PatentDe  


Dokumentenidentifikation DE68927167T2 03.04.1997
EP-Veröffentlichungsnummer 0396741
Titel FÜR [LYS46, ASP97, ASP113] UND [LYS46, ASP113, ASP137] THAUMATIN-I POLYPEPTIDE KODIERENDE DNA
Anmelder International Genetic Engineering, Inc., Santa Monica, Calif., US
Erfinder BLAIR, Lindley, Calvin, Los Angeles, CA 90066, US;
KODURI, Raju, Kanaka, LaJolla, CA 92121, US;
LEE, Jar-How, Palos Verdes Estates, CA 90274, US;
WEICKMANN, Joachim, Ludwig, Los Angeles, CA 90066, US
Vertreter BOEHMERT & BOEHMERT, 28209 Bremen
DE-Aktenzeichen 68927167
Vertragsstaaten AT, BE, CH, DE, FR, GB, IT, LI, LU, NL, SE
Sprache des Dokument En
EP-Anmeldetag 06.11.1989
EP-Aktenzeichen 909027468
WO-Anmeldetag 06.11.1989
PCT-Aktenzeichen US8905018
WO-Veröffentlichungsnummer 9005775
WO-Veröffentlichungsdatum 31.05.1990
EP-Offenlegungsdatum 14.11.1990
EP date of grant 11.09.1996
Veröffentlichungstag im Patentblatt 03.04.1997
IPC-Hauptklasse C12N 1/19
IPC-Nebenklasse C12N 1/21   C12N 15/29   

Beschreibung[de]
Hintergrund

Die vorliegende Erfindung betrifft allgemein die Manipulation von genetischen Material, und genauer gesagt die Herstellung spezifischer DNA-Sequenzen, die in rekombinanten Verfahren nützlich sind, um die Herstellung von verbesserten Varianten eines Polypeptids zu sichern, das als natürliches Thaumatin-I identifiziert wurde.

Thaumatin ist ein extrem süß schmeckendes Protein, das in den Arillen der Frucht des afrikanischen Strauches Thaumatococcus daniellii Benth hergestellt wird. Die Frucht ist traditionell in West-Afrika als ein Süßstoff von Palmwein, Maisbrot und Sauerfrüchten verwendet worden. Thaumatin, das auf Gewichtsbasis etwa 5000mal süßer als Saccharose ist, wird in mindestens fünf Formen produziert: Thaumatine I, II, a, b und c. Diese Proteine, benannt in der Reihenfolge der Elution von einer Ionenaustauschsäule [Higginbotham, et al., in Sensory Properties of Foods (Birch et al., eds.), London: Applied Sciences, pp. 129-149 (1977)] weisen Molekulargewichte von etwa 22 Kilodalton auf. Die Thaumatine I und II sind fast identische Proteine, wobei jedes aus einer einzigen unmodifizierten Polypeptidkette besteht mit einer Länge von 207 Aminosäureresten.

Thaumatin ist ein nicht-toxisches, kalorienarmes und nicht-kariesauslösendes Protein, das starke süße Geschmacksreaktionen auslöst. Diese Eigenschaften weisen auf eine stabile Wechselwirkung zwischen den Proteinen und menschlichen Geschmacksrezeptoren hin. Deshalb weist Thaumatin ein Potential zur Verwendung als ein Zuckerersatz, Nahrungsmittelzusatz, eine Süßigkeitsrezeptorsonde und ein Werkzeug für weitergehende Auslösung der Geschmacksreaktion auf.

Eine reichliche Versorgung mit reinem Thaumatin ist erforderlich, um das Protein als einen möglichen Nahrungsmittelzusatzstoff und Forschungswerkzeug zu verwenden. Da die Thaumatinpflanze ein tropisches Klima und Insektenbestäubung für erfolgreiche Fruchtvermehrung benötigt, gibt es beachtliche Schwierigkeiten bei der Kultivierung der Pflanze im Gewächshaus.

Iyengar offenbarte eine Aminosäuresequenz für Thaumatin-I, die in Tabelle 1 unten gezeigt ist [Iyengar, et al., Eur. J. Biochem., 96, 193,204 (1979)].

Tabelle 1

Die Aminosäuresequenz für Thaumatin-II ist von seiner Nucleotidsequenz abgeleitet worden [Edens, et al., Gene, 18, 1-12 (1982)] und ein Gen für Thaumatin-II ist von Boten-RNA-abgeleiteter cDNA kloniert worden. Die fünf Aminosäuren in der Thaumatin-II-Sequenz, die von der Thaumatin-I-Sequenz oben verschieden sind, sind die folgenden: Lysin anstelle von Asparagin an Rest 46; Arginin anstelle von Serin an Rest 63, Arginin anstelle von Lysin an Rest 67, Glutamin anstelle von Arginin an Rest 76; und Asparaginsäure anstelle von Asparagin an Rest 113. Die Sequenzanalyse zeigte auch an, daß Thaumatin- II ursprünglich als eine Precursorform, Prä-Pro-Thaumatin, translatiert wird, mit sowohl einer aminoterminalen Verlängerung aus 22 Resten als auch einem sauren, sechs Aminosäuren langen carboxyterminalen Schwanz. Das aminoterminale Peptid wurde auf der Grundlage seines hydrophoben Charakters als ein Sekretionssignal postuliert, und für die carboxyterminale Verlängerung eine Kompartimentalisierungsrolle vermutet.

Die oben zitierte Literaturstelle Edens et al. vermerkt, daß ein Polypeptid mit der nativen Sequenz von Prä-Pro-Thaumatin- II mikrobiologisch produziert worden ist. Genauer gesagt offenbart die Literaturstelle und Verrips, et al., U.S. Patent No. 4,771,000 cDNA-Sequenzen, die für natives reifes Thaumatin-II und Prä-Pro-Thaumatin-II codieren und offenbaren auch Klonierungsvehikel, die die DNA-Sequenzen zur Verwendung bei der Transformation in Mikroorganismen umfassen.

In WO 85/01746 wurden Techniken für die Synthese von erzeugten Genen, die für die Aminosäuresequenz von Thaumatin-I, wie identifiziert von Iyengar, et al., codieren, ebenso offenbart wie DNA-Mikroorganismentransformationsvektoren, Fusionsgene, transformierte Mikroorganisnen und Verfahren zum Exprimieren der erzeugten Gene und zum Sichern des damit hergestellten Polypeptidproduktes. Spezifische hergestellte Gene der Anmeldung nahmen eine Reihe von für die Expression in Hefewirtszellen "bevorzugten" Codons auf.

In WO 87/02776 wurden Polypeptide und Gene für deren Synthese offenbart mit der Aminosäuresequenz von [Asp¹¹³] Thaumatin-I und [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin-I, d.h. solche, die die kontinuierliche Sequenz von Aminosäureresten von natürlichem Thaumatin-I enthalten, wie berichtet von Iyengar, et al., mit Ausnahme eines Aspartataminosäure-Restes anstelle von Asparagin in der 113-ten Position vom aminoterminalen Ende des Polypeptids und optional eines Lysin-Aminosäurerestes anstelle von Asparagin in der 46-ten Position. Diese Peptide konnten in eine süße Konformation unter Verwendung eines in vitro-Verfahrens gefaltet werden. Rekombinant hergestelltes Thaumatin-I mit der von Iyengar et al. publizierten Aminosäuresequenz war nicht süß und konnte nicht in eine süße Konformation gefaltet werden.

Während die rekombinanten hergestellten [Asp¹¹³] und [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin-I Polypeptide Verbesserungen gegenüber der Technik bilden, teilen sie mit aus Pflanzen gewonnen Thaumatin Geschmackseigenschaften, die ihre Verwendung in einigen Lebensmittelprodukten begrenzen. Am signifikantesten von diesen Eigenschaften ist ein bleibender Nachgeschmack, der anders ist als der von Zucker (Saccharose).

Für die vorliegende Erfindung ist die Offenbarung von van der Wel, et al., Chemical Senses and Flavor, 2, 211-218 (1976) von Interesse. Diese Literaturstelle offenbart Experimente, in denen Lysin-Reste in Thaumatin-I durch Acetylierung mit Essiganhydrid und durch reduktive Methylierung chemisch modifiziert wurden. Wenigstens vier acetylierte Thaumatine wurden erhalten mit entweder einer, zwei, drei oder vier acetylierten Aminogruppen. Zusätzlich wurde ein methyliertes Thaumatin hergestellt, das sechs Dimethyl-Lysinreste und einen Monomethyl- Lysinrest aufwies. Während das methylierte Thaumatin mit sieben modifizierten Lysin-Resten eine Süßigkeitsintensität auf wies, die praktisch mit derjenigen des ursprünglichen Thaumatins gleich ist, nahm die Süßigkeitsintensität der acetylierten Thaumatine mit der zunehmenden Anzahl von acetylierten Aminogruppen ab. Das Empfinden des süßen Geschmackes verschwand vollständig wenn vier acetylierte Lysin-Reste in das Molekül eingeführt wurden. Die Literaturstelle schlug die Möglichkeit vor, daß eine Korrelation zwischen der Nettoladung und der Süßigkeitsintensität des Moleküls existieren könne.

Für die Herstellung der Thaumatine der vorliegenden Erfindung sind bestimmte Polypeptidsekretionssignale von Interesse. Von Heijne, European J. Biochem., 133, 17-21 (1983) offenbart eine Anzahl von eukaryontischen Signalsequenzen und merkt an, daß Signalsequenzen typischerweise zwei verschiedene, unabhängige Signale enthalten. Das erste Signal soll in der Form einer hydrophoben Kemzone vorliegen, während das zweite Prozessierungsspezifität verleihen soll. Oliver, Ann. Rev. Microbiol., 39, 615-48 (1985) behandelt Proteinsekretion in Escherichia coli und offenbart eine Anzahl von bakteriellen Sekretionssignalen, die dadurch gekennzeichnet sind, daß sie drei konservierte Merkmale enthalten, die (a) einen positiv geladenen Aminoterminus (b) eine hydrophobe Kemzone (c) eine hochkonservierte zur Prozessierungsstelle benachbarte Sequenz einschließen.

Kendall, et al., Natur, 321, 706-708 (1986) offenbart die Verwendung von ortsgerichteter Mutagenese, um eine mutierte Signalsequenz herzustellen, die neun aufeinanderfolgende Leucin- Reste in dem hydrophoben Kernzonensegment enthält. Sjostrom, et al., The EMBO Journal, 6, 823-831 (1987) beschreibt die Analyse von E. coli-Sekretionssignalssequenzen und offenbart das Vorhandensein von Lysin-Resten im aminoterminalen Ende der Sequenz für eine große Anzahl von E. coli-Signalsequenzen. Sjostrom, et al. merken jedoch an, daß die Signalpeptide von Eukaryonten kaum Sequenzhomologien aufweisen.

Zusammenfassung der Erfindung

Die vorliegende Erfindung sieht gereinigte und isolierte DNA- Sequenzen vor, die in der Lage sind, in einen ausgewählten Wirtsmikroorganismus die Synthese von [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Aps¹¹³] Thaumatin-I und [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I zu steuern, die die kontinuierliche Sequenz von Aminosäureresten von natürlichem Thaumatin-I, wie berichtet von Iyengar. et al., enthalten, ausgenommen einen Lysin-Aminosäurerest anstelle von Asparagin an der 46-ten Position vom aminoterminalen Ende des Polypeptids, einen Asparaginsäure-Rest anstelle von Asparagin in der 113-ten Position und entweder Asparaginsäure anstelle von Lysin an der 97-ten Position oder Asparaginsäure anstelle von Lysin an der 137-ten Position. In bevorzugten Formen der Gene schließen die Basensequenzen ein oder mehrere Codons ein, die dieselbe Aminosäuresequenz auf der Basis von bevorzugten Expressionscharakteristiken des Codons in einem geplanten Wirtsorganismus, zum Beispiel E. coli, Saccharomyces cerevisiae, spezifizieren. Andere bevorzugte Formen von erzeugten Genen schließen diejenigen ein, worin: (1) ein Codon eine zusätzlich Aminosäure in dem synthetisierten Polypeptid spezifiziert (z.B. einen Methionin-Rest am Anfang), die die direkte Expression in E. coli-Mikroorganismen und/oder Hefe-Mikroorganismen erleichtert; oder (2) wenigstens ein Terminationscodon am Ende des erzeugten Genes, um die richtige Termination des Polypeptids zu gewährleisten.

Bei der Ausübung der Erfindung, um Polypeptidprodukte zu erzeugen, werden DNA-Sequenzen, einschließlich erzeugter Gene, in einen viralen oder zirkulären Plasmid-DNA-Vektor inseriert, um einen Hybridvektor zu bilden, und die Hybridvektoren werden verwendet, um Wirtsmikroorganismen wie Baktieren (z.B. E. coli) oder Hefezellen (z.B. S. cerevisiae) zu transformieren. Vektoren können auch mit geeigneten Promotor-/Regulator-DNA- Sequenzen versehen sein, die kontrollierte Expression in den Wirtsmikroorganismus erlauben. Die transformierten Mikroorganismen werden danach unter geeigneten Nährstoffbedingungen angezogen und exprimieren die Polypeptidprodukte der Erfindung.

Die Erfindung sieht auch neue DNA-Sequenzen vor, die verbesserte Hefesekretionssignalsequenzen codieren, die die lag-Zeit verringern, die Transformanten für rekombinant hergestellte Polypeptide wie Thaumatin benötigen, um zu erscheinen. Zusätzlich sieht die Erfindung weiterhin bevorzugte mutagenisierte Wirtszellen zur Expression und Sekretion der Thaumatin-Proteine der Erfindung vor.

Die neuen [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] und [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I-Polypeptide liefern neue Geschmackscharakteristiken, besonders mit Blick auf die reduzierte Langlebigkeit von süßem Nachgeschmack. Diese Erfindung lehrt die Bedeutung der 97-ten und 137-ten Aminosäurereste für die biologischen Eigenschaften wie Geschmackscharakteristiken des Thaumatin-I-Moleküls. Andere Aspekte und Vorteile der vorliegenden Erfindung werden nach Studium der folgenden detaillierten Beschreibung derselben ersichtlich werden.

Kurze Beschreibung der Zeichnungen

Fig. 1 ist eine Darstellung der relativen Geschmacksqualitäten von [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] und [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I- Polypeptide und von aus Pflanzen gewonnenem Thaumatin.

Fig. 2 ist eine Darstellung der relativen Geschmacksqualitäten von [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] und [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I- Polypeptiden und von aus Pflanzen gewonnenem Thaumatin.

Detaillierte Beschreibung der Erfindung Beispiel 1

In diesem Beispiel wurden die Plasmide pING152T, das [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I codiert, und pING323T, das [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I codiert, aus Plasmiden pKS6 und M13mp10-Thaumatin, deren Konstruktionen in WO87/02776 beschrieben sind, und pING58T, dessen Konstruktion in der publizierten internationalen Anmeldung Nr. US/PCTB6/02443 beschrieben ist, konstruiert.

Plasmid pKSG, das den 218 bp PGK-Promotor enthält und für ein [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin-I-Polypeptid codiert, wurde mit BamHI und XhoI geschnitten und das 850 Basenpaar PGK-Promotor-Thaumatin-Fragment wurde an BamHI und XhoI geschnittenem M13MP10- Thaumatin ligiert, um Plasmid M13-K56 zu bilden. Die einzelsträngige Phagen-DNA wurde aus M13-K56 präpariert und als Matrize für die ortsgerichtete Mutagenese verwendet.

Zwei Oligonudeotide, 5'-GAGCCTTAAGGTCAGCTGGACAT-3', um Lys¹³&sup7; in Asp zu ändern, und 5'-GATGTAGTCGTCACCGTATTG-3', um Lys in Asp zu ändern, wurden an M13-KS6 getrennt aneliert und ortsgerichtete Mutagenese vorgenommen, wie beschrieben in Miyada et al., Gene, (1982), 17:167-177. Dieselben für Mutagenese verwendeten Oligonudeotide wurden als Sonden verwendet, um positive Plaques zu screenen. Positive Plaques wurden durch Kettenterminationsreaktion sequenziert (Sanger, et al., Proc. Natl. Acad. Sci. USA, (1977), 74:5463-5467) und die erwünschten Änderungen wurden bestätigt. Ein positiver Plaque von jeder Mutagenese wurde einzeln aufgenommen. Doppelsträngige DNA in Replikationsform wurde präpariert, mit BamHI und XhoI geschnitten, an BamHI- und XhoI-geschnittenem pING58T ligiert, um pING152T [Lys¹³&sup7; zu Asp¹³&sup7;] und pING323T [Lys&sup9;&sup7; zu Asp&sup9;&sup7;] zu bilden. Diese zwei Konstrukte erzeugten nach Transformation in Hefestamm BB29-1c intrazelluläres [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I bzw. [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I. Die Thaumatin-Polypeptide wurden aus Hefezellenextrakten gereinigt wie beschrieben in US-Patent 4,766,205, und jede wieder in eine süße Form gefaltet.

Beispiel 2

In diesem Beispiel wurden die Plasmide pING152CVS und pING323CVS konstruiert und getrennt in Hefestämme transformiert. Ein Hefesekretionsvektor, Plasmid pING804CVS, der den 220 bp PGK-Promotor, die SUC2-Hefe-Invertase-Signalsequenz, die Struktursequenz für [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin-I, von dem eine 138 Basenpaare umfassende Deletion gemacht worden ist, und den PGK-Terminator auf einem Hefevektor CV20 mit einer mittleren Kopienzahl (YEp20, ATCC 37059, Broach, Methods and Enzymology, 101:307-325) enthält, wurde als der Basisvektor zum Konstruieren der Sekretionsvektoren YT152 und YT323 verwendet. Der Grund für die Auswahl von pIN804CVS als ein Basisvektor ist der, daß er ein kleineres BglII - XhoI-Fragment erzeugt und leicht von dem BglII-XhoI-Fragment der YT152- und YT323-Gene in seiner vollen Länge unterschieden werden kann. Die Plasmide pING152T und pING323T wurden mit BglII und XhoI geschnitten und die partiellen 485 bp großen Thaumatin-Gene an BglII- und XhoI-geschnittenem pING804CVS ligiert, um pING152VCS bzw. pING323CVS zu erzeugen.

Die Plasmide pING152CVS und pING323CVS wurden in Hefestamm AH7 (MATα leu2-3) (erhalten vom Labor von Gerald Fink, Whitehead Institute for Cancer Research) getrennt transformiert. Leu&spplus;- Transformanten wurden in SD-leu für vier Tage angezogen und Proben für den Radioimmunoassay gezogen. Der Sekretionsumfang von YT152 oder YT323 wurde zu etwa 0,4 µg/ml bestimmt.

Beispiel 3

Als ein alternatives Mittel zum Herstellen von Vektoren, die Thaumatin-Polypeptide der vorliegenden Erfindung codieren, ist es durchaus im Rahmen der in der Technik üblichen Fähigkeiten, unter Verwendung kommerziell erhältlicher Vorrichtungen ganze Nucleotidsequenzen zu synthetisieren, die die Aminosäuresequenzen der Thaumatin-Polypeptide der Erfindung zusammen mit geeigneten Promotor-, Sekretionssignal- und Terminatorsequenzen codieren. Kassetten, die solche Sequenzen umfassen, können an ihren 5'- und 3'-Enden mit Nudeotiden versehen sein, die Restriktionsstellen duplizieren, so daß sie leicht in geeignete Plasmide inseriert werden können.

Zum Beispiel werden unten in den Tabellen 2 und 3 Nucleotidsequenzen von DNA-Kassetten zur Verfügung gestellt, die die pING152CVS-Sequenz, die PGK-Promotor-SUC2-Signalsequenz - [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin I-PGK-Terminator umfaßt (Tabelle 2), und die pING323CVS-Sequenz, die PGK-Promotor - SUC2 - Signalsequenz - [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin I-PGK-Terminator (Tabelle 3) umfaßt, codieren. Diese Sequenzen schließen auch "klebrige Enden" für eine BamHI-Stelle am 5'-Ende und eine SalI-Stelle am 3'-Ende ein und produzieren, wenn inseriert in das öffentlich erhältliche Plasmid CV20 (YEp20, ATCC 37059), geöffnet mit den BamHI- und SalI-Restriktionsenzymen, alternativ pING152CVS und pING323CVS.

Tabelle 2 pING152CVS-Sequenz
Tabelle 3 pING323CVS-Sequenz

Beispiel 4 Reinigung aus Wachstumsmedien

In diesem Beispiel werden Verfahren beschrieben zur Reinigung von Thaumatin, das durch transformierte Zellen hergestellt und ins Wachstumsmedium sekretiert wurde. Nach den Verfahren zur Reinigung von Thaumatin aus Kulturen, die in Schüttelkolben (0,2 bis 20 l) oder in Fermentern im kleinen Maßstab (10 bis 75 l) angezogen wurden, wird Kulturmedium durch kontinuierliche Durchlaufzentrifugation (Westfalia SA-1) geklärt, um die Hefezellen zu pelletieren.

Das zellfreie Wachstumsmedium wird dann 10- bis 20-fach konzentriert unter Verwendung eines Amicon DC-10L-Konzentrators, der mit einer Spiralkartusche mit einer molekularen Ausschlußgröße von 10.000 Dalton ausgestattet ist, und mit 15 Volumina Wasser gewaschen. Das Konzentrat wird dann zum Klären bei 17.000 xg für 20 Minuten zentrifugiert (wobei Hohlfaserkartuschen für große Volumina verwendet werden). Der Überstand wird dann durch eine Membran mit einer Porengröße von 0,45 µm filtriert, um Partikel und restlichen Zelldebris zu entfernen. Natriumphosphatpuffer wird dann zu einer Konzentration von bis zu 10 mM zugegeben, um den pH auf zwischen 7 und 8 einzustellen.

Das geklärte Wachstumsmediumkonzentrat wird dann auf eine Zeta Chrom-60 SP-Scheibe (Western Analytical, Sulphopropylkationenaustauscher) geladen. Die Scheibe wird mit Puffer, 10 mM Natrium- oder Kaliumphosphatpuffer pH 7-8, gewaschen und der Durchfluß nach Testen auf die Anwesenheit von Thaumatin mittels Radioimmunoassay verworfen. Das auf dem SP-Harz konzentrierte Thaumatin wird dann von der Scheibe eluiert mit 200 ml einer 250 mM NaCl-Lösung in dem oben verwendeten Puffer. Die verdünnte Thaumatin-Lösung wird dann durch Druckultrafiltration auf einer Amicon-Rührzelle konzentriert, die mit einer YM-5-Membran ausgestattet ist und zweimal mit Wasser gewaschen, um ein im wesentlichen gereinigtes Produkt (d.h größer als 95%) zu erhalten.

Wenn Thaumatin aus Wachstumsmedien aus einer Fermentation im Großmaßstab (d.h. 400 bis 600 Liter) gereinigt wird, wird ein modifiziertes Reinigungsverfahren angewandt. Das Fermentationsmedium wird zuerst einem Inaktivierungsverfahren unterworfen, das Behandlung mit Phosphorsäure, um pH 4,0 zu erreichen, Zugabe von 0,4% Natriumbenzoat (w/v) und Inkubation bei 30ºC für 30 Minuten ohne Begasung umfaßt. Die Zellen wurden durch Zentrifugation pelletiert und dann mit 5% Bleiche abgetötet.

Das zellfreie Wachstumsmedium wird dann 10- bis 20-fach konzentriert unter Verwendung eines Amicon DC-30P-Konzentrators, der mit sechs Spiralkartuschen mit einer molekularen Ausschlußgröße von 10.000 ausgestattet ist, und mit fünf Volumina Wasser gewaschen. Das Medium wird dann in einer Amicon-Hohlfilterkartusche mit einem cut off von 0,1 um geklärt und mit 15 Litern 250 mM NaCl in 10 mM Natriumphosphat, pH 7-8, gewaschen Zu diesem Zeitpunkt wird das Medium unter Verwendung eines Amicon DC-10L-Konzentrators konzentriert, bei 17.000 xg zentrifugiert, durch eine Millipore-Membran mit 0,45 µm filtriert und auf pH 7 bis 8 in derselben Weise gepuffert, wie für die Fermentationen im kleineren Maßstab beschrieben.

Das geklärte Wachstumsmediumkonzentrat wird dann auf eine Zeta Chrom (Western Analytical) 100 cc SP-Kapsel bei einer maximalen Flußrate von 20 ml pro Minute geladen und mit 10 mM Natrium- oder Kaliumphosphatpuffer pH 7-8 gewaschen. Das konzentrierte Protein wird dann eluiert unter Verwendung eines Liters 250 mM NaCl in dem Puffer. Das Eluat wird auf Proteinelution mit dem Biorad-Proteinassay überwacht. Die Protein-positiven Fraktionen werden dann vereinigt und entsalzt/konzentriert durch Ultrafiltration unter Verwendung einer Amicon- Rührzelle, die mit einer YM-5-Membran ausgestattet ist, um ein in wesentlichen reines Produkt zu ergeben.

Beispiel 5

In diesem Beispiel wurden verschiedene verbesserte Sekretionssignalsequenzen konstruiert. Plasmid pKS48 wurde konstruiert, um Sequenzänderungen (in erster Linie, um positiv geladene Aminosäuren zu codieren) in das 5'-Ende der SUC2-Wildtyp-Hefe- Invertase-Signalsequenz einzuführen. Plasmid PSH4, das den 218 bp PGK-Promotor mit SphI - SstI - XhoI - Linkern am 3'-Ende enthält, wurde mit XhoI verdaut, mit T4-DNA-Polymerase aufgefüllt und dann mit BamHI verdaut. Das glattendige BamHI 218 bp PGK-Promotorfragment wurde an mit HindIII-verdautes, mittels T4-Polymerase glatt gemachtes, BamHI-geschnittenes pKK108 ligiert, um pKS48 zu erzeugen. Plasmid pKS48 enthält den 218 bp PGK-Promotor, eine partielle Invertase-Signalsequenz und das partielle Thaumatin-Gen.

Das Verdauen von pKS48 mit SphI und HindIII erlaubt die Insertion von synthetischen Oligonudeotiden, um das 5'-Ende der Invertase-Signalsequenz zu ändern. Fünf Oligonudeotide wurden synthetisiert. Die Aminosäuresequenzänderungen, für die sie codieren, sind in Tabelle 4 unten gezeigt.

Tabelle 4

Jedes synthetische Oligonucleotid wurde an Plasmid pKS48 ligiert, das mit SphI und HindIII geschnitten worden war. Nach Transformation in E. coli-Stamm MC1061 wurden die einzelsträngigen Lücken in vivo repariert (Huang, et al., Biochemistry, (1987), 26:8242-8246), um die Plasmide pKS48-1 [Leu(1) T Arg], pKS48-2 [Leu(2) T Arg], pKS48-3 [Gln(3) T Lys], pKS55 [Leu(2) T LysLysLys) und pKS56 [Leu(2) T LysArgLysArg] zu bilden. Die BamHI-EcoRI-Fragmente, die die 218 bp PGK-Promotor - mutierte Signalsequenz - partielle Thaumatin-Gen - Sequenz enthalten, wurden von allen fünf Plasmiden einzeln gereinigt. Ebenso wurde ein EcoRI-XhoI-Fragment, das die 3'-Hälfte eines als YT406 bezeichneten Gens, das [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin-I codiert, enthält, aus pING95CVS oder pING438CVS gereinigt (obwohl das YT406-Gen aus anderen Plasmiden wie pKS6 hätte erhalten werden können). Die BamHI-EcoRI-Fragmente aus pKS48-1, pKS48-2 und pKS48-3 wurden an das EcoRI-XhoI-Fragment von pING95CVS und BamHI-XhoI-verdautes pING58 (ein Plasmid, das eine PGK-Terminator-Sequenz enthält, dessen Konstruktion in WO87/02776 beschrieben ist) ligiert, um pING447, pING448 bzw. pING449 zu bilden. Die BamHI-EcoRI-Fragmente aus pKS55 und pKS56 wurden an das EcoRI-XhoI-Fragment von pING438CVS und BAmHI-XhoI-verdautes pING58 ligiert, um die Plasmide pING454 bzw. pING456 zu bilden.

Um die Hydrophobizität im zentralen Teil der SUC2-Signalsequenz zu erhöhen, wurde ein synthetisches Oligonucleotid (5'GCTTTCTTGATCTTGTTGATTTTGTTCCCAGGTAAGATCTCTGCCTGCA 3') verwendet, um das kleine HINDIII-PstI-Fragment von pKS46 mittels der in vivo-Lückenauffüllungstechnik zu ersetzen, um pKS49 zu erzeugen. Das Thaumatin-Gen von pING174 wurde an die neue Signalsequenz von pKS49 als eine In-Phasen-Fusion durch eine zweistufige Klonierung angehängt, um pKS54 zu bilden. Das 218 bp PGK-Promotor - Signalsequenz - Thaumatin-Gen wurde in pING58 als ein BamHI-XhoI-Fragment kloniert, um pING451 zu erzeugen. In Plasmid pING451 wurden in der SUC2-Sekretionssignal-Sequenz die folgenden Substitutionen vorgenommen: [Phe&sup7; T Ile, Ala¹&sup0; T Ile, Gly¹¹ T Leu, Ala¹³ T Pro und Ala¹&sup4; T Gly].

Kombinieren der Veränderungen in pKS55 und pKS56 mit jenen in pKS54 wurde wie folgt vorgenommen. Die kleinen BamHI-HindIII- Fragmente aus pKS55 und pKS56 wurden mit dem kleinen HindIII- KpnI-Fragment von pKS54 in mit BamHI-KpnI-geschnittentes pKS56 ligiert, um pKS57 bzw. pKS58 zu bilden. Die BamHI-XhoI-Fragmente (etwa 920 bp, enthaltend die Promotor - Signal - Thaumatin-Fusionen) aus pKS57 und pKS58 wurden dann in BamHI- und XhoI-geschnittenes pING58 kloniert, um pING460 bzw. pING462 zu bilden. Diese Plasmide codierten Sekretionssignalsequenzen mit sowohl positiv geladenen Aminosäureresten am Aminoende der Sequenz als auch erhöhte Hydrophobizität im Zentrum des Moleküls.

Der Hefestamm BB33-1c [MATa, leu 2-3, 2-112, ura3-52] wurde mit den Plasmiden pING156, pING447, pING448, pING449, pING451, pING454, pING456, pING460 und pING462 transformiert. Die Leu&spplus;- Transformanten wurden auf SD-leu-Platten selektiert und einzelne Kolonien in SD-leu-Brühe aufgenommen und für vier Tage angezogen. Dann wurden Proben für den Radioimmunoassay gezogen. Die maximale Ausbeute an [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin I-Produktion, verglichen mit der Transformations-lag-Zeit, wurde in Tabelle 5 unten aufgezeichnet.

Tabelle 5 Wirkung modifizierter Signalsequenzen auf die Thaumatin-Sekretion

Beispiel 6

In diesem Beispiel wurde PS16, ein bevorzugter Hefestamm, der große Mengen an Thaumatin sekretiert, isoliert. Stamm BB33-1c (MAT leu2-3,2-112 ura3-52) wurde mit pING156 transformiert (ein Expressionsplasmid mit hoher Kopienzahl, das [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin-I codiert und eine Wildtyp-Sekretionssignalsequenz umfaßt) durch Selektion auf Leu&spplus;-Transformanten. Eine kleine Fraktion der Transformanten sekretierte 0,3 - 0,6 µm/ml Thaumatin. Es wurde später gefunden, daß eine dieser höher sekretierenden Transformanten nicht länger haploid war und sie wurde als PS11 bezeichnet. pING156 enthaltender PS11 wurde mit N-methyl-N'-nitro-nitrosoguanidin mutagenisiert und die Kolonien wurden auf erhöhte Sekretion gescreent.

Das Screening beinhaltete das Anziehen von Kolonien auf SD- leu-Platten, Abheben der Kolonien von den Master-Platten auf Nitrocellulosefilter und Plazieren der Filter mit der Kolonieseite nach oben auffrische SD-leu-Platten. Nach 6- bis 24- stündigem Wachstum wurden die Kolonien von den Filtern gewaschen und die Filter auf Thaumatin durch Protein-Immunoblotting (Western-Verfahren) kontrolliert. Höher sekretierende Kolonien wurden von der Master-Platte einzeln aufgenommen und erneut durch Western- und RIA-Verfahren kontrolliert. Dieser Ansatz wurde durch serielles Isolieren höher sekretierender Kolonien wiederholt, um die Genealogie PS11 [pING156] T PS6[pING156]TPS10[pING156]TPS14[pING156] zu ergeben. PS14 wurde vom Plasmid geheilt durch Wachstum auf nicht-selektivem Medium (YPD) und erneut mit pING460 transformiert. Mutagenese von PS14[pING460] ergab PS16[pING460]. Hefestamm PS16 ist hinterlegt durch Vertrag mit der American Type Culture Collection 12301 Parklawn Drive, Rockville, Maryland 20852-1776 als A.T.C.C. Hinterlegungsnummer 20909. Die Thaumatin-Sekretion einer jeden Mutante in der Serie ist in Tabelle 6 unten gezeigt.

Tabelle 6 [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin-I-Sekretion durch Mutanten, die Vektoren mit verschiedenen Signalsequenzen enthalten (µm/ml) gestestet mittels RIA

Konstruktion von pING816A

Genomische DNA von Kluyveromyces lactis-Stamm KG51-5A (ATCC #48792) wurde teilweise verdaut mit dem Restriktionsenzym Sau3A. Fragmente mit einer Größe von 10-12 Kb wurden auf einem Saccharosegradienten fraktioniert und gesammelt. Diese DNA wurde in pING1001RKnB ligiert, das mit BamHI (BamHI-Enden sind mit Sau3A-Enden kompatibel) geschnitten worden war, um eine genomische Plasmidgenbank von Hefe zu bilden. pING1001RKnB ist ein S. cerevisiae-E. coli-Shuttle-Vektor, der das an den S. cerevisiae - 3-Phosphoglycerat-Kinase (PGK)-Promotor gekoppelte Tn903-Aminoglycosid-Phosphotransferase-Gen enthält. Dies erlaubt Transformation der Genbank in S. cerevisiae durch Selektion auf Resistenz gegen das Aminoglycosid G418. Plasmid pING1001RKnB ist nicht kritisch für dieses Verfahren und kann durch andere Plasmide ersetzt werden, die einen oder mehrere Marker aufweisen, die die Wirtsdefizienz komplementieren.

Als die Genbank in den Hefestamm BB33-1c (MATa leu2-3, 2-112, ura3-52) transformiert wurde, wurde eine Ura&spplus;-Transformante isoliert. Plasmid-DNA wurde aus dieser Transformante isoliert, in E. coli transformiert und in einer Plasmidpräparation geerntet. Obwohl die BamHI-Stelle von pING1001RKnB oft zerstört wird, wenn sie mit Sau3A-Enden ligiert wird (wie im vorliegenden Fall), wird sie von zwei EcoRI-Stellen (die einzigen Eco- RI-Stellen in pING1001RKnB) flankiert, was erlaubt, daß die DNA, die BB33-1c Ura&spplus; verleiht, als ein 2,8 kb EcoRI-Fragment entfernt wird.

Dieses 2,8 kb EcoRI-Fragment wurde durch T4-DNA-Polymerase glattendig gemacht und an das AatII-geschnittene, mit T4-DNA- Polymerase glattendig gemachte pING460 ([Lys&sup4;&sup6;,Asp¹¹³] Thaumatin-I), wie oben beschrieben, ligiert. Plasmide mit beiden Orientierungen des K. lactis-URA3-Fragmentes wurden isoliert, wie bestimmt durch die Plazierung einer XhoI-Stelle an einem Ende des Fragmentes bezüglich der PstI-Stelle des Amp -Gens in den bakteriellen Sequenzen von pING460. pING816A weist die XhoI-Stelle etwa 1 kb von der PstI-Stelle auf, wohingegen pING816B die XhoI-Stelle etwa 3 kb von der PstI-Stelle aufweist.

Plasmid pING816A-Transformanten von Hefestamm PS16 (ein mutagenisiertes Derivat von BB33-1c), selektiert auf Ura&spplus;, erschienen innerhalb von 3-4 Tagen. Sie sekretierten etwa 10 µg/ml Thaumatin unter Ura&spplus;-Selektion in Flüssigmedium. Dieser Thaumtin-Sekretionsumfang war reproduzierbar und schien ziemlich stabil zu sein. Selektion auf einen Leu&spplus;- oder einen Leu&spplus;Ura&spplus;- Phänotyp mit pING816A ergab einen geringeren Thaumatin-Sekretionsumfang (2-3 µg/ml). Etwa 37% der Zellen waren nach etwa 20 Generationen in nicht-selektivem YPD-Medium noch Ura&spplus;.

BEISPIEL 7

In diesem Beispiel wurden Thaumatin-Proteine, die von Zellen hergestellt wurden, die mit Plasmiden pING152T und pING323T {Hefe-Thaumatin 152 (YT152) [Lys&sup4;&sup6;, Asp¹¹³,Asp¹³&sup7;] Thaumatin-I bzw. Hefe-Thaumatin 323 (YT 323) [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I} transformiert waren, durch eine Geschmackstafel getestet und mit aus Pflanzen gewonnenem Thaumatin verglichen. Pflanzen-Thaumatin ist intensiv süß, weist aber einen verzögerten Beginn, gefolgt von einem raschen Anstieg der Süßigkeitsintensität, eine langanhaltende Süßigkeit und einen langen Nachgeschmack, der als "Lakritze-ähnlich" beschrieben worden ist, auf. Hiiginbotham, et al., Flavor Potentiating Properties of Talin Sweetener (Thaumatin). The Quality of Foods and Beverages, Academic Press, New York, 91-111 (1981).

Fünfzehn potentielle Kandidaten wurden auf ihre Fähigkeit hin gescreent, die Grundqualitäten des Geschmacks süß, sauer, salzig und bitter (2% Saccharose, 0,07% Zitronensäure, 0,2% Natriumchlorid, 0,07% Coffein) zu unterscheiden. Dreizehn Kandidaten (zehn Frauen und drei Männer) schlossen das Screeningprogramm erfolgreich ab.

Nach dem Screening nahmen die Kandidaten an fünf dreißigminütigen Trainingssitzungen in beschreibender Analyse teil. Das Training schloss sowohl Diskussion am runden Tisch als auch Testen von Proben, die so ausgewählt waren, daß sie sensorische Attribute und Intensitäten einschlossen, die typisch für die zu evaluierenden Süßstoffe waren, in den abgetrennten Sensorikzellen ein.

Das Training war abgeschlossen nachdem die Kandidaten eine beschreibende Sensoriksprache mit Definitionen, einen Bewertungsbogen, um die Intensität einer jeden Eigenschaft zu messen, ein Standardverfahren zum Untersuchen und Bewerten der Produkte entwickelt hatten und eine Fähigkeit zeigten, die Produkte unter Verwendung eines Bewertungsbogen, der sich auf 18 Geschmacks- und Nachgeschmackseigenschaften bezieht, zu evaluieren (siehe Tabelle 7 unten).

Tabelle 7 Geschmacks- und Nachgeschmackseigenschaften von Thaumatin-Proteinen

Testproben wurden in einem Liter isosüßen (10% Saccharoseäquivalent) Stammansätzen hergestellt und bei 38ºF für von einem bis drei Tagen zum Testen aufbewahrt.

Tabelle 8

Das ganze Testen wurde in Sensorikzellen durchgeführt, die so konstruiert sind, daß sie eine kontrollierte Testumgebung liefern. Proben (10 ml) wurden in geruchlosen Plastikbechern von 1 Unze gereicht. Jeder Kandidat evaluierte eine Probe zu einer Zeit und man ließ ihm ein 3-minütiges Pausenintervall zwischen den Proben. Die Kandidaten wurden gebeten, die Proben auszuspucken und mit gereinigtem Wasser und ungesalzenen Keksen zwischen den Proben auszuspülen. Das ganze Testen erfolgte zwischen 10:00 Uhr und 11.30 Uhr morgens. Die jedem Kandidaten gereichten Proben waren nur mit dreistelligen zufälligen Zahlen kodiert. Die Zahlen waren für jeden Kandidaten und jede Probe bei jedem Test verschieden.

Proben wurden in einer ausgewogenen Blockanordnung gereicht, ausgewogen hinsichtlich Darreichungsreihenfolge, Kandidat und Tag über die gesamte Studie. Jede Probe wurde von jedem der 13 Kandidaten evaluiert, einmal am Tag für drei Tage, was etwa 39 Beobachtungen pro Produkt hinsichtlich jedes der 18 Attribute ergab. Die Daten wurden mittels einer Einwegvarianzanalyse analysiert, um die individuelle Leistung hinsichtlich jedes Attributs zu evaluieren, einer Zweiwegvarianzanalyse, um die gesamte Tafelleistung hinsichtlich jedes Attributes zu evaluieren und einem multiplen Wertebereichstest nach Duncan, um statistisch signifikante Unterschiede zwischen den Probenwerte zu identifizieren.

Das Testen wurde auch hinsichtlich der Süßigkeitsintensität der Thaumatin-Proteine über die Zeit durchgeführt. Potentielle Kandidaten wurden rekrutiert und auf ihre Fähigkeit hin gescreent, Süßigkeit in fünf Supraschwellenkonzentrationen von Saccharose und Thaumatin aus Pflanzen nachzuweisen. Diejenigen, die dieses anfängliche Screening passierten, wurden dann auf ihre Fähigkeit hin getestet, verschiedene Konzentrationen von saccharoselösungen in der Reihenfolge von am niedrigsten bis am höchsten (5, 7,5, 10, 12,5 und 15% in Wasser) anzuordnen, entsprechend dem Verfahren von Swartz, et al., Food Technology, Vol 31, 51-67 (1977). Die 13 bis 15 akkuratesten und vertrauenswürdigsten Juroren wurden ausgewählt, um an den Zeit-Intensität-Studien teilzunehmen.

Drei Übungssitzungen wurden durchgeführt, um den Kandidaten grundlegende Instruktionen über die Techniken des Kostens und die Betriebsweise des Streifenkartenrekorders zu vermitteln, wie beschrieben von Larson-Powers und Pangborn, J. Food Science, 43(1), 41-46 (1987). Die Kandidaten waren dann bereit, die Zeit-Intensität-Studien zu sein.

Die Süßstoffkonzentrationen waren in etwa äquisüß mit 10% (w/v) Saccharoselösung. Diese Konzentrationen wurden abgeleitet durch die Vervollständigung von Isosüßigkeit-Studien, die durchgeführt wurden, um verlässliche Zeit-Intensität-Daten zu sichern. Den Kandidaten wurden zufällig (3-stellig) nummerierte 10 ml Proben von jedem Süßstoff in einer sequentiellen nonadischen ausgewogenen Reihenfolge gegeben. Die Kandidaten wurden angewiesen, die gesamte Probe in ihren Mund zu nehmen, den Rekorder mit dem sich bewegenden Streifen mit einem Fußpedal zu starten und "entlang der Linie, die am besten die relative Süßigkeitsintensität der Probe wiederspiegelt, zu markieren". Eine Linie wurde auf dem Papier an dem Punkt markiert, an dem die Kandidaten angewiesen wurden, die Probe auszuspukken (10 Sekunden) und die Süßigkeitsintensität weiterhin zu bewerten, bis die ganze Süßigkeit weg war. Die Kandidaten reinigten ihren Mund durch Verwendung von Wasser, ungesalzenen Keksen und einigen Minuten Zeit zwischen den Probenevaluierungen. Dieses Verfahren wurde für jeden zu testenden Süßstoff wiederholt. Jede Studie wurde dreimal wiederholt, um dabei zu helfen, Konsistenz zu gewährleisten, die statistische Genauigkeit zu erhöhen und eine hinreichend große Datenbasis hoher Qualität zu liefern, auf deren Grundlage man zu vertrauenswürdigen Schlußfolgerungen gelangt.

Die folgenden vier sensorischen Eigenschaften wurden von jeder einzelnen Aufzeichnung gemessen:

1. Intensität bei Ausspucken: Der nummerische Intensitätswert auf einer Skala mit 100 Einheiten bei 10 Sekunden.

2. Maximale Intensität: Der höchste auf einer Skala mit 100 Einheiten vergebene Süßigkeitsintensitätswert.

3. Zeit bis zum Maximum: Die Anzahl der verstrichenen Sekunden von Zeit 0 bis zu der Zeit da die maximale Süßigkeit erreicht wird.

4. Gesamtdauer: Die Anzahl der Sekunden von Zeit 0 bis alle Süßigkeit weg ist und die Aufzeichnung gestoppt ist.

Diese Daten wurden mit einer Einwegvarianzanalyse analysiert, um die einzelne Leistung des Panelisten zu evaluieren, mit einer Zweiwegvarianzanalyse, um die Gesamttafelleistung bezüglich jeder Messung zu evaluieren und mit einem multiplen Wertebereichstest nach Duncan, um statistisch signifikante Unterschiede zwischen den Süßstoffen zu identifizieren. Alle statistischen Analysen wurden bei einem Vertrauensbereich von 95% durchgeführt.

Mittelwerte wurden auch für jedes 2,5-Sekundenintervall entlang den von jedem Juror für jeden Süßstoff erzeugten Streifen berechnet.

Das Testen lieferte die Ergebnisse, daß YT152 und YT323 nicht signifikant verschieden waren von von Pflanzen produziertem Thaumatin hinsichtlich des salzigen, sauren, menthol-kühlen, medizinischen, medizinischen Nachgeschmackes und Menthol-Nachgeschmackes. Es bestanden jedoch wesentliche Unterschiede hinsichtlich 11 der 18 gemessenen Attribute. Sowohl YT152 bei 90 µg/ml als auch YT323 bei 145 µg/ml waren gleich süß wie Pflanzen-Thaumatin bei 49 µg/ml. YT323 war Thaumatin am ähnlichsten, hinterließ aber einen weniger sauren und weniger bitteren Nach-Geschmack. YT152 war von Thaumatin ganz verschieden. YT152 hatte weniger Lakritze-Geschmack und Nachgeschmack, einen weniger sauren und weniger süßen Nachgeschmack, war weniger mundwässernd, wies weniger Mundbedeckung auf und hatte weniger anhaltende Gesamtsüßigkeit (Figuren 1 und 2, Tabellen 7-9).

In getrennten Studien waren YT152 bei 104 µg/ml und YT323 bei 70 µg/ml gleich süß wie 49 µg/ml Pflanzen-Thaumatin, benötigten weniger Zeit, um die maximale Süßigkeitsintensität zu erreichen und wiesen weniger anhaltende Süßigkeit als Pflanzen- Thaumatin auf (Tabelle 12).

Diese Daten zeigen deutlich an, daß der latente Süßigkeitsbeginn und der anhaltende Nachgeschmack von Pflanzen-Thaumatin sowohl für YT152 als auch für YT323 signifikant reduziert worden ist. YT152 weist auch einen wesentlich verringerten "Lakritze-ähnlichen" Geschmack und Nachgeschmack auf, was seine möglichen Anwendungen erweitern kann.

Tablle 9

a Mittel sind nicht wesentlich verschieden bei dem Wahrscheinlichkeitsniveau von 0,5.

b Mittel sind nich wesentlich verschieden bei dem Wahrscheinlichkeitsniveau von 0,5.

Tabelle 10

a Mittel sind nicht wesentlich verschieden bei dem Wahrscheinlichkeitsniveau von 0,5.

b Mittel sind nich wesentlich verschieden bei dem Wahrscheinlichkeitsnivau von 0,5.

Tabelle 11 Zusammenfassung der wesentlichen Unterschiede¹

¹ Alle aufgelisteten Attribute waren signifikant unterschiedlich bei p < 0,05.

Tabelle 12 Süßstoffcharakteristiken - Zeit-Intensität

a Mittelwerte sind nicht wesentlich verschieden bei dem Wahrscheinlichkeitsniveau von 0,5

b Mittel stellen interpretierte Trends auf der Basis von Rängen und Daten einzelner Ansprechender dar.

BEISPIEL 8

In diesem Beispiel wurde KHK1, ein von PS16 abgeleiteter bevorzugter Hefestamm, isoliert. Eine PS16 [pING816A]-Transformante wurde auf SD-ura-Agar zur Einzelkolonieisolierung ausgestrichen. 16 Kolonien wurden auf Thaumatin-Sekretion durch Wachstum für 4 Tage in 3 ml flüssigem SD&supmin;ura getestet. Eine von diesen, als BB2 bezeichnet, die 12,9 µg/ml Thaumatin sekretierte, wurde subkloniert durch erneutes Ausstreichen auf SD&supmin; ura-Agar. Vier Kolonien wurden einzeln zum Wachstum in SD&supmin;- Flüssigkeit aufgenommen. Eine von diesen, KHK1 (ursprünglich BB2a) sekretierte 14-17 µg/ml. Hefestamm KHK1 ist hinterlegt durch Vertrag mit der American Type Culture Collection, 12301 Parklawn Drive, Rockville Maryland 20852-1776 als A.T.C.C. mit der Hinterlegungsnr. NO. 20954.

Wegen der XhoI-Stelle in dem EcoRI-Fragment, das das uraA-Gen enthält, war der pING816A-Plasmidhintergrund wenig geeignet für Routineklonierungen von BamHI-XhoI-Fragmenten vor den PGK- Terminator. Deshalb wurde ein ähnlicher Plasmidhintergrund konstruiert, bei dem diese XhoI-Stelle zerstört ist. pING816A wurde mit BamHI und XbaI geschnitten, mit T4-DNA-Polymerase glattendig gemacht und ligiert. Dies entfernte etwa 2900 bp, wobei die XbaI-Stelle zerstört und die BamHI-Stelle wieder erzeugt wurde. Dieses Zwischenplasmid, pKK135, wurde dann mit XhoI geschnitten, mit T4-DNA-Polymerase glattendig gemacht und religiert und somit die XhoI-Stelle zerstört, aber eine PvuI- Stelle geschaffen. Dieses zweite Intermediat, pKK136, wurde mit BamHI und HpaI geschnitten und mit dem etwa 2150 bp BamHI- HpaI-Fragment von pING58 ligiert. Das resultierende Plasmid, pING827, enthält das Betalactamase-Gen für Ampicillin-Selektion und das colEI-Replikon für die Replikation in E. coli; das uraA-Gen von K. lactis und den leu2-d-Marker, die S. cerevisiae mit URA3- und teilweise LEU2-Funktionen als selektierbare Marker ausstatten können; den Replikationsursprung und die STB (REP3)-Funktionen des endogenen 2-Micron-Plasmids für die Replikation von pING827 in S. cerevisiae; und den PGK-Terminator hinter einer einzigen XhoI-Stelle.

Plasmid pING827 ist geeignet zum Klonieren von BamHI-XhoI- Fragmenten, die einen Promotor (in diesem Falle den PGK-Promotor) und ein funktionelles Gen enthalten, das dem Promotor folgt (in diesem Fall ein Thaumatin-Gen mit einem Sekretionssignal), vor dem PGK-Terminator. Plasmid pING834 wurde dadurch konstruiert, daß das etwa 190 bp BamHI-XhoI-Fragment von pING827 durch das etwa 1280 bp BamHI-XhoI-Fragment von pING460 ersetzt wurde. Dies erzeugte erfolgreich eine Version von pING816A, bei der die XhoI-Stelle in uraA zerstört ist. Ähnlich wie pING816A weist pING834 die [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin-I codierende Sequenz auf.

Ein verwandtes Plasmid, pING835, das die [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I codierende Sequenz enthält, kann durch Ligation von drei Restriktionsfragmenten konstruiert werden: Das große BamHI-XhoI-Fragment von pING827; ein etwa 540 bp BamHI-EcoRI- Fragment von pING460, das den PGK-Promotor, die Signalsequenz und den 5'-Teil der [Lys&sup4;&sup6;, Asp¹¹³] Thaumatin-I codierenden Sequenz enthält; und ein etwa 267 bp EcoRI-XhoI-Fragment, das den 3'-Teil der [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I codierende Sequenz enthält. Dieses EcoRI-XhoI-Fragment kann bereitgestellt werden aus pING152CVS, wurde aber, tatsächlich, von einem anderen Plasmid, pING152KRS, bereitgestellt.

KHK1 [pING816A] wurde in Fermentern im kleinen Maßstab angezogen, wobei der Umfang von im geklärten Kulturmedium vorhandenem sekretiertem Thaumatin konsistent 100 mg/l überschritt. Speziell wurden PS-16- oder KHK1-Impfkulturen mit Plasmid pING816A, pING834 oder pING835 bei 30ºC in SD-ura mit der sechsfachen der normalen Leucin-Menge, d.h. 0,18 g/L, bei 30ºC angezogen. 5-50 ml Impfkultur mit OD&sub6;&sub0;&sub0; > 2 wurden aseptisch in etwa einen Liter Batchmedium auf der Basis von Fieschko et al-, Biotech. & Bioeng., Vol XXIX, pp. 1113-1121, John Wiley & Sons (1987) inokuliert, das hergestellt wurde durch Kombinieren von 90 Volumenteilen einer Lösung, welche 23,0 g/L Casaminosäuren, 4,0 g/L Ammoniumsulfat und 13,0 g/L Kaliumphosphat (monobasisch) enthält, mit 10 Teilen getrennt autoklavierten Zusätzen, welche einen Teil 1 (2,0 g/L Glucose, 1,0 g/L Magnesiumsulfat und 0,1 g/L Inositol) und einen Teil 2 (3,0 ml/L Vitaminlösung, 3,0 ml/L Spurenmetalllösung und 3, ml/L 1% Thiaminlösung) umfassen. Obwohl eine Selektion während des Wachstums des Impfgutes aufrechterhalten wird, wird das genaue Verfahren des Impfgutwachstums als nicht kritisch betrachtet. Die Fermenterkultur wurde bei 30ºC angezogen, während der pH durch Zugabe von 40% Ammoniumhydroxid bei pH 5,5 und der gelöste Sauerstoff mittels Preßluft und Sauerstoff bei größer als 35% gehalten wurde. Wenn die OD&sub6;&sub0;&sub0; im Fermenter etwa 1 erreichte, basierte das Zulaufmedium auf Fieschko, et al. und umfaßte 530 ml von Teil 1 (100 g/L Casaminosäuren, 3,0 g/L Kaliumphosphat (monobasisch), 5,0 g/L Ammoniumsulfat, 0,5 ml/L Polypropylenglydol und 465,0 ml/L RO (Umkehrosmose)-H&sub2;O) und 455 ml von Teil 2 (500,0 g/L Glucose, 15,0 ml/L 1 M Magnesiumsulfat, 0,1 g/L Inositol und 120 ml/L RO-H&sub2;O) zu dem, nach Erhitzen, um die Glucose zu lösen, 7,0 ml Vitaminlösung, 7,0 ml Spurenmetallösung und 2,0 ml Thiaminlösung zugegeben worden waren. Die Zulauflösung wurde zugegeben beginnend mit einer Rate von 1 ml/Std. Der Zulauf wurde proportional zur OD&sub6;&sub0;&sub0; gesteigert (bestimmt durch Ziehen und Messen von Proben aus dem Fermenter), aber, was wichtiger ist, die Ethanolkonzentration (aus dem Hefemetabolismus) wurde bei weniger als 0,1 g/L aufrechterhalten. Die Fermentation wurde für 2 bis 8 Stunden fortgesetzt, nachdem der Zulauf ausgegangen war. Die typische End-OD&sub6;&sub0;&sub0; war größer als 200, aber weniger als 250.

Die Werte für sekretiertes Thaumatin wurden bestimmt durch einen ELISA, der Thaumatin-spezifische monoklonale und polyklonale Antikörper verwendet. Die Mengen von in das Fermentationsmedium sekretiertem Thaumatin wurden durch wenigstens eines der zwei zusätzlichen Verfahren gemessen: (1) Bandenintensität von entsalztem Medium, das auf mit Coomassie-Blau gefärbtem SDS-Polyacrylamidgel lief; und (2) Proteinpeakbereichen von Medienproben, die unter Verwendung von Kationenaustauschchromatographie (entweder HPLC oder FPLC) eluiert waren. Für die HPLC wurde ein 10-minütiger Gradient von 0 bis 500 mM NaCl in 10 mM Na-PO&sub4;, pH 6,9, über eine BioRad HRLC MA7C-Säule (Carboxymethylgruppen) verwendet. Für FPLC wurde derselbe Gradient in 20 mM MES [2-N-Morpholino) Ethansulfonsäure] pH 6,0, über eine Rainin-Hydropore-SCX-Säule verwendet. Entsprechend diesem Kationenaustauschchromatographie-Verfahren eluiert Thaumatin als ein einzelner Peak während andere Medienproteine in diesem Chromatographieschema nicht an die Säule binden.


Anspruch[de]

1. Eine gereinigte und isolierte DNA-Sequenz, die in der Lage ist, in einem ausgewählten Wirtsmikroorganismus die Synthese von [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I zu steuern.

2. Eine gereinigte und isolierte DNA-Sequenz nach Anspruch 1, wobei die DNA-Sequenz ein erzeugtes Gen ist.

3. Eine gereinigte und isolierte DNÄ-Sequenz nach Anspruch 2, wobei die Basensequenz ein oder mehrere Codon(s) einschließt, das/die ausgewählt ist/sind unter alternativen Codons, die dieselbe Aminosäure spezifizieren, auf der Basis bevorzugter Expressionscharakteristika des Codons in E. coli.

4. Eine gereinigte und isolierte DNA-Sequenz nach Anspruch 2, wobei die Basensequenz ein oder mehrere Codon(s) einschließt, das/die ausgewählt ist/sind unter alternativen Codons, die dieselbe Aminosäure spezifizieren, auf der Basis von bevorzugten Expressionscharakteristika des Codons in Saccharomyces cerevisiae.

5. Eine gereinigte und isolierte DNA-Sequenz nach Anspruch 1, welche die folgende Sequenz von Nucleotidbasen im codierenden Strang derselben umfaßt:

6. Eine gereinigte und isolierte DNA-Sequenz, die in der Lage ist, in einem ausgewählten Wirtsmikroorganismus die Synthese von [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I zu steuern,

7. Eine gereinigte und isolierte DNA-Sequenz nach Anspruch 6, worin die DNA-Sequenz ein erzeugtes Gen ist.

8. Eine gereinigte und isolierte DNA-Sequenz nach Anspurch 7, worin die Basensequenz ein oder mehrere Codon(s) einschließt, das/die ausgewählt ist/sind unter alternativen Codons, die dieselbe Aminosäure spezifizieren, auf der Basis von bevorzugten Expressionscharakteristika des Codons in E. coli.

9. Eine gereinigte und isolierte DNA-Sequenz nach Anspruch 7, wobei die Basensequenz ein oder mehrere Codon(s) einschließt, dasldie ausgewählt ist/sind unter alternativen Codons, die dieselbe Aminosäure spezifizieren, auf der Basis von bevorzugten Expressionscharakteristika des Codons in Saccharomyces cerevisiae.

10. Eine gereinigte und isolierte DNA-Sequenz nach Anspruch 6, die die folgende Sequenz von Nukleotidbasen im codierenden Strang derselben umfaßt:

11. Ein biologisch funktioneller DNA-Mikroorganismentransformationsvektor, der ein Gen einschließt, das in der Lage ist, in einem ausgewählten Wirtsmikroorganismus die Synthese von [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I zu steuern.

12. Ein biologisch funktioneller DNA-Mikroorganismentransforrnationsvektor, der ein Gen einschließt, das in der Lage ist, in einem ausgewählten Wirtsmikroorganismus die Synthese von [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I zu steuern.

13. Ein Mikroorganismus, der mit einem Vektor transformiert ist, der ein Gen enthält, das in der Lage ist, die Synthese von [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I zu steuern.

14. Ein Mikroorganismus, der mit einem Vektor transformiert ist, der ein Gen einschließt, das in der Lage ist, die Synthese von [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I zu steuern.

15. Die Mikroorganismen nach den Ansprüchen 13 oder 14, die E. coli-Mikroorganismen sind.

16. Die Mikroorganismen nach den Ansprüchen 13 oder 14, die Saccharomyces cerevisiae-Mikroorganismen sind.

17. Ein Verfahren zur Herstellung von [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I, das umfaßt:

Anziehen von Mikroorganismen unter geeigneten Nährstoffbedingungen, die mit biologisch funktioneller DNA transformiert sind, die ein Gen einschließt, das die Synthese von [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I steuert, wobei besagte Mikroorganismen besagtes Gen exprimieren und [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I produzieren.

18. Ein Verfahren zur Herstellung von DNA [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I, das umfaßt:

Anziehen von Mikroorganismen unter geeigneten Nährstoffbedingungen, die mit biologisch funktioneller DNA transformiert sind, die ein Gen einschließt, das die Synthese von [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I steuert, wobei besagte Mikroorganismen besagtes Gen exprimieren und [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I produzieren.

19. Die Verfahren nach den Ansprüchen 17 oder 18, wobei besagte Mikroorganismen E. coli-Mikroorganismen sind.

20. Die Verfahren nach den Ansprüchen 17 oder 18, wobei besagte Mikroorganismen Saccharomyces cerevisiae-Mikroorganismen sind.

21. Ein Polypeptidprodukt der Expression eines Gens, das für [Lys&sup4;&sup6;, Asp&sup9;&sup7;, Asp¹¹³] Thaumatin-I codiert, in einem Mikroorganismus.

22. Ein Polypeptidprodukt der Expression eines Gens, das für [Lys&sup4;&sup6;, Asp¹¹³, Asp¹³&sup7;] Thaumatin-I codiert, in einem Mikroorganismus.







IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com