aus Stufe 32 ligiert, wobei die gewünschten Transformanten durch Kanamycinresistenz selektiert werden.

35. Das so erhaltene Plasmid besitzt die codierende Sequenz von Tn903, vorhanden auf einem 1,05 kb langen BamHI- Fragment; dieses Fragment wird nach der BamHI-Spaltung und nach Auffüllen mit Klenow isoliert.

36. Das Plasmid pRK252, ein Derivat des Plasmids pRK2 mit breitem Wirtsspektrum ist von Dr. Don Helinski von der University of California, San Diego erhältlich. Diesem Plasmid fehlt die BglII-Spaltstelle, die in dem Stammplasmid pRK290 vorhanden ist [Ditta et al., Proc. Nat. Acad. Sci. USA, in7 (1980) 262-269]. pRK252 wird mit SmaI und SalI gespalten, unter Verwendung von Klenow aufgefüllt, und das große Fragment, das aus dieser Spaltung hervorgeht, wird isoliert.

37. Das TN903 enthaltende Fragment, das in Stufe 35 isoliert wurde, wird an das große Fragment von pRK252 ligiert, wodurch pRK2Km konstruiert wird.

38.Das Plasmid pRK2Km wird mit EcoRI gespalten, mit Klenow glattendig gemacht und mit BglII-Linkern (New England, Biolabs) versehen.

39. Das Plasmid pCIB2 wird mit EcoRV gespalten und mit BglII-Linkern (New England Biolabs) versehen.

40. Das mit BglII-Linkern versehene pCIB2 aus Stufe 39 wird in den Vektor aus Stufe 38 ligiert, wodurch pCIB10 konstruiert wird.

Beispiel 7d: Konstruktion von pCIB10a

Das Beispiel 7c kann unter Verwendung des Plasmids pRK252 anstelle des Plasmid pRK290 wiederholt werden.

41. Das Plasmid pRZ102 [Jorgensen, et al., (1979), a.a.O.] wird mit BamHI gespalten und mit Klenow aufgefüllt.

42. Eine AluI-Teilspaltung des Plasmid pAO3 [Oka, et al., (1978), a.a.O.] wird durchgeführt.

43.Die AluI-Spaltung wird in das restriktionsgespaltene prZ102 aus Stufe 32 ligiert, und die geeigneten Transformanten werden durch Kanamycinresistenz selektiert.

44. Das so erhaltene Plasmid besitzt die codierende Sequenz von Tn903, vorhanden auf einem 1,05 kb langen BamHI-Fragment. Dieses Fragment wird nach BamHI-Spaltung und Auffüllen mit Klenow isoliert.

45. Das Plasmid pRK290, ein Derivat des Plasmids pRK2 mit breitem Wirtsspektrum, ist von Dr. Don Helinski der University of California, San Diego erhältlich. pRK290 wird mit SmaI und SalI gespalten, unter Verwendung von Klenow aufgefüllt und das aus dieser Spaltung hervorgehende große Fragment wird isoliert.

46. Das Tn903 enthaltende Fragment, das in Stufe 35 isoliert wurde, wird in das große Fragment von pRK290 ligiert, wodurch pRK290KM konstruiert wird.

47. Das Plasmid der Stufe 46 wird mit BglII gespalten, mit Klenow aufgefüllt und ligiert, wodurch dessen BglII-Spaltstelle zerstört wird, wobei pRK290KM konstruiert wird.

48. Das Plasmid pRK290Km wird mit EcoRI gespalten, unter Verwendung von Klenow glattendig gemacht und mit BglII-Linkern (New England Biolabs) versehen.

49. Das Plasmid pCIB2 wird mit EcoRV gespalten und mit BglII-Linkern (New England Biolabs) versehen.

50. Das mit BglII-Linkern versehende pCIB2 aus Stufe 39 wird in den Vektor der Stufe 47 ligiert, wodurch pCIB10a konstruiert wird.

Beispiel 7e: Konstruktion eines chimären Gens für das Bacillus thuringiensis-Protoxin mit dem CaMV-35S-Promotor A. Konstruktion einer CaMV-35S-Promotorkassette

Das Plasmid pCIB710 wird, wie in Figur 10 gezeigt, konstruiert. Dieses Plasmid enthält den CaMV-Promotor und Transkriptionsterminationssequenzen für das 35S-RNA- Transkript [Covey, S.N., Lomonosoff, G.P. und Hull, R., Nucleic Acids Research, 2 (1981) 6732-6747]. Ein 1149 bp langes BglII-Restriktionsfragment der CaMV-DNA [bp 7643- 6494 in Hohn et al., (1982)] wird aus dem Plasmid pLV111 (erhalten von Dr. S. Howell, University of California, San Diego; alternativ kann das Fragment direkt aus der CaMV-DNA isoliert werden] durch präparative Agarosegelelektrophorese, wie vorstehend beschrieben, isoliert und mit der BamHI-gespaltenen Plasmid pUC19-DNA, vermischt, mit T4-DNA-Ligase behandelt und in E. coli transformiert. (Hinweis: Die BamHI-Restriktionsspaltstelle des so erhaltenen Plasmids wurde durch Ligieren der cohäsiven BglII-Enden an cohäsive BamHI-Enden zerstört.) Das so erhaltene Plasmid mit der Bezeichnung pUC19/35S wird dann bei der oligonukleotidgerichteten in vitro-Mutagenese verwendet, um die BamHI-Erkennungssequenz GGATCC unmittelbar nach dem CaMV-Nukleotid 7483 der Literaturstelle von Hohn zu insertieren. Das so erhaltene Plasmid pCIB710 enthält die CaMV-35S-Promotorregion und die Transkriptionsterminationregion, getrennt durch eine BamHI-Restriktionsspaltstelle. Die in diese BamHI-Spaltstelle insertierten DNA-Sequenzen werden in Pflanzen von diesen CaMV-Transkriptionsregulationssequenzen exprimiert. (Es wird auch darauf hingewiesen, daß pCIB710 keine ATG-Translationsinitiationscodons zwischen dem Start der Transkription und der BamHI-Spaltstelle enthält.)

B. Insertion der CaMV-35S-Promotor/Terminatorkassette in pCIB10

Die folgenden Stufen sind in Figur 11 dargestellt. Die DNAS der Plasmide pCIB10 und pCIB710 werden mit EcoRI und SalI gespalten, vermischt und ligiert. Bei dem so erhaltenen Plasmid pCIB10/710 ist die CaMV-35S-Promotor/Terminatorkassette in den Pflanz entransformationsvektor pCIB10 insertiert. Die CaMV-35S-Sequenzen befinden sich zwischen den T-DNA-Grenzen in pCB10 und werden so in das Pflanzengenomen bei Pflanzentransformationsexperimenten insertiert.

C. Insertion des Bacillus thuringiensis-Protoxingens in pCIB10/710

Die folgenden Stufen sind in Figur 12 dargestellt. Als Quelle für das Protoxingen wird das Plasmid pCIB10/19SBT mit BamHI und NcoI gespalten, und das 3,6 kb lange Fragment, das das Protoxingen enthält, wird durch präparative Gelelektrophorese isoliert. Das Fragment wird dann mit dem synthetischen NcoI-BamHI-Adapter mit der Sequenz 5'- CATGGCCGGATCCGGC-3' vermischt, dann mit BamHI gespalten. Diese Stufe erzeugt cohäsive BamHI-Enden an den beiden Enden des Protoxinsfragments. Dieses Fragment wird dann in den BamHI-gespaltenen pCIB10/710 insertiert. Das so erhaltene Plasmid pCIB10/35SBt, das in Figur 12 gezeigt ist, enthält das Protoxingen zwischen dem CaMV-35S-Promotor und den Transkriptionsterminationssequenzen.

Das Plasmid pCIB10/19SBt [in dem E. coli-Stamm HB101] wurde bei der ATCC hinterlegt und besitzt die ATCC-Hinteriegungsnr. 67330 [Hinterlegungsdatum: 27. Februar 1987].

pCIB10/35SBt in dem Stamm MC1061 wurde bei der ATCC, Rockville, Maryland USA, unter der Hinterlegungsnr. 67329 hinterlegt. Diese Hinterlegung erfolgte gemäß den Erfordernissen des Budapester Vertrags [Hinterlegungsdatum: 27. Februar 1987].

Beispiel 8a: Transformation von Zea-mays-Protoplasten durch Elektroporation

Alle Stufen, ausgenommen der Hitzeschock, werden bei Raumtemperatur durchgeführt. Die Protoplasten werden in der letzten Stufe von Beispiel 3 in 0,5 M Mannit, enthaltend 0,1% Gew./Vol. MES und 6 mM MgCl&sub2;, resuspendiert. Der Widerstand dieser Suspension wird in der Kammer eines Dialog- Elektroporators gemessen und auf 1 bis 1,2 kOhm unter Verwendung einer 300 mm MgCl&sub2;-Lösung eingestellt. Den Protoplasten wird durch 5minütiges Eintauchen des die Proben enthaltenden Röhrchens in ein Wasserbad bei 45ºC und anschließende Abkühlung auf Raumtemperatur auf Eis ein Hitzeschock versetzt. Aliquoten von 0,25 ml dieser Suspension werden 4 ug linearisiertem pCIB712-Plasmid, das das Hygromycinresistenzgen enthält, und 20 ug Kälberthymus-Träger- DNA zugesetzt.

Diese Protoplasten werden mit 0,125 ml einer 24%igen Gew./Vol. Polyethlyenglykol-(PEG)-Lösung (MW von PEG 8000) in 0,5 M Mannit, enthaltend 30 mM MgCl&sub2;, versetzt. Das Gemisch wird gut, aber sanft gemischt und 10 Minuten lang inkubiert. Die Probe wird in die Kammer des Elektroporators überführt und dreimal mit losekündigen Intervallen von Anfangsspannungen von 1000, 1200, 1500, 1800, 2300 und 2800V cm&supmin;¹ und einer exponentiellen Zerfallszeit des Pulses von 10 Mikrosekunden (usec) gepulst.

Die Protoplasten werden wie folgt gezüchtet:

Die Proben werden in Petrischalen mit einem Durchmesser von 6 cm bei Raumtemperatur gegeben. Nach weiteren 5 bis 15 Minuten werden 3 ml KM-Medium, enthaltend 1,2% Gew./Vol. SeaPlaque -Agarose 1 mg/l 2,4-D und 100 mg/l o-Acetylsalicylsäure zugesetzt. Die Agarose und die Protoplasten werden gut vermischt, und das Medium wird gelieren gelassen.

Beispiel 8b: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8a wird wiederholt, jedoch mit der Modifikation, daß der Widerstand des Protoplastenpräparats auf 0,5 bis 0,7 kOhm eingestellt wird.

Beispiel 8c: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8a wird wiederholt, jedoch mit der Modifikation, daß das verwendete PEG PEG mit einem Molekulargewicht von 4000 ist.

Beispiel 8d: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8c wird wiederholt, jedoch mit der Modifikation, daß der Widerstand des Protoplastenpräparats auf 0,5 bis 0,7 kOhm eingestellt wird.

Beispiel 8e: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8a wird wiederholt, jedoch mit der Modifikation, daß kein PEG zugesetzt wird.

Beispiel 8f: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8b wird wiederholt, jedoch mit der Modifikation, daß kein PEG zugesetzt wird.

Beispiel 8g: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8a wird wiederholt, jedoch mit der Modifikation, daß die Hälfte des Volumens an 12%igem Gew./Vol. PEG zugesetzt wird.

Beispiel 8h: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8b wird wiederholt, jedoch mit der Modifikation, daß die Hälfte des Volumens an 12%igem Gew./Vol. PEG zugesetzt wird.

Beispiel 8i: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8c wird wiederholt, jedoch mit der Modifikation, daß die Hälfte des Volumens an 12%igem Gew./Vol. PEG zugesetzt wird.

Beispiel 8j: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8d wird wiederholt, jedoch mit der Modifikation, daß die Hälfte des Volumens an 12%igem Gew./Vol. PEG zugesetzt wird.

Beispiel 8k: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8j werden wiederholt, jedoch mit der Modifikation, daß die Pulse in Intervallen von 3 Sekunden gesetzt werden.

Beispiel 8l: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiel 8a bis 8k werden wiederholt, wobei die Protoplasten nach der Elektroporatorion in Gefäße auf einer auf eine Temperatur von 16ºC gekühlten Platte gegeben werden.

Beispiel 8m: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8l werden wiederholt, jedoch mit der Modifikation, daß die Protoplasten nach der Elektroporationsstufe in Röhrchen gegeben werden und mit 10 ml einer 6/7 starken KMC-Lösung gewaschen werden, durch 10minütige Zentrifugation bei 60 g gewonnen werden, in 0,3 ml KM-Medium resuspendiert werden und wie in Beispiel 8a plattiert werden.

Beispiel 8n: Transformation von Zea-mays-Protoplasten durch Elektroporation

Beispiel 8m wird wiederholt, jedoch mit der Modifikation, daß das zum Waschen der Protoplasten verwendete Medium eine W5-Lösung (380 mg/l KCl; 18,375 g/l CaCl&sub2;.2H&sub2;O; 9 g/l NaCl; 9 g/l Glucose; pH 6,0) ist.

Beispiel 8o: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8n werden wiederholt, jedoch mit der Modifikation, daß das für die Plattierung der Protoplasten verwendete Medium KM-Medium, enthaltend 30 Volumen-% Schenk-und-Hildebrand-(1972)-Medium, enthaltend 30 uM Dicamba , worin die Zellsuspensionen von Dactylis glomerata zuvor gezüchtet wurden, ist.

Beispiel 8p: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8n werden wiederholt, jedoch mit der Modifikation, daß das für die Plattierung der Protoplasten verwendete Medium KM-Medium, enthaltend 15 Volumen-% Schenk-und-Hildebrand-(1972)-Medium [Can. J. Bot., 50 (1972) 199-204], enthaltend 30 4M Dicamba , worin die Zellsuspensionen von Dactylis glomerata zuvor gezüchtet wurden, ist.

Beispiel 8q: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8n werden wiederholt, jedoch mit der Modifikation, daß das zur Plattierung der Protoplasten verwendete Medium KM-Medium, enthaltend 30 Volumen-% N6-Medium, in dem die in Beispiel 3 beschriebenen Zellsuspensionen zuvor gezüchtet wurden, ist.

Beispiel 8r: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8n werden wiederholt, jedoch mit der Modifikation, daß das zur Plattierung der Protoplasten verwendete Medium KM-Medium, enthaltend 15 Volumen-% N6-Medium, in dem die in Beispiel 3 beschriebenen Zellsuspensionen zuvor gezüchtet wurden, ist.

Beispiel 8s: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8r werden wiederholt, jedoch mit der Modifikation, daß die Protoplasten in einem Kulturmedium (KM-Medium, enthaltend 0,5 mg/l 2,4-D und 100 mg/l o-Acetylsalicylsäure, und 1,2% Gew./Vol. Seaplaque -Agarose) auf Nährkulturfiltern von einer Dichte von 0,5 Millionen Protoplasten/ml aufgenommen werden.

Bei dieser Ausführungsform werden die Durapore-Filter [Katalognr. GVWP 04700, Porengröße 0,22 mm, Durchmesser 47 mm] am Rand mit einem Bleistift auf der oberen Oberfläche, sofern sie von dem Behälter entfernt werden, numeriert. Dies gewährleistet, daß die obere Seite auf den Nährkulturen nach oben liegt, und daß nur ein Filter jeweils aufgebracht wird. Die Filter werden in destilliertem entionisiertem Wasser in einem durchscheinendem Behälter (GA7R oder ein ähnlicher Behälter) 20 Minuten lang autoklaviert. Wenn sie abgekühlt sind, wird das Wasser durch flüssige KM- Medien wie vorstehend beschrieben, aber ohne Geliermittel mindestens 3 Stunden vor Gabe der Filter auf die Nährkulturen ersetzt.

Nährkulturen werden aus Black Mexican Süßmais-Suspensionskulturen (BMS) (Green, Hort. Sci., 12 (1977) 131; Smith et al Plant Sci. Lett., 36 (1984) 67] oder den in Beispiel 3 beschriebenen embryogenen Suspensionen hergestellt.

Wenn BMS als Nährkultur verwendet wird, wird ein steriles KM-Medium mit 0,5 mg/l 2,4-D und 100 mg/l o-Acetylsalicylsäure (2 mg/ml in 2% Vol./Vol. DMSO, enthaltend 0,1% Gew./Vol. MES, pH 6,0) der sterilen Seaplaque -Agarose zugesetzt, wodurch eine Endkonzentration an Agarose von 1,2% Gew./Vol. erhalten wird. Nach Erhitzen zum Schmelzen der Agarose wird das Medium auf 44ºC in einem Wasserbad abgekühlt, 1 ml PCV an BMS-Suspension wird pro 10 ml Medium zugesetzt, und 5 ml Aliquote werden in Petrischalen mit einem Durchmesser von 60 mm verteilt. Wenn das Medium sich verfestigt hat, werden sterile Durapore-Filter auf die Oberfläche gegeben und an der oben aufliegenden Seite numeriert.

Wenn embryogene Maissuspensionskulturen als Nährmedien verwendet werden, wird die Osmolalität der N6-Medien unter Verwendung von Glucose auf etwa 530 bis 540 mOs/kgH&sub2;O erhöht. Der pH-Wert wird auf 6,0 erneut eingestellt, und das Medium wird durch ein 0,2-um-Filter sterilfiltriert. 0,5 mg/l 2,4-D und 100 mg/l o-Acetylsalicylsäure (2 mg/ml in 2% Vol./Vol. DMSO, enthaltend 0,1% Gew./Vol. MES, pH 6,0) werden zugesetzt. Das Medium wird in sterile Seaplaque -Agarose gegeben, wodurch eine Endkonzentration an Agarose von 1,2% Gew./Vol. erhalten wird. Nach Erhitzen zum Schmelzen der Agarose wird das Medium auf 44ºC in einem Wasserbad abgekühlt, 1 ml PCV der embryogenen Suspensionskultur wird pro 10 ml Medium zugesetzt und 5 ml Aliquote werden in Petrischalen mit einem Durchmesser von 60 mm verteilt. Wenn das Medium sich verfestigt hat, werden sterile Durapore- Filter auf die Oberfläche gegeben und auf der oben aufliegenden Seite numeriert.

Das Protoplastenpräparat wird mit gekühltem (44ºC) KM-Medium mit 1,2% Gew./Vol. Seaplaque -Agarose, das 0,5 mg/l 2,4-D und 100 mg/l o-Acetylsalicylsäure enthält, bis zu einer Konzentration von 0,5 Millionen Protoplasten/ml verdünnt. 0,5 ml dieses Präparats werden langsam auf die Oberfläche jedes der Filter pipettiert.

Beispiel 8t: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8s werden wiederholt, jedoch mit der Modifikation, daß die Kälberthymus-Träger-DNA nicht zugesetzt wird.

Beispiel 8u: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8t werden wiederholt, jedoch mit der Modifikation, daß 50 Mikrogramm linearisiertes Plasmid pCIB712 zugesetzt werden.

Beispiel 8v: Transformation von Zea-mays-Protoplasten durch Elektroporation

Die Beispiele 8a bis 8u werden wiederholt, jedoch mit der Modifikation, daß das Plasmid pCIB712 nicht linearisiert ist.

Beispiel 9a: Transformation von Zea-mays-Protoplasten durch Behandlung mit Polyethylenglykol

Die Protoplasten werden in der letzten Stufe von Beispiel 3 mit einer 0,5 M Mannitlösung, die 12 bis 30 mM MgCl&sub2; enthält, resuspendiert. Ein 5minütiger Hitzeschock von 45ºC wird, wie in Beispiel 8a beschrieben, verabreicht. Die Protoplasten werden in Aliquote zur Transformation in Zentrifugenröhrchen mit 0,3 ml suspendierte Protoplasten pro Röhrchen verteilt. Während der nächsten 10 Minuten werden die folgenden Bestandteile zugesetzt: DNA (wie für Beispiel 8a bis 8v) und PEG-Lösung (PEG 6000 40% Gew./Vol.; Ca(NO&sub3;)&sub2; 0,1 M; Mannit 0,4 M; pH 8 bis 9 mit KOH), umfassend eine Endkonzentration von 20% Gew./Vol.. Die Aliquote werden 30 Minuten lang unter gelegentlichem sanftem Schütteln inkubiert, und dann werden die Protoplasten in Petrischalen (0,3 ml ursprüngliche Protoplastensuspension pro Schale mit 6 cm Durchmesser) gegeben und wie in den Beispielen 8a oder 8o bis 8r beschrieben gezüchtet.

Beispiel 9b: Transformation von Zea-mays-Protoplasten durch Behandlung mit Polyethlyenglykol

Die Protoplasten werden in der letzten Stufe von Beispiel 3 in einer 0,5 M-Mannitlösung, die 12 bis 30 mM MgCl&sub2; enthält, in einer Dichte von 20 Millionen Protoplasten/ml resuspendiert. Ein 4minütiger Hitzeschock von 45ºC wird, wie in Beispiel 8a beschrieben, verabreicht. Die Protoplasten werden in Aliquoten zur Tranformation in Zentrifugenröhrchen mit 0,5 ml Protoplasten pro Röhrchen verteilt. Während der nächsten 10 Minuten werden die folgenden Bestandteile zugesetzt: DNA (wie für Beispiel 5a) und PEG-Lösung (PEG 8000 [Sigma oder eine äquivalente Marke], 36% Gew./Vol., 0,1 M Ca(NO&sub3;)&sub2;, 0,4 M Mannit, 0,1% MES, eingestellt über eine Zeitspanne von 3 Stunden auf pH 7 bis 8 mit einer durch 0,2 um-Filter sterilfiltrierten KOH-Lösung) bis zu einer Endkonzentration von 18% Gew./Vol.. Die Aliquote werden 30 Minuten lang unter sanftem Schütteln inkubiert, und dann werden die Protoplasten in Petrischalen gegeben und, wie in Beispiel 8a bis 8s beschrieben, gezüchtet.

Beispiel 9c: Transformation von Zea-mays-Protoplasten durch Behandlung mit Polyethlyenglykol

Die Beispiele 9a und 9b werden wiederholt, und die Protoplasten werden nach 30minütiger Inkubation in PEG durch Zugabe von 0,3 ml WS-Lösung von Beispiel 8n 5mal in 2- bis 3minütigen Intervallen gewaschen, danach werden sie zentrifugiert, der Überstand wird entfernt und die Protoplasten werden wie in den Beispielen 8a bis 8s gezüchtet.

Beispiel 9d: Transformation von Zea-mays-Protoplasten durch Behandlung mit Polyethlyenglykol

Alternativ werden die Protoplasten durch die aufeinanderfolgende Zugabe von 1 ml, 2 ml und 5 ml der W5-Lösung von Beispiel 8n in 5minütigen Intervallen gewaschen. Sie werden dann zentrifugiert, der Überstand wird entfernt, und die Protoplasten werden wie für die Beispiele 8a bis 8s gezüchtet.

Beispiel 9e: Transformation von Zea-mays-Protoplasten durch Behandlung mit Polyethlyenglykol

Die Beispiele 9a bis 9d werden wiederholt, jedoch mit der Modifikation, daß die Endkonzentration an PEG 15% Gew./Vol. beträgt.

Beispiel 9f: Transformation von Zea-mays-Protoplasten durch Behandlung mit Polyethlyenglykol

Die Beispiele 9a bis 9e werden wiederholt, jedoch mit der Modifikation, daß die Endkonzentration von PEG 25% Gew./Vol. beträgt.

Beispiel 9g: Transformation von Zea-mays-Protoplasten durch Behandlung mit Polyethlyenglykol

Die Beispiele 9a bis 9d werden wiederholt, jedoch mit der Modifikation, daß die Endkonzentration an PEG 12% Gew./Vol. beträgt.

Beispiel 9h: Transformation von Zea-mays-Protoplasten durch Behandlung mit Polyethlyenglykol

Die Beispiele 9b bis 9f werden wiederholt, jedoch mit der Modifikation, daß die Protoplasten mit einer KMC-Salzlösung gemäß Beispiel 8n gewaschen werden.

Beispiel 10a: Regeneration des Kallus aus den Protoplasten

Die die Protoplasten in Agarose enthaltenden Platten werden bei 26ºC ins Dunkle gestellt. Innerhalb von 14 Tagen entwickeln sich Zellkolonien aus den Protoplasten. Die die Kolonien enthaltende Agarose wird auf die Oberfläche einer Petrischale mit einem Durchmesser von 9 cm, enthaltend 30 ml N6-Medium mit 2 mg/l 2,4-D, verfestigt mit 0,24% Gew./Vol. Gelrite (2N6), überführt. Die Kolonien werden bis zum Erhalt eines Kallus gezüchtet. Der Kallus wird weiter im Dunkeln bei 26ºC gezüchtet, und Kallusstücke werden alle 2 Wochen in frischem N6-Medium, das 2 mg/l 2,4-D enthält (verfestigt mit 0,24% Gew./Vol. Gelrite ), subkultiviert.

Beispiel 10b: Regeneration des Kallus aus den Protoplasten

Die die Protoplasten aus den Nährkulturen enthaltenden Platten werden bei 26ºC ins Dunkle gestellt. In etwa 2 Wochen sind Kolonien erschienen. Ganze Filter werden dann auf die Oberfläche einer Petrischale mit einem Durchmesser von 9 cm, die N6-Medium mit 2 mg/l 2,4-D enthält, das mit 0,24% Gew./Vol. Gelrite (2N6) verfestigt wurde, überführt, oder die Kolonien werden entnommen und einzeln in dieses Medium überführt. Der sich entwickelnde Kallus wird weiter im Dunkeln bei 26ºC gezüchtet, und Kallusstücke werden alle 2 Wochen in frischem N6-Medium, enthaltend 2 mg/l 2,4-D (verfestigt mit 0,24% Gew./Vol. Gelrite ), subkultiviert.

Beispiel 11a: Selektion des transformierten Kallus von Zea mays

Beispiele 10a und 10b werden wiederholt, jedoch mit der Modifikation, daß 50 mg/l Hygromycin B dem 2N6-Medium Zugesetzt werden, um die transformierten Zellen zu selektionieren.

Beispiel 11b: Selektion des transformierten Kallus von Zea mays

Beispiele 10a und 10b werden wiederholt, jedoch mit der Modifikation, daß 100 mg/l Hygromycin B dem 2N6-Medium Zugesetzt werden, um die transformierten Zellen zu selektionieren.

Beispiel 11c: Selektion des transformierten Kallus von Zea mays

Beispiele 10a und 10b werden wiederholt, jedoch mit der Modifikation, daß 200 mg/l Hygromycin B dem 2N6-Medium zugesetzt werden, um die transformierten Zellen zu selektionieren.

Beispiel 12a: Regeneration von Pflanzen

Der Kallus wird auf 2N6 zum Erhalt und auf ON6 (N6-Medium ohne Hormone) und N61 (0,25 mg/l 2,4-D + 10 mg/l Kinetin) gegeben, um die Regeneration zu initiieren. Das auf ON6- und N61-Medium wachsende Material wird im Licht (16 Stunden/Tageslicht von 10 bis 30 uE/m² sec aus weißen Fluoreszenslampen) gezüchtet. Der auf dem N61-Medium wachsende Kallus wird nach 2 Wochen auf ON6 überführt, da eine längere Zeitspanne aus den N61-Platten schädlich ist. Der Kallus wird alle 2 Wochen subkultiviert, selbst wenn der Kallus erneut auf die gleiche Mediumformulierung zu überführen ist. Die Setzlinge benötigen bis zum Erscheinen 4 bis 8 Wochen.

Sobald die Setzlinge mindestens 2 cm hoch sind, werden sie auf ON6-Medium in GA7-Behältern oder anderen geeigneten Kulturgefäßen überführt. Wurzeln bilden sich in 2 bis 4 Wochen. Sobald die Wurzeln gut genug ausgeprägt erscheinen, um das Wachstum zu unterstützen, werden die Setzlinge auf Boden in Torfkästen überführt, wobei das Licht die ersten 4 bis 7 Tage abgeschattet wird. Es ist oft hilfreich, eine klare Kunststoffumhüllung über die Transplantate mehrere Tage lang zu stülpen.

Sobald sich die Pflanzen entwickelt haben, werden sie wie normale Zea mays-Pflanzen behandelt und im Treibhaus bis zur Reife gezüchtet und dann auf Fertilität und Vererbung der eingeschleusten Gene getestet.

Beispiel 12b: Regeneration von Pflanzen

Beispiel 12 a wird wiederholt, jedoch mit der Modifikation, daß 50 mg/l Hygromycin B dem zur Erhaltung des Kallus verwendeten Medium zugesetzt werden.

Beispiel 12c: Regeneration von Pflanzen

Beispiel 12 a wird wiederholt, jedoch mit der Modifikation, daß 100 mg/l Hygromycin B dem zur Erhaltung des Kallus verwendeten Medium zugesetzt werden.

Beispiel 12d: Regeneration von Pflanzen

Beispiel 12 a wird wiederholt, jedoch mit der Modifikation, daß 200 mg/l Hygromycin B dem zur Erhaltung des Kallus verwendeten Medium zugesetzt werden.

Beispiel 13: Transformation und Regeneration

Die Beispiele 8, 9, 10 und 11 werden wiederholt, jedoch mit den einzigen Modifikationen, daß das Plasmid pCIB10/35SBt als Plasmid-DNA verwendet wird, und daß das Antibiotikum G418 gegen Hygromycin bei den Selektionsstufen ersetzt wird.

Beispiel 14: Konstruktion von pIRV, enthaltend sowohl die chimären Hygromycinresistenz- als auch die chimären BT-Gene

Das Plasmid pCIB712 wird mit SmaI gespalten. Das Plasmid pCIB10/35SBt wird mit SphI gespalten, mit dem großen Fragment der DNA-Polymerase (Klenow-Enzym) behandelt, um glatte Enden zu erzeugen und dann mit SmaI gespalten. Das etwa 4,8 kb lange Fragment, das das chimäre BT-Gen enthält, wird durch Agarosegelelektrophorese gereinigt und an SmaI gespaltene pCIB712-DNA ligiert. Das so erhaltene Plasmid pIRV enthält sowohl das chimäre Hygromycinresistenzgen als auch das chimäre Bt-Gen. pIRV wird an einer geeigneten Stelle distal den chimären Genen vor der Elektroporation linearisiert.

Beispiel 15: Transformation und Regeneration

Die Beispiele 8, 9, 10 und 11 werden wiederholt, jedoch mit der Modifikation, daß das Plasmid pIRV als Plasmid-DNA und Hygromycin bei der Selektion verwendet werden.

Beispiel 16: Konstruktion des Plasmids, das die chimären Chitinase- und chimären Hygromycinresistenzgene tragen

Ein cDNA-Clon, pSCH1, enthaltend die codierende Region eine Tabak-Chitinase-Gens wird in einer Bank von Tabak-cDNAs, die in die PstI-Spaltstelle von pBR322 cloniert ist, identifiziert. Die hybridselektionierte Translation ergibt ein Proteinprodukt, das mit Antikörpern gegen Bohnen-Chitinase Kreuzreaktion zeigt [Shinshi et al., Proc. Natl. Acad. Sci. USA, 84 (1987) 89-93]. Aus einer lambda-Bank der Tabak-DNA wird der entsprechende genomische Clon unter Verwendung des cDNA-Clons als Sonde [Maniatis, a.a.O.] identifiziert. Die Hybridisierung und die Untersuchungen zur Restriktionskartierung werden verwendet, um eine dem cDNA-Clon und dem genomischen Clon gemeinsame PstI-Spaltstelle zu identifizieren.

Die Sequenzanalyse der genomischen DNA stromaufwärts dieser gemeinsamen PstI-Spaltstelle zeigt den Start des offenen Leserasters für das Chitinase-Strukturgen sowie eine SphI- Erkennungsstelle an einer Position -35 von dieser Startstelle. Die folgenden Stufen werden verwendet, um dieses stromaufwärtige genomische DNA-Fragment an das stromabwärtige cDNA-Fragment unter Bildung einer codierenden Region in voller Länge für Chitinase anzufügen:

a/ Das Gen in voller Länge wird in einen Plasmidvektor pGY1 konstruiert, der ein CaMV-35S-Promotorfragment, ein Terminations/Polyadenylierungssignal von CaMV und einen Polylinker zwischen diesen beiden enthält. Die Polarität der Polylinker zwingt die Orientierung des stromaufwärtigen Fragments. Die korrekte Orientierung des stromabwärtigen Fragments wird durch Sequenzanalyse bestimmt.

Das stromaufwärtige SphI/PstI-Fragment aus dem genomischen Clon wird isoliert und gereinigt. Es wird dann in das Plasmid pGY1, das mit SphI und PstI gespalten worden war, ligiert.

b/ Das so erhaltene intermediäre Plasmid wird mit PstI gespalten. Das stromabwärtige PstI-Fragment wird aus dem Clon pSCH1 isoliert und in diesen gespaltenen intermediären Vektor ligiert.

c/ Der Clon mit der korrekten Orientierung und der Fusion im Leseraster des cDNA-Fragments an das stromaufwärtige genomische DNA-Fragment wird durch DNA-Sequenzanalyse bestätigt. Das so erhaltene Plasmid wird als pSCH1 bezeichnet. Das Plasmid pSCH1 [in dem E. coli-Stamm K12] wurde bei der Deutschen Sammlung von Mikroorganismen in Göttingen, Westdeutschland, unter der Hinterlegungsnr. DSM 4129 hinterlegt. Diese Hinterlegung erfolgte gemäß den Erfordernissen des Budapester Vertrags [Hinterlegungsdatum: 29. Mai 1987].

Das komplette Chitinasegen, das von dem CaMV-35S-Promotor und den Terminatorregionen flankiert ist, wird durch EcoRI- Spaltung aus pSCH1 herausgeschnitten. Das Fragment wird durch die Verwendung des großen Fragment der DNA-Polymerase I [Maniatis, a.a.O.] glattendig gemacht. Das Rezeptorplasmid pCIB712, das ein chimäres Hygromycinresistenzgen enthält, das in Pflanzenzellen exprimiert wird, wird mit 5mal gespalten. Das 5mal gespaltene pCIB712-Plasmid und das glattendige Fragment, das das chimäre Chitinasegen enthält, werden unter Verwendung von T4-DNA-Ligase miteinander ligiert [Maniatis, a.a.O.]. Das so erhaltene Plasmid wird als pCIBcht bezeichnet. Vor der Protoplastentransformation wird pCIBcht an einer zu den chimären Genen distalen Stelle linearisiert.

Beispiel 17: Konstruktion eines Vektors, der das chimäre AHAS-Gen, welches Sulfonylharnstoffresistenz verleiht, trägt a. Isolierung von sulfonylharnstoffresistenten (SU-R) Arabidopsis-Pflanzen

Mit Ethylmethansulfonat (EMS) mutagenisierte M2-Arabidopsis thaliana-(Rasse Columbia)-Samen werden gemäß Haughn und Somerville [Mol. Gen. Genet. 204 (1986) 430-434] und Somerville und Ogren (Methods in Chloroplast Molecular Biology, Edelman et al. (Hrsg.) (1982) 129-138) erzeugt. Das EMS wird in einer Konzentration von 0,3% 14 bis 16 Stunden lang eingesetzt, und die M1-Samen werden ausgesät und in einer Dichte von 2 bis 3 Pflanzen pro cm² gezüchtet.

Sulfonylharnstoffresistente-(SU-R)-Arabidopsis-Pflanzen werden ausgewählt und aus den M2-Stammsamen gemäß Haughn und Somerville (a.a.O.) gezüchtet.

b. Konstruktion der rekombinanten lambda-Phagenbank von SU- R-Arabidopsis-DNA

Die DNA wird aus den SU-R-Arabidopsis-Pflanzen gemäß Jen und Chilton [J. Bacteriol., 166 (1986) 491-499] isoliert. Die Arabidopsis-DNA wird vollständig mit XbaI (New England Biolabs) gespalten. 4 bis 8 kpb lange DNA-Fragmente werden aus einem Agarosegel unter Verwendung einer NA45-DEAE-Membran (Schleicher und Schuell, Keene, N.H. Katalog Nr. 03431) isoliert und in den lambda-ongC-X-Vektor (Stratagene, 3770 Tansy St., San Diego, CA 92121) unter Verwendung des vom Hersteller empfohlenen Verfahrens cloniert. Die rekombinante Phagen-DNA wird unter Verwendung des Gigapack-plus-Kits von Strategene verkapselt.

c. Clonierung des SU-R-Acetohydroxysäuresynthase-(AHAS)- Gens aus SU-R-Arabidopsis-Pflanzen

Das Plasmid pE16/8-c4, das den ILV2-Locus von Saccharomyces cerevisiae [J. Polaina, Carlsberg Res. Comm., 49 (1984) 577-584] enthält, wird von J. Polaina erhalten und in E. coli-HB101 transformiert, und eine Plasmidherstellung in großem Maßstab wird durchgeführt. Das Plasmid pE16/8-c4 wurde bei der American Type Culture Collection unter der Hinterlegungsnr. 67420 hinterlegt. Diese Hinterlegung erfolgte gemäß den Erfordernissen des Budapester Vertrags [Hinterlegungsdatum: 29. Mai 1987]. Die DNA des Plasmids pe16/8-c4 wird mit EcoRI gespalten und das 2,1-kbp-(Eco 2.1)-Fragment, das die für AHAS codierende Sequenz enthält [Falco et al., Nucl. Acid Res 13 (1985) 4011-4027], wird aus einem Agarosegel isoliert. Das Eco-2.1-Fragment wird mit 32-Phosphor bis zu einer spezifischen Aktivität von 5 bis 8 x 10&sup8; cpm/ug mit dem PRIME-TIME-Kit (International Biotechnologies, Inc.) radioaktiv markiert.

Die rekombinanten Phagen, die die Arabidopsis-XbaI-Fragmente enthalten, werden auf E. coli-VCS-257 gemäß Maniatis et al., (1982) [Cold Spring Harbor, N.Y.] und den Protokollen von Stratagene ausplattiert.

Doppelte Aufnahmen des lambda-Plaques werden von jeder Phagenplatte mit der Kolonie/PlaqueScreen -Membran (New England Nuclear Research Products) gemäß dem Protokoll des Herstellers vorgenommen. Die Aufnahmen an Plaques werden wie folgt behandelt:

i/ Waschung in 5 x SSC, 2% SDS bei 65ºC für 6 Stunden [alle Vorschriften entsprechen Maniatis et al., (a.a.O.)];

ii/ Vorhybridisierung in einem Hybridisierungsgemisch (5 x SSC, 1% SDS, 5 x Denhardt's-Lösung, 200 ug/ml denaturierte und mit Scherkräften behandelte Lachs-DNA, 25% Formamid, 10% Dextransulfat; 10 ml Gemisch pro 150 mm Membran) bei 42ºC für 16 bis 20 Stunden;

iii/ Hybridisierung in Hybridisierungsgemisch (10 ml pro 150 mm Membran), enthaltend 2 ng/ml denaturiertes radioaktiv markiertes Eco-2.1-Fragment bei 42ºC für 18 bis 20 Stunden;

iv/ Waschung in 2 x SSC, 1% SDS bei Raumtemperatur für 30 Minuten;

v/ Waschung in 5 x SSC, 1% SDS, 25% Formamid bei 42ºC für 6 bis 8 Stunden mit vier Wechseln der Waschlösung. Die Membranen werden einem Röntgenfilm (Kodak X-Omat AR) exponiert. Phagenplaques, die zusammenfallende Hybridisierung auf den doppelten Membranen zeigen, werden mit einer zweiten Runde von Entnahmen an lambda-Plaque und Hybridisierung mit der Eco-2.1-Sonde gereinigt.

Die Plattenlysate des rekombinanten Phagen, der die den Hefe-AHAS-Sequenzen homologe Insertion enthalten, werden gemäß Maniatis et al. (a.a.O.) hergestellt. Die Phagen-DNA wird aus Plattenlysaten mit Lambdasorb (Promega, 2800 S. Fish Hatchery Rd., Madison, WI 53711) gemäß den vom Hersteller empfohlenen Verfahren hergestellt.

d. Konstruktion und Bestätigung des Transformationsvektors pCIB803, der das SU-R-Arabidonsis-AHAS-Gen enthält

Die rekombinante Phagen-DNA wird mit XbaI gespalten und das 5,8 kbp lange Insertionsfragment wird in einen XbaI-gespaltenen pCIB10-Transformationsvektor insertiert, wodurch pCIB803 erhalten wird. Das Plasmid pCIB803 wird von dem E. coli-HB101-Wirt in Agrobacterium tumefaciens CIB542 durch dreistämmige Paarung [Ditta et al., Proc. Acad. Sci. USA, 77 (1980) 262-269] überführt. A. tumefaciens pCIB803/CIB542 wird zur Transformation von Arabidopsis-thaliana-Pflanzenexplantaten gemäß Lloyd et al. [Science, 234 (1980) 464-466] und Sheikholeslam und Weeks [Plant Molec. Biol., 8 (1987) 291-298] verwendet. Die transformierten Gewebe werden zu Pflanzen gemäß Lloyd et al. (a.a.O.) und Feldman und Marks [Plant Sci., 47 (1986) 63-69] regeneriert. Es wird gezeigt, daß das Wachstum der transformierten Gewebe in Kulturmedium gegenüber 3 bis 10 ng/ml Chlorsulfuron tolerant ist. Es wurde gezeigt, daß die Keimung und das Wachstum der transgenen Arabidopsis-Pflanzen in Agarmedien gegenüber 10 bis 30 ng/ml Chlorsulfuron tolerant ist.

e. Konstruktion des Transformationsvektors pCIB804, enthaltend ein chimäres SU-R-AHAS-Gen

Die Lokalisation der für AHAS codierenden Sequenz innerhalb des 5,8-Xba-Fragments wird durch Kartierung mit Nuklease-S1 [Maniatis et al., a.a.O.], Primerextension [McKnight et al., Cell, 25 (1981) 385-398] bestimmt und durch Sequenzierung der DNA [Sanger et al., Proc. Nat. Acad. Sci. USA, 74 (1977) 5463-5467] und Vergleichen der Proteinsequenzen mit bakteriellen und Hefe-AHAS-Sequenzen [Falco et al., Nucl. Acid Res., 13 (1985) 4011-4027] bestätigt. Das 5,8 kb lange XbaI-Fragment wird in Bluescript (Stratagene) cloniert, und Sequenzen stromaufwärts der für AHAS codierenden Sequenz werden auf innerhalb 10 bis 20 bp stromaufwärts des AHAS- Initiationscodons unter Verwendung des Exo/Mung-Deletion- Kits (Stratagene) deletiert. Ein geeigneter Linker wird an den Deletionsendpunkt angefügt. Das resektierte AHAS-Gen an einer geeigneten Restriktionsspaltstelle mindestens 10 bp stromabwärts des AHAS-Terminationscodons gespalten, und der gleiche Linker, der am 5'-Ende des Gens verwendet wird, wird an das 3'-Ende des Gens geknüpft. Das die für AHAS codierende Sequenz enthaltende Fragment wird aus dem Vektor durch Spalten an den Linkerstellen herausgeschnitten und in die BamHI-Spaltstelle von pCIB710 cloniert.

Die BamHI-Spaltstelle von pCIB710 wird angepaßt oder in eine mit dem vorstehend verwendeten Linker kompatible Stelle umgewandelt, sofern notwendig, um das mit einem Linker versehene SU-R-AHAS-Gen aufzunehmen. Die Orientierung der AHAS-Geninsertion in pCIB710 wird mit geeigneten Restriktionsenzymen bestimmt. Der die für AHAS codierende Sequenz in korrekter Orientierung bezüglich der Transkriptionsrichtung des CaMV-35S-Promotors enthaltende Clon wird als pCIB804 bezeichnet.

Beispiel 18: Förderung der Kallusbildung aus Protoplasten von Zea mays durch 2,4-D und Acetylsalicylsäure

Die Protoplasten werden in der letzten Stufe von Beispiel 3 in einer 6/7-starken KMC-Lösung in einer Konzentration von 7,5 Millionen pro ml resuspendiert. Die o-Acetylsalicylsäure wird in einer Konzentration von 2,5 mg/ml in dem KM- Medium aufgelöst. Die Lösung wird sterilfiltriert. Die o- Acetylsalicylsäure wird dann dem Kulturmedium unmittelbar vor Gebrauch zugesetzt. Aliquote der Protoplastensuspension werden in Petrischalen mit einem Durchmesser von 6 cm bei Raumtemperatur gegeben. 3 ml KM-Medium, enthaltend 1,2% Gew./Vol. SeaPlaque -Agarose, 2,4-D und o-Acetylsalicylsäure werden zugesetzt, um die korrekten 2,4-D- und o-Acetylsalicylsäurekonzentrationen und eine Protoplastendichte von 0,5 Millionen pro ml zu ergeben. Die Agarose und die Protoplasten werden gut gemischt, und das Medium wird gelieren gelassen.

Die Platten werden wie in Beispiel 7 beschrieben gezüchtet.

Nach einer Periode von 3 Wochen werden die makroskopischen Kolonien, die sich in den Schalen entwickeln, gezählt. Die Ergebnisse sind in den Tabellen 2 und 3 für die Protoplasten aus zwei verschiedenen unabhängig voneinander erhaltenen embryogenen Suspensionskulturen gezeigt.

o-Acetylsalicylsäure (mg/l) NT: Nicht getestet

Tabelle 2: Koloniebildung aus Zea mays-Protoplasten in Gegenwart von o-Acetylsalicylsäure und 2,4-D. [Die Ziffern sind die Anzahlen der gebildeten Kolonien]

o-Acetylsalicylsäure

Tabelle 3: Koloniebildung aus Zea mays-Protoplasten in Gegenwart von o-Acetylsalicylsäure und 2,4-D. [Die Ziffern sind die Anzahlen der gebildeten Kolonien]

Figur 7: Kolonien, entstehend aus Zea mays-Protoplasten, plattiert in KM-Medium mit und ohne 2,4-D und Acetylsalicylsäure.

Links oben: Kein 2,4-D oder Acetylsalicylsäure.

Rechts oben: 1 mg/l 2,4-D und keine Acetylsalicylsäure.

Links unten: 100 mg/l Acetylsalicylsäure und kein 2,4-D.

Rechts unten: 100 mg/l Acetylsalicylsäure und 1 mg/l 2,4-D.

Beispiel 19: Erhöhte Koloniebildung aus Protoplasten von Zea mays durch Zugabe von o-Acetylsalicylsäure und 2,4-D

Die Protoplasten werden wie in Beispiel 18 beschrieben hergestellt und für die Kultur in 2 ml Medium in Petrischalen mit einem Durchmesser von 6 cm ausplattiert.

Die Schalen werden, wie in Beispiel 10 beschrieben, bebrütet. Nach einer Zeitspanne von 3 Wochen werden die makroskopischen Kolonien, die aus den Schalen hervorgehen, gezählt. Die Ergebnisse sind in Tabelle 4 gezeigt. Es wurde erneut gefunden, daß o-Acetylsalicylsäure die Koloniebildung stimuliert. Jedoch wird bei einer Konzentration von 300 mg/l und darüber eine toxische Wirkung beobachtet. Man nimmt an, daß dies eine Folge des pH-Problems sein könnte, und daß dies wahrscheinlich durch geeignete Pufferung des Mediums überwunden werden könnte.

o-Acetylsalicylsäure (mg/l)

4: Koloniebildung (pro Schale) von Zea mays-Protoplasten in Anwesenheit von o-Acetylsalicylsäure und 2,4-D. [Die Ziffern sind die Anzahlen der gebildeten Kolonien]

Beispiel 20: Förderung der Koloniebildung aus Zea mays-Protoplasten durch DMSO und o-Acetylsalicylsäure in Anwesenheit von 2,4-D

Die Protoplasten werden wie in Beispiel 18 beschrieben hergestellt und in einer Konzentration von 0,75 Millionen pro ml unter Verwendung von 1 ml Medium pro Petrischale mit 3,5 cm Durchmesser plattiert. Die o-Acetylsalicylsäure wird in das Medium aufgenommen. Die o-Acetylsalicylsäure wird in DMSO aufgelöst und dann dem Medium vor Plattierung der Protoplasten zugesetzt. Um eine Lösung in DMSO zu erhalten, wird ein 1 g o-Acetylsalicylsäure in 10 ml DMSO aufgelöst und zu 90 ml destilliertem Wasser gegeben. Die Lösung wird dann vor Gebrauch steril filtriert.

Die Platten werden, wie in Beispiel 10 beschrieben, bebrütet. Nach einer Zeitspanne von 3 Wochen werden die makroskopischen Kolonien, die aus den Schalen hervorgehen, gezählt. Die Ergebnisse sind in Tabelle 5 gezeigt. DMSO allein (1% Vol./Vol.) ergibt keine signifikante Erhöhung oder Abnahme der Koloniebildungeffizienz der Zea mays-Protoplasten und potenziert offensichtlich die stimulierende Wirkung der o-Acetylsalicylsäure.

Keine Zugaben 100mg Acetylsalicylsäure/l

Tabelle 5: Wirkung von o-Acetylsalicylsäure auf die Koloniebildung durch Zea mays-Protoplasten, wobei die stimulierende Wirkung der Auflösung der o- Acetylsalicylsäure in DMSO gezeigt ist. [Anzahl der gebildeten Kolonien]

Beispiel 21: Erhöhung der Koloniebildung von Zea mays-Protoplasten durch Zugabe von 2,4-D und verwandter Pflanzenwachstumsregulatoren (Auxine)

Die Protoplasten werden in der letzten Stufe von Beispiel 3 in 6/7-starker KMC-Lösung in einer Konzentration von 5 Millionen pro ml resuspendiert. Aliquote der Protoplastensuspension werden in Petrischalen mit einem Durchmesser von 6 cm bei Raumtemperatur gegeben. 2 ml des KM-Mediums, welches 1,2% Gew./Vol. SeaPlaque -Agarose und 2,4-D, Picloram, Dicamba oder para-Chlorphenoxyessigsäure (pCPA) enthält, werden zugesetzt, um die korrekten Konzentrationen an Pflanzenwachstumsregulator zu ergeben. Die verwendete abschließend erreichte Protoplastendichte beträgt 0,54 Millionen pro ml. Die Agarose und die Protoplasten werden gut vermischt und das Medium wird gelieren gelassen.

Die Platten werden, wie in Beispiel 10 beschrieben, bebrütet. Nach einer Zeitspanne von 3 Wochen werden die makroskopischen Kolonien, die aus den Schalen hervorgehen, gezählt. Die Ergebnisse sind in Tabelle 6 dargestellt.

Konzentration an Pflanzenwachstumsregulator (mg/l)
Auxin Picloram Dicamba

Tabelle 6: Koloniebildung aus gezüchteten Protoplasten von Zea mays in Gegenwart von verschiedenen Pflanzenwachstumsregulatoren (Auxine) [Anzahl der gebildeten Kolonien]

Beispiel 22: Konstruktion eines deletierten Bt-Protoxingens, enthaltend etwa 725 Aminosäuren. und Konstruktion eines chimären Gens, enthaltend dieses deletierte Gen mit dem CaMV-35S-Promotor

Ein deletiertes Protoxingen, enthaltend etwa 725 Aminosäuren, wird durch Entfernen des COOH-terminalen Teils des Gens durch Spaltung an der KnpI-Restriktionsspaltstelle in Position 2325 in der in Formel I in Figur 13 gezeigten Sequenz hergestellt. Das Plasmid pCIB10/35SBt (Figur 12) wird mit BamHI und KnpI gespalten, und das ungefähr 2,2 kpb lange BamHI/KnpI-Fragment, das das deletierte Protoxingen enthält, wird durch präparative Agarosegelelektrophorese isoliert. Um die KnpI-Spaltstelle am 3'-Ende in eine BamHI- Spaltstelle umzuwandeln, wird das Fragment mit einem KnpI/BamHI-Adapter-Oligonukleotid gemischt und ligiert. Dieses Fragment wird dann mit BamHI-gespaltenem pCIB10/710 vermischt (Figur 11). Die so erhaltenen Transformanten mit der Bezeichnung pCIB10/35SBT (KnpI), die in Figur 15 gezeigt sind, enthalten das deletierte Protoxingen von etwa 725 Aminosäuren. Diese Transformanten werden auf Kanamycin selektioniert.

Beispiel 23: Konstruktion eines deletierten Bt-Protoxingens, enthaltend etwa 645 Aminosäuren und Konstruktion eines chimären Gens, enthaltend dieses deletierte Gen mit dem CaMV-35S-Promotor

Ein deletiertes Protoxingen, enthaltend etwa 645 Aminosäuren, wird durch Entfernen des COOH-terminalen Teils des Gens durch Spalten an der BclI-Restriktionsspaltstelle in Position 2090 in der in Formel I in Figur 13 gezeigten Sequenz hergestellt. Das Plasmid pCIB10/35SBt (Figur 12) wird mit BamHI und BclI gespalten, und das ungefähr 1,9 kpb lange BamHI/BclI-Fragment, das das deletierte Protoxingen enthält, wird durch präparative Agarosegelelektrophorese isoliert. Da BclI ein cohäsives mit BamHI kompatibles Ende erzeugt, wird vor der Ligierung des Fragments in das BamHI- gespaltene pCIB10/710 (Figur 11) keine weitere Manipulation benötigt. Das so erhaltene Plasmid, das die in Figur 16 gezeigte Struktur pCIB10/35SBt (BclI) besitzt, wird auf Kanamycin selektioniert.

Beispiel 24: Konstruktion eines deletierten Bt-Protoxin- gens, enthaltend ungefähr 607 Aminosäuren, und Konstruktion eines chimären Gens. enthaltend dieses deletierte Gen mit dem CaMV-35S-Promotor

Ein deletiertes Protoxingen wird durch Einschleusen einer BamHI-Spaltstelle (GGATCC) nach Nukleotid 1976 in der in Formel I gezeigten Sequenz (Figur 13) hergestellt. Dies wird durch Clonieren des BamHI-Fragments, das die Protoxinsequenz auf pCIB10/35SBT enthält, in mp18 und unter Verwendung der vorstehend beschriebenen Standard-Oligonukleotidmutageneseverfahren durchgeführt. Nach der Mutagenese wird doppelsträngige replikative DNA aus dem M13-Clon hergestellt, der dann mit BamHI gespalten wird. Das ungefähr 1,9 kbp lange Fragment, das das deletierte Protoxingen enthält, wird in das BamHI-gespaltene pCIB10/710 insertiert. Das so erhaltene Plasmid, das die Struktur pCIB10/35SBt(607) besitzt, ist in Figur 17 gezeigt und wurde auf Kanamycin selektioniert.


Anspruch[de]

1. Verfahren zur Erzeugung einer Kallus-Kultur von Zea mays, aus der Protoplasten isoliert werden können, wobei die Protoplasten zu fertilen Pflanzen regeneriert werden können, dadurch gekennzeichnet, daß man in Stufen

(a) aus Zea mays-Pflanzen stammendes Gewebe in einem geeigneten Medium mit der Fähigkeit zur Initiierung eines Kallus und/oder zur Unterhaltung der Kallus-Proliferation züchtet, bis ein spezieller Kallus-Typ, der relativ wenig schleimig, körnig und zerreibbar ist, identifiziert werden kann,

(b) den speziellen Kallus-Typ selektioniert, und

(c) den speziellen Kallus-Typ auf einem geeigneten, einen Kallus unterhaltenden Medium züchtet.

2. Verfahren nach Anspruch 1, wobei das Gewebe von Stufe (a) einen Kallus bilden kann und unreifes Zea mays- Gewebe, bevorzugt aus unreifen Narbenfäden, unreifen Embryonen, dem Basalteil von jungen Blättern oder aus dem Schildchen unreifer Embryonen, ist.

3. Verfahren nach Anspruch 2, wobei das unreife Gewebe von Stufe (a) aus unreifen Embryonen mit einer Länge von 1 und 4 mm besteht.

4. Verfahren nach einem der Ansprüche 1 bis 3, wobei man das Gewebe der Stufe (a) und den relativ wenig schleimigen, körnigen und zerreibbaren Kallus von Stufe (c) in Gegenwart von geeigneten Konzentrationen von Zuckern und Pflanzenwachstumsregulatoren züchtet.

5. Verfahren nach einem der Ansprüche 1 bis 3, wobei der in Stufe (a) angesetzte Kallus in frischem Erhaltungsmedium in Intervallen von 1 bis 120 Tagen und einer Temperatur zwischen 0º und 50ºC subkultiviert wird, bis der relativ wenig schleimige, körnige und zerreibbare Spezialkallus von Stufe (a) identifiziert werden kann.

6. Verfahren nach einem der Ansprüche 1 bis 5, wobei der relativ wenig schleimige, körnige und zerreibbare Spezialkallus von Stufe (a) in frischem Erhaltungsmedium in Intervallen von 1 bis 120 Tagen subkultiviert wird.

7. Verfahren zur Erzeugung von Zellsuspensionskulturen von Zea mays-Zellen und Zellaggregaten, aus denen Protoplasten isoliert werden können, wobei die Protoplasten zu fertilen Pflanzen regeneriert werden können, dadurch gekennzeichnet, daß man

(a) aus Zea mays-Pflanzen stammendes Gewebe in einem geeigneten Medium mit der Fähigkeit zur Initiierung eines Kallus und/oder zur Unterhaltung der Kallus-Proliferation züchtet, bis ein spezieller Kallus-Typ, der relativ wenig schleimig, körnig und zerreibbar ist, identifiziert werden kann;

(b) den speziellen Kallus-Typ selektioniert;

(c) gegebenenfalls den speziellen Kallus-Typ auf einem geeigneten, einen Kallus unterhaltenden Medium subkultiviert;

(d) den speziellen Kallus-Typ in ein flüssiges Medium überführt, um eine Suspension von Zellen oder Zellaggregaten zu bilden;

(e) die Suspension für eine geeignete Zeitspanne und mit einer Häufigkeit, die ausreicht, die Zellen und Zellaggregate in einem lebensfähigen Zustand zu erhalten, subkultiviert, und

(f) die Kulturen aus dem Produkt der Stufe (e), die Aggregate von dichten cytoplasmatischen, sich teilenden Zellen enthalten, selektioniert und beibehält.

8. Verfahren nach Anspruch 7, wobei man die Suspension von Stufe (e) für eine Zeitspanne von etwa 7 Tagen und mit einer Häufigkeit, die ausreicht, die Zellen und Zellaggregate in einem lebensfähigen Zustand zu erhalten, subkultiviert.

9. Verfahren nach einem der Ansprüche 7 bis 8, wobei man in Stufe (e) die Subkultivierung durchführt, bis die Suspensionskultur einen Anteil von mindestens 50% an dichten, cytoplasmatischen, sich teilenden Zellen und Zellaggregaten enthält.

10. Verfahren zur Erzeugung von Zea mays-Protoplasten mit der Fähigkeit, sich zu fertilen Pflanzen zu regenerieren, dadurch gekennzeichnet, daß man entweder:

(i) den gemäß Anspruch 1 erhältlichen Kallus entnimmt;

oder

(ii) die Kulturen, die gemäß einem der Ansprüche 7 bis 9 erhältlich sind, entnimmt, wobei die Kulturen aus Aggregaten von dichten, cytoplasmatischen, sich teilenden Zellen bestehen; und man

die Zellwände mit einem geeigneten Enzympräparat entnimmt und die so erhaltenen Protoplasten isoliert und reinigt.

11. Verfahren zur Regeneration von Zea mays-Pflanzen aus Protoplasten, dadurch gekennzeichnet , daß man:

(i) Protoplasten mit der Fähigkeit, zu fertilen Pflanzen regeneriert zu werden, erhältlich nach dem Verfahren von Anspruch 10, erzeugt;

(ii) die Protoplasten in einem geeigneten Medium ausplattiert, in dem sich die Protoplasten teilen und Zellen bilden; und

(iii) die so erhaltenen Zellen subkultiviert, um Setzlinge auf einem Wachstumsmedium zu regenerieren, um fertile Pflanzen zu erhalten.

12. Verfahren nach Anspruch 11, wobei die Zea mays-Protoplasten stabil inkorporierte exogene DNA enthalten.

13. Verfahren nach Anspruch 11, wobei die DNA in Zea mays exprimierbar ist.

14. Verfahren nach Anspruch 11, wobei man die Zea mays- Protoplasten in Gegenwart einer für die Regulation des Wachstums effektiven nichttoxischen Menge eines Pflanzenwachstumsregulators und in Gegenwart einer Menge an o-niedrig-Alkanoylsalicylsäure, die ausreicht, die Zellteilung oder Koloniebildung zu fördern, züchtet.

15. Verfahren nach Anspruch 14, wobei die Menge des Pflanzenwachstumsregulators im Bereich von etwa 0,01 bis etwa 100 mg/l liegt.

16. Verfahren nach Anspruch 14, wobei die o-niedrig-Alkanoylsalicylsäure o-Acetylsalicylsäure oder o-Propionylsalicylsäure ist.

17. Verfahren nach Anspruch 14, wobei man die Zea mays- Protoplasten in Gegenwart eines Pflanzenwachstumsregulators, ausgewählt aus der Gruppe, bestehend aus Dicamba, Picloram, pCPA und 2,4-D, und in Gegenwart einer Menge einer niedrig-Alkanoylsalicylsäure, ausgewählt aus der Gruppe, bestehend aus o-Acetylsalicylsäure und o-Propionylsalicylsäure, die ausreicht, um die Zellteilung oder Koloniebildung zu fördern, züchtet.

18. Verfahren nach Anspruch 17, wobei der Pflanzenwachstumsregulator 2,4-D ist und im Bereich von 0,1 bis 100 mg/l liegt, und die o-niedrig-Alkanoylsalicylsäure o-Acetylsalicylsäure ist.

19. Verfahren nach Anspruch 14, umfassend weiterhin die Anwesenheit einer Menge an DMSO, die ausreicht, um die Zellteilung oder Koloniebildung zu fördern.

20. Verfahren nach Anspruch 11, wobei die Protoplasten in Stufe (i) sich unter Bildung eines Kallus teilen.

21. Verfahren nach Anspruch 22, wobei der Kallus Embryonen oder Proembryonen vor der Regeneration zu Setzlingen bildet.

22. Verfahren nach Anspruch 13, wobei die Zellen in Stufe (iii) vor der Regeneration zu Setzlingen Embryonen bilden.

23. Verfahren zur Erzeugung von transgenen Zea mays-Protoplasten, die sich zu fertilen Pflanzen regenerieren können, dadurch gekennzeichnet, daß man die nach dem Verfahren nach Anspruch 10 erhältlichen Protoplasten mit exogener DNA behandelt, um Zea mays-Zellen zu erzeugen, die die Gesamtheit oder einen Teil der in ihr genetisches Material inkorporierten exogenen DNA enthalten.

24. Protoplast von Zea mays mit der Fähigkeit, sich zu fertilen Pflanzen zu regenerieren, und erhältlich nach dem Verfahren von Anspruch 10.

25. Protoplast nach Anspruch 24, in den stabil exogene DNA inkorporiert ist

26. Protoplast nach Anspruch 25, bei dem die inkorporierte exogene DNA in Zea mays exprimierbar ist.

27. Protoplast nach Anspruch 26, wobei die inkorporierte exogene DNA ein chimäres Gen ist, das der transformierten Pflanze eine neue phänotypische Eigenschaft verleiht.

28. Protoplast nach Anspruch 27, wobei die neue phänotypische Eigenschaft erhöhte Resistenz gegenüber Schädlingen; erhöhte Resistenz gegenüber Krankheitserregern; erhöhte Resistenz gegenüber Chemikalien; erhöhte Resistenz gegenüber Cytotoxinen; erhöhte Resistenz gegenüber ungünstigen Umwelteinflüssen; erhöhte Bildung von erwünschten Substanzen; erniedrigte Bildung von unerwünschten Substanzen; oder modifizierte morphologische oder entwicklungsbedingte Eigenschaften ist.

29. Protoplast nach Anspruch 28, wobei die neue phänotypische Eigenschaft eine erhöhte Herbizidresistenz ist.

30. Protoplast nach Anspruch 29, wobei die erhöhte Herbizidresistenz auf eine veränderte Acetohydroxysäuresynthase zurückzuführen ist.

31. Protoplast nach Anspruch 27, wobei inkorporierte exogene DNA ein chimäres Gen ist, das ein Polypeptid mit den insektentoxischen Eigenschaften des kristallinen Bacillus thuringiensis-Proteins codiert.

32. Protoplast nach Anspruch 24, wobei der Zea mays-Genotyp eine Zea mays-Inzuchtlinie ist.

33. Protoplast nach Anspruch 24, wobei der Zea mays-Genotyp eine Elite-Zea mays-Inzuchtlinie ist.

34. Protoplast nach Anspruch 33, wobei der Elite-Zea mays Funk 2717 ist, der bei der American Type Culture Collection unter der ATCC-Hinterlegungsnr. 40326 hinterlegt ist.

35. Protoplast nach Anspruch 26, wobei der Zea mays-Genotyp eine Zea mays-Inzuchtlinie ist.

36. Protoplast nach Anspruch 35, wobei der Zea mays-Genotyp eine Elite-Zea mays-Inzuchtlinie ist.

37. Protoplast nach Anspruch 36, wobei der Elite-Zea mays Funk 2717 ist, der bei der American Type Culture Collection unter der ATCC-Hinterlegungsnr. 40326 hinterlegt ist.

38. Embryogene Zellkultur von Zea mays, aus der Protoplasten isoliert werden können, wobei die Protoplasten Zellwände regenerieren, sich teilen und einen Kallus mit der Fähigkeit, sich zu fertilen Pflanzen zu regenerieren, bilden und die nach dem Verfahren nach einem der Ansprüche 7 bis 22 erhältlich ist.

39. Embryogene Zellkultur nach Anspruch 38, wobei die Zellkultur eine Suspensionskultur ist.

40. Embryogene Zellkultur nach Anspruch 38, wobei die Zellkultur eine Kallus-Kultur ist.

41. Embryogene Zellsuspensionskultur von Zea mays, die zu fertilen Zea mays-Pflanzen regeneriert werden kann, und die nach dem Verfahren nach Anspruch 7 erhältlich ist.







IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com