PatentDe  


Dokumentenidentifikation DE10248301A1 29.04.2004
Titel Herstellung eines Lebend-Impfstoffes gegen Influenza-Viren
Anmelder Philipps-Universität Marburg, 35037 Marburg, DE
Erfinder Klenk, Hans-Dieter, Prof. Dr., 35440 Linden, DE;
Stech, Jürgen, Dr.med., 35085 Ebsdorfergrund, DE
DE-Anmeldedatum 16.10.2002
DE-Aktenzeichen 10248301
Offenlegungstag 29.04.2004
Veröffentlichungstag im Patentblatt 29.04.2004
IPC-Hauptklasse A61K 39/145
IPC-Nebenklasse C12N 7/04   A61P 31/16   
Zusammenfassung Die vorliegende Erfindung betrifft ein neues Verfahren zur Herstellung eines attenuierten Influenza-Virus, das homolog zum epidemischen Wild-Typ Stamm ist, als Impfstoff gegen das Influenza-Virus. Durch die Modifikation eines Influenza-Oberflächenproteins verliert das Virus seine Pathogenität, nicht aber seine Immunogenität und ist als Lebend-Impfstoff bei der Immunisierung von Individuen insbesondere Kinder, ältere Menschen und immundefiziente Personen verwendbar.

Beschreibung[de]

Die vorliegende Erfindung betrifft neue Mutanten von Influenza-Viren, deren Genom weitestgehend mit dem des epidemischen Stammes übereinstimmt, wobei die erfindungsgemäßen Virus-Mutanten immunogen, jedoch nicht pathogen sind. Weiterhin betrifft die Erfindung ein sicheres Verfahren zu deren Herstellung sowie die Verwendung der erfindungsgemäßen Virus-Mutanten als attenuierte rekombinante Impfstoffe gegen das Influenza-Virus, die auch für die Applikation bei Kindern, älteren Menschen und Immundefizienten Personen geeignet ist.

Trotz der Verfügbarkeit von verschiedenen Impfstoffen stellt die Infektion mit dem Influenza A Virus eine bedeutende Gesundheitsbedrohung für den Menschen dar, die mit den dadurch bedingten Arbeitsausfällen auch gesamtwirtschaftlich hohe Kosten verursacht.

Das zu der Familie der Orthomyxoviridae gehörende Influenza A Virus ist ein Negativ-Strang RNA-Virus mit segmentiertem Genom. Es ist allgemein bekannt, dass RNA Viren schwer zu bekämpfen sind, da deren Polymerasen eine extrem hohe Fehlerrate haben und dadurch zu einer enormen Wandlungsfähigkeit dieser Viren beitragen. Influenza-Viren besitzen darüber hinaus die Fähigkeit, die Genomsegmente aus verschiedenen Virus-Stämmen neu zu kombinieren. Derzeit sind von den sogenannten „Oberflächenproteinen" Haemagglutinin und Neuraminidase, die als Spikes auf der Virusoberfläche erscheinen, 15 Haemagglutinin (HA) und 9 Neuraminidase (NA) Subtypen bekannt. Vermutlich spielen Schweine, als Zwischenwirt eine entscheidende Rolle bei der Entstehung neuer, humanpathogener Virusstämme. Schon seit vielen Jahren ist es das Ziel der Wissenschaft, die Entstehung der human pathogenen Influenza-Virusstämme zu beobachten und zu beeinflussen und verbesserte antivirale Therapien und Vakzinen zu entwickeln.

Der Stand der Technik kennt Impfstoffe, die als Spaltimpfstoffe oder als Untereinheit-Impfstoffe vorliegen, wobei die Spaltimpfstoffe die durch Detergenzien solubilisierten Bestandteile des gesamten Influenza-Virus enthalten, die Untereinheit-Impfstoffe hingegen eine Anreicherung der Oberflächenproteine. Dazu beschreibt beispielsweise die DE 698 00 383 T2 ein Verfahren zur Herstellung eines Influenza-Oberflächenantigen-Impfstoffes, die DE 199 07 485 A1 eine Vakzine gegen humanes Immundefizienzvirus (HIV), die eine Mischung viraler Proteinmoleküle umfasst.

Die Effektivität der inaktivierten Impfstoffe (Spaltvakzinen und Untereinheitvakzinen mit standardisierter HA-Menge) hängt ab vom Alter des Impflings und dem Grad der Übereinstimmung der für die Impfstoffherstellung verwendeten Virusstämme mit dem epidemischen Stamm (CDC, Atlanta, USA: MMWR Vol. 48 No. RR-4:1-28 (1999)). Bei älteren Personen ist die Effektivität geringer als bei jüngeren Erwachsenen. Die enorme Variabilität der Influenzaviren erfordert jedes Jahr eine an die zu erwartenden epidemischen Stämme neu angepasste Impfung durch intramuskuläre Injektion, wobei die Prognose auch unzutreffend sein kann. Die jährliche Impfung führt zu einem Akzeptanzproblem (vor allem bei Kindern), was sich an den Impfraten ablesen lässt (CDC, Atlanta, USA: MMWR Vol. 48 No. RR-4:1-28 (1999)). Eine Reduktion der Morbidität würde aber weit höhere Durchimpfungsraten erfordern. Die intranasale Impfung mit einem attenuierten Virus würde das Akzeptanzproblem umgehen. Weiterhin wird der natürliche Infektionsvorgang weitestgehend nachgeahmt, und es kommt zu einer Stimulierung aller Komponenten des Immunsystems, nämlich der Antikörperbildung sowie der Stimulation von T-Helfer-Zellen und Induktion von zytotoxischen T-Zellen (CD8). Die natürliche Influenza-Infektion induziert beim Menschen eine bis zu 5 Jahren dauernde belastbare Immunität auch bei geringerer Übereinstimmung der Oberflächenantigene (Jilg, Schutzimpfungen, Ecomed 2000; Spiess, Impfkompendium, Thieme 1999), was für ein attenuiertes Influenzavirus gleichermassen zu erwarten wäre. Nachteilig für die inaktivierten Impfstoffe ist weiterhin, dass nicht alle Antigene des Influenza-Virus enthalten sind und die intramuskuläre Applikation in geringerem Masse eine mukosale Immunität induziert.

Ein besserer Ansatz ist daher die Verwendung eines sogenannten Lebendimpfstoffes, mit einem attenuierten, lebenden Virus, das nur eine limitierte virale Replikation und Proteinsynthese in den infizierten Zellen initiiert. Dazu werden die Viren unter verschiedenen Bedingungen in Zellkulturpassagen vermehrt, bis sie mehr oder weniger zufallsbedingt ihre Pathogenität verlieren und gleichzeitig die immunogenen Eigenschaften behalten. Allerdings dauert dieser Vorgang relativ lange. Zudem ist generell bei diesem Verfahren die Einheitlichkeit der entstehenden Viruspopulationen ein Problem und Risiko bei der Impfstoffherstellung.

Die DE 35 00 744 A1 beschreibt ein Verfahren zur Herstellung eines Impfstoffes gegen Herpes-Viren, indem durch Passagen des virulenten Stammes in Gegenwart bestimmter Verbindungen, wie z.B. 5-Jod-2'-Deoxyuridin avirulente, aber immunogene Mutanten des Virus entstehen, die erst kloniert und dann zur Herstellung eines einheitlichen Impfstoffes verwendet werden.

Für Influenza-Viren ist durch Orlich et al. bekannt, wie durch Selektion und wiederholte Passagen in Zellkultur Trypsin-resistente Influenza-Viren entstehen (Orlich M, Linder D, Rott R. J Gen Virol. 76:625–633, 1995). Die so erhaltenen Influenza Virus-Mutanten (A/Seal/Mass/1/80) weisen die Charakteristik auf, dass das HA seine proteolytische Spaltbarkeit durch Trypsin verloren hat, aber in verschiedenen Zellkulturen durch Elastase, Chymotrypsin oder Thermolysin aktivierbar ist. Diese Proteasen aktivieren in den Mutanten auch die Infektiosität, die Hämolyse und Zellfusionseigenschaften. Eine besondere Eigenschaft der Protease-aktivierbaren Mutanten ist, dass sie für Hühner nicht pathogen sind, allerdings gegen ein stark pathogenes Virus eine schützende Immunantwort auslösen. Der Verlust der proteolytischen Spaltbarkeit durch Trypsin sowie die Aktivierbarkeit durch andere Proteasen geht einher mit einem Aminosäure-Austausch in der HA-Spaltstelle. Der Austausch der basischen Aminosäure Arginin 1 durch neutrale Aminosäuren, wie Isoleucin, Threonin, Methionin oder Leucin führt zu Virus-Mutanten mit Spaltbarkeit durch Chymotrypsin und Elastase, die Insertion einer einzelnen Aminosäure Leucin an Position 4 des HA2 Polypeptid führt zu Virus-Mutanten mit Spaltbarkeit durch Thermolysin.

Nachteilig für die Impfstoff-Herstellung ist jedoch, dass die Trypsinresistenten Influenza-Viren nur durch Selektion und aufwendig wiederholte Passagen in Zellkultur entstehen. Dieser Vorgang dauert relativ lange und verursacht entsprechende Kosten. Das Verfahren muss jedes Jahr auf die aktuellen epidemischen Virus-Stämme neu angewandt werden, wobei es keine Vorhersagbarkeit des Ergebnisses gibt, da der Verlust der Pathogenität durch die Zellkulturpassagen (oft in unnatürlichen Wirtszellen) mehr oder weniger zufallsbedingt erfolgt.

Zur Herstellung eines Lebend-Impfstoffes gegen Influenza-Viren ist weiterhin das Verfahren der Kälte-Adaptation (Firma Aviron) bekannt. Es handelt sich bei den etablierten kälteadaptierten Impfstoffen um attenuierte Viren, die durch Doppelinfektion aus einem kälteadaptierten Laborstamm (A/Ann Arbor/6/60 ca, Maassab, H.F., Fa. Aviron; Russland: A/Len/47 ca, Ghendon, Y., Medvedeva, T.) und einem aktuellen, epidemischen Stamm hergestellt werden. Die dabei entstehende Reassortante enthält das Haemagglutinin und die Neuraminidase des aktuellen Virus sowie alle anderen Gene des kälteadaptierten Virus. Aufgrund seiner nach unten verschobenen Temperaturspezifität repliziert dieses Virus jedoch nur im oberen Respirationstrakt (Nasen und Rachenraum).

Die kälteattenuierten Viren induzieren Immunantworten gegen die Oberflächenantigene HA und NA des aktuellen, epidemischen Stammes aber auch gegen die anderen, nicht aktuellen 6 Gensegmente des kälteadaptierten Laborstammes.

Dieses Verfahren weist eine große Anzahl von Nachteilen auf. Zum einen ist das Herstellungsverfahren durch Doppelinfektion (Reassortment) sehr zeitaufwendig und kostspielig. Darüber hinaus können von Jahr zu Jahr abhängig vom epidemischen Stamm unterschiedlich starke Inkompatibilitäten zwischen HA mit den übrigen 6, vom kälteadaptierten Laborstamm stammenden Gensegmenten auftreten (Hoffmann et al., PNAS, Vol.97, 6108–6113, 2000; Scholtissek et al., Journal of Virology, Vol. 76, 1781–1786 2002), was die Planbarkeit der Herstellung des Impfstoffes stark beeinträchtigt. In diesem Zusammenhang ist zudem damit zu rechnen, dass eine optimale Steuerung der Immunantwort durch das Vorhandensein der 6 Gensegmente des kälteadaptierten Laborstammes stark beeinträchtigt ist. Ein großer Nachteil ist auch die mögliche Reversion der Nukleotidsubstitution bei jeder Vermehrung des Virus, sowie die prinzipbedingte Beschränkung der viralen Replikation auf den oberen Respirationstrakt durch Mutationen im Polymerasebereich.

Ein Verfahren zur Herstellung von attenuierten lebenden, rekombinanten Influenza A-Viren mit inkorporierten fremden Glykoproteinen offenbart die DE 197 09 512 A1. Allerdings ist in diesem Verfahren zur Herstellung rekombinanter Viren noch die umständliche Verwendung eines Helfervirus vorgesehen.. Verfahren zur Herstellung kompletter Influenza A Viren ohne Helfervirus werden in Hoffmann et al. (PNAS, Vol.97, 6108–6113, 2000) und in den WO 00/60050 A3 und WO 00/53786 A1 beschrieben.

Aufgabe der vorliegenden Erfindung ist es, die beschriebenen Nachteile im Stand der Technik zu beseitigen und ein sicheres Verfahren zur Herstellung neuer immunogener, jedoch nicht pathogener Mutanten von Influenza-Viren bereitzustellen, deren Genom weitestgehend mit dem des epidemischen Stammes übereinstimmt, die als attenuierte rekombinante Lebend-Impfstoffe auch bei Kindern, älteren Menschen und immundefizienten Personen gegen das Influenza-Virus einsetzbar sind.

Die Aufgabe wird erfindungsgemäß durch die Bereitstellung immunogener, jedoch nicht pathogener Mutanten von Influenza-Viren, die als attenuierter rekombinanter Lebend-Impfstoff auch bei Kindern, älteren Menschen und immundefizienten Personen einsetzbar sind, sowie durch ein Verfahren gemäß Anspruch 1 zu deren Herstellung gelöst.

Überraschenderweise wurde ein Attenuierungsprinzip gefunden, mit dem die proteolytische Aktivierung des rekombinanten Virus in vivo weitestgehend verhindert wird und alle viralen Antigene an denselben Ort der natürlichen Influenza-Infektion, den unteren und oberen Respirationstrakt gebracht werden.

Influenzaviren benötigen für eine multizyklische Replikation die Spaltung ihres HA durch eine Protease, um die Fusion zwischen viraler Lipidhülle und zellulärer Endosomenmembran einzuleiten. Daher ist die proteolytische Aktivierung ein essentieller Schritt; Viren mit ungespaltenem HA sind nicht infektiös und können sich nicht im Organismus vermehren. Die dafür verwendete Protease ist keine virale Komponente, sondern wird vom Wirt bereitgestellt. Welche Protease zur Wirkung kommt, hängt vom Spaltmotiv im HA ab [Klenk und Garten, 1994]. Das Spaltmotiv und seine Position sind bei allen Influenzaviren konserviert und in folgendem Übersichtsartikel beschrieben Steinhauer (Virology Vol: 258, 1–20, 1999).

Es wird erfindungsgemäß vorgeschlagen, das Spaltmotiv des HA so zu ersetzen, dass ein Virus entsteht, welches in vitro gut vermehrungsfähig ist, aber in vivo nur abortiv replizieren kann. Da das Virus in vitro nicht die Möglichkeit hat, durch Anpassung die fehlende zelluläre Funktion zu ersetzen, ist hier ein Entweichen vor dem Selektionsdruck durch Mutation nicht möglich und eine sichere und einfache Herstellung als Impfstoff gegeben.

Ein mit diesen Viren erzeugter Impfstoff hat weiterhin den Vorteil, dass alle Antigene des aktuellen pathogenen Influenza-Virus enthalten sind, das Impfvirus zwar immunogen, aber nicht pathogen ist, dabei sowohl die B-Zell-Antwort mit Antikörperproduktion, als auch eine Reaktion der CD4- und CD8-T-Zellen stimulieren wird. Es induziert eine protektive Immunität, ohne Krankheitssymptome auszubilden. Aufgrund dieser abortiven in vivo Replikation ist eine Wirksamkeit des Impfstoffes insbesondere auch bei Kindern, älteren Menschen und Immundefizienten Personen gegeben.

Die folgende Zeichnung erläutert ausführlich den Erfindungsgegenstand:

1 Modelldarstellung des HA-Proteins nach Steinhauer, 1999. Die HA-Spaltstelle ist vergrößert heraus gezeichnet und zeigt die Position der Virus-Wildtyp (WSNwt) Aminosäure Arginin R, die im Beispiel der Elastase-abhängigen rekombinanten Virus-Mutante (WSN-E) durch Valin V ersetzt ist.

2 Darstellung der Ergebnisse des Plaquetestes der Elastase-abhängigen rekombinanten Virus-Mutante in Gegenwart von Elastase (A) und in Gegenwart von Trypsin (B).

3 Wachstumskurven der Elastase-abhängigen rekombinanten Virus-Mutante WSN-E (mit Quadrat markierte Kurve) und des Virus-Wildtyps WSNwt (mit Dreieck markierte Kurve) auf MDCK-Zellen.

4 In-vivo Test zur Replikation der Elastase-abhängigen rekombinanten Virus-Mutante WSN-E und des Virus-Wildtyps WSNwt in Lunge, Gehirn und Herz von Mäusen.

5 Ergebnis der intranasalen Immunisierung von Mäusen mit der Elastase-abhängigen rekombinanten Virus-Mutante WSN-E.

6 Ergebnis der WSNwt-Infektion von mit WSN-E immunisierten Mäusen sowie einer nicht immunisierten Kontrollgruppe.

7 Plaquetiter in der Lunge von Mäusen, die mit WSN-E immunisierten waren, am 3.Tag nach intranasaler Immunisierung mit dem Virus-Wildtyp WSNwt.

Der Herstellung der erfindungsgemäßen rekombinanten Influenza Viren liegt das von Hoffmann et al., in PNAS, Vo1.97, 6108–6113, 2000 beschriebene System der reversen Genetik zugrunde, das auf die Verwendung eines Helfervirus verzichtet. In diesem System werden die acht Gensegmente des jeweils aktuellen epidemischen Stammes in den Plasmidvektor pHW2000 kloniert. Das Insert wird von PoI1- und Pol2-Promotoren flankiert, was zur Transkription in vRNA und in mRNA nach Transfektion in der Zelle führt. Der dabei rekonstituierte virale Polymerasekomplex führt zur sekundären Synthese weiterer viraler Komponenten und verstärkt somit die Bildung neuer Virionen zusätzlich. Ein solches plasmidbasiertes System ermöglicht die Herstellung beliebiger (lebensfähiger) Virusmutanten durch Einführung von Mutationen in die Inserts der verwendeten Plasmide. Jedes plasmidbasierte System der reversen Genetik, welches eine solche Mutagenese erlaubt, wäre für die Realisierung der Erfindung verwendbar (so auch das von Neumann et al., PNAS, Vo1.97, 6108–-6113, 2000).

Die auf diese Weise erhaltenen Mutationen beeinträchtigen die Vermehrung des Virus in vitro nicht, verhindern aber unerwarteterweise die proteolytische Aktivierung des rekombinanten Virus in vivo aber weitestgehend. Damit sind diese Virus-Mutanten zur Verwendung als Lebendimpfstoff insbesondere für Kinder, ältere Menschen und immundefiziente Personen hervorragend geeignet. Im besonderen handelt es sich bei der erfindungsgemäßen Mutation um eine Mutation im HA, indem beispielsweise die Aminosäure Arginin gegen Valin ausgetauscht wird. Dabei entsteht ein Elastase-Motiv, das gleichzeitig das monobasische Spaltmotiv von HA, welches in allen Influenzaviren anzutreffen ist, zerstört. 1 zeigt im HA-Modell von Steinhauer (Virology, 1999) die proteolytischen Spaltstellen (Pfeil) und eine Gegenüberstellung der Spaltstellen von WSNwt (Wildtypvirus) und WSN-E (erfindungsgemäße Influenza-Virus-Mutante).

Zur Herstellung eines Elastase-abhängigen rekombinanten Virus werden die von Hoffmann et al. in PNAS, Vo1.97, 6108–6113, 2000 beschriebenen Plasmide, die dem Stamm AANSN/33 entsprechen, direkt verwendet (pHW 181-PB2, pHW 182-PB1, pHW 183-PA, pHW 184-HA, pHW 185-NP, pHW 186-NA, pHW 187-M, pHW 188-NS). Das Plasmid pHW 184-HA enthält dabei das HA und ist Ziel der Mutation. Mittels PCR-Technik werden die Nukleotide AG gegen GT an den Positionen 1027 und 1028 im kodierenden Bereich des HA-Gens des Stammes AANSN/33 (Accession J02176) ausgetauscht. Das führt zum Ersatz der Aminosäure Arginin gegen Valin. Das rekombinante Influenza-Virus mit dieser Mutation wird im folgenden als WSN-E, das unmodifizierte rekombinante Wildtypvirus als WSNwt bezeichnet.

Das Elastase-Spaltmotiv (Mecham et al., Journal of Biological Chemistry 272: 18071–18076 (1997) bietet zahlreiche Mutagenesemöglichkeiten. Es wird jedoch der Einsatz von Aminosäuren bevorzugt, die sich in mindestens zwei Nukleotiden eines Codons vom Wildtyp (dort Arginin) unterscheiden, um die Wahrscheinlichkeit des Auftretens von Revertanten zu reduzieren. Daher ist der Austausch in die Aminosäure Glycin zwar ebenfalls möglich, wird aber nicht favorisiert. Besser geeignet ist der Austausch zu den Aminosäuren Valin (V) oder Alanin (A).

Der eingeführte Austausch zu Valin (V) zerstört das monobasische HA-Spaltmotiv des Wildtypvirus und erzeugt ein neues, bisher nicht vorhandenes Elastase-Motiv. Die hochpathogenen Stämmen wie das Geflügelpestvirus oder das H5N1-HongKong-Isolat von 1997 haben ein polybasisches Spaltmotiv im HA. Auch hier führt eine Mutation durch Ersatz des polybasischen Motivs durch ein Elastase-Motiv zu attenuierten Viren.

Für die Mutation des Wildtyp-HA-Spaltmotives stehen darüber hinaus weitere Alternativen zu Verfügung. Dies sind neben der Elastase-Abhängigkeit, auch eine Abhängigkeit für andere Proteasen, wie beispielsweise die TEV-Protease (Fa. Invitrogen GmbH, Karlsruhe, Deutschland) oder Thermolysin (Fa. Roche Diagnostics GmbH, Mannheim, Deutschland). Das Einfügen entsprechender Mutationen im Wildtyp-HA-Spaltmotiv führt ebenfalls zu attenuierten rekombinanten TEV-bzw. Thermolysin-abhängigen Influenza-Viren, die als Lebend-Impfstoff verwendbar sind.

Für die Mutagenese zur Einführung von Mutationen in Plasmide beispielsweise mittels inverser PCR stehen dem Fachmann zahlreiche Methoden aus dem Stand der Technik zur Verfügung. Dies gilt auch für die weitere Analyse der Klone mittels Sequenzierung, Restriktionsspaltungen, Agarose-Gelelektrophorese, Isolierung und Reinigung von Nukleinsäure-Fragmenten, Transfer von Nukleinsäuren auf Nitrocellulose und Nylon-Membran, Verknüpfung von Nukleinsäuren-Fragmenten (Sambrook et al.).

Das mutierte HA-Plasmid wird zusammen mit den anderen nicht mutierten sieben Plasmiden nach dem Protokoll von Hoffmann et al. PNAS, Vo1.97, 6108–6113, 2000) in der Transfektion in einer Mischkultur von 293T- und MDCK-Zellen eingesetzt. Prinzipiell eignet sich jedes im Stand der Technik bekannte Transfektionsprotokoll. Um die multizyklische Replikation der Elastase-Mutante zu ermöglichen, wird dem Überstand 2 Tage nach Transfektion Elastase (5 &mgr;g/ml, Elastase aus Schweinepankreas, Fa. Sigma) zugesetzt. Die Bedingungen zur weiteren Virusvermehrung nach Transfektion können den Erfordernissen des freizusetzenden Virus individuell angepasst werden. Dies ist dem Fachmann je nach Eigenschaft des Ausgangsisolates leicht möglich.

Neben der primären Einführung der Elastase-Mutation führt eine Kombination mit weiteren attenuierenden, so z.B. temperatursensitiven Mutationen zur Herstellung eines mehrfach attenuierten Virus. Um ein solches Virus zu erzeugen, wird der Zellkultur bei einer entsprechend reduzierten Temperatur zusätzlich Elastase zugesetzt.

Drei bis fünf Tagen nach Transfektion ist typischerweise auf den Gewebekultur-Zellen ein zytopathischer Effekt in Form von morphologischen Zellveränderungen sichtbar, die Zellen verlieren ihre Form, sie werden kleiner und lösen sich ab, Zellkontakte gehen verloren. Die Mutationen mit Sequenzanalyse bestätigt und die Proteaseabhängigkeit im Plaquetest demonstriert, wobei statt des üblich eingesetzten Trypsins die entsprechende Protease, hier beispielhaft die Elastase zugegeben wird. 2 zeigt den Plaquetest mit Elastase (A) oder Trypsin (B) der erfindungsgemäßen Elastase-abhängigen rekombinanten Virus-Mutante (WSN-E) auf MDCK-Zellen bei gleicher Verdünnung von 10–5. WSN-E ist deutlich Elastase-abhängig (Plaques bei A) und kann im Gegensatz zum Wildtypvirus (WSNwt) nicht mehr durch Trypsin aktiviert werden (keine Plaques bei B). 3 zeigt Wachstumskurven von WSNwt und WSN-E während Kultivierung auf MDCK-Zellen. WSNwt wird in Anwesenheit von 0,5 &mgr;g/ml Trypsin (Kurve mit Dreieck), WSN-E in Anwesenheit von 5 &mgr;g/ml Elastase (Kurve mit Quadrat) kultiviert. Beide Viren werden mit einer MOl von 3×10 2 inokuliert und wachsen innerhalb von 72h zu annähernd gleich hohen Titern. Das Wachstum der Elastase-abhängigen rekombinanten Virus-Mutante (WSN-E) unterscheidet sich damit nicht vom Wildtypvirus WSNwt.

Das Elastase-abhängige Virus WSN-E wird im Tierversuch hinsichtlich Letalität und Organtropismus getestet.

Dazu werden vier Wochen alte, weibliche BalbC-Mäuse über verschiedene Zeiträume hinweg (12h dunkle, 1d mittelgraue und 3d hellgraue Säulen) intranasal inokuliert mit PBS (als negative Kontrolle), dem Wildtypvirus WSNwt oder den Elastase-abhängigen rekombinanten Viren WSN-E (beide Viren mit 106 pfu in 20 &mgr;l PBS unter Narkose nach intramuskulärer Ketamininjektion (200 mg/kg Maus)). 4 zeigt den Vergleich hinsichtlich der Replikation in Lunge, Gehirn und Herz dieser Mäuse. Im Gegensatz zu WSNwt ist die Replikation von Elastase-abhängigen rekombinanten Viren WSN-E auf se-abhängigen rekombinanten Viren WSN-E auf die Lunge sowie auf einen kürzeren Zeitraum (weniger als 3 Tage) bei niedrigeren Titern (um 4 Logstufen weniger) in Gehirn und Herz beschränkt (graue Hervorhebung) ist. Bei den Tieren treten keinerlei Krankheitssymptome auf.

Die 5, 6 und 7 fassen die Ergebnisse eines Immunisierungsexperimentes in Mäusen zusammen, in dem die Mäuse intranasal inokuliert werden. Diese Immunisierung wird gut toleriert, ohne dass Krankheitssymptome oder Gewichtsverlust auftraten (Daten nicht gezeigt).

5 zeigt, dass alle Mäuse die intranasale Immunisierung mit den Elastase-abhängigen rekombinanten Viren WSN-E überleben. Die Experimente werden in drei Gruppen durchgeführt: 106 pfu WSN-E inaktiviert mit Formalin (mit Kreuz markiert), 103 pfu WSN-E als Lebendvirus (mit Punkt markiert) und 106 pfu WSN-E als Lebendvirus (mit Quadrat markiert).

6 zeigt die Infektion der überlebenden Mäuse in den Gruppen aus 5 mit dem letalen Wildtypvirus WSNwt (106 pfu intranasal) sowie einer weiteren, nicht immunisierten Gruppe als Positivkontrolle. Die Inokulation erfolgt vier Wochen nach Immunisierung. Bis auf die Gruppe mit den Mäusen, die mit 106 pfu WSN-E immunisiert worden waren kommt es in den anderen Gruppen (inaktiviertes Virus, WSN-E in niedrigerer Dosis von 103 pfu und nicht immunisierte Mäuse als Positivkontrolle) zu starker Gewichtsabnahme sowie zu 100% Letalität. Tiere in der Gruppe mit der Immunisierungsdosis 106 pfu WSN-E zeigen weder Gewichtsabnahme noch Krankheitssymptome. Alle Tiere aus dieser Gruppe überleben, eine Immunisierungsdosis von 106 pfu WSN-E schützt.

Von der Lunge von jeweils zwei Mäusen aus jeder der in 5 benannten Gruppe wird am 3. Tag nach intranasaler Inokulation mit dem letalen Wildtypvirus WSNwt der Plaquetiter bestimmt.

7 zeigt das Ergebnis des Plaquetests mit Lungenhomogenat. In Mäusen der Gruppen mit inaktiviertem Virus, WSN-E in niedrigerer Dosis von 103 pfu und nicht immunisierte Mäuse als Positivkontrolle lassen sich deutlich Plaquetiter in der Lunge nachweisen, während bei Mäusen der Gruppe, die mit WSN-E in hoher Dosis von 106 pfu immunisiert worden war, keine Plaquetiter in der Lunge nachweisbar ist.

Zusammenfassend belegen die Experimente, daß die Elastaseabhängige rekombinante Influenza-Virus Mutante WSN-E in Zellkultur vergleichbar gut herstellbar ist, wie das Wildtyp-Virus. Die Mutante WSN-E ist in vivo vollständig attenuiert und induziert eine protektive Immunität, ohne Krankheitssymptome nach Infektion auszubilden.

In einer Form der erfindungsgemäßen Verwendung wird vorgeschlagen, Impfstoffe mit einer Protease-abhängigen rekombinanten Influenza-Virus Mutante insbesondere der Elastase-abhängigen rekombinanten Influenza-Virus Mutante WSN-E zur Prävention einer Infektion mit einem Influenza A Virus einzusetzen.

Daher betrifft die Erfindung die Verwendung des Impfstoffes an Patienten, die einem Infektionsrisiko mit einem Influenza-A-Virus unterliegen.

Der Begriff Patient bezieht sich dabei gleichermaßen auf Menschen und Wirbeltiere. Damit kann der Impfstoff in der Human- und Veterinärmedizin verwendet werden. Besonders geeignet ist der Impfstoff für Kinder, ältere Menschen und immundefiziente Personen. Der therapeutisch wirksame Impfstoff der vorliegenden Erfindung wird den Patienten, als Teil einer pharmazeutisch akzeptablen Komposition entweder oral, rektal, parenteral intravenös, intramuskulär oder subkutan, intracisternal, intravaginal, intraperitoneal, intravasculär, lokal (Puder, Salbe oder Tropfen) oder in Sprayform verabreicht.

Pharmazeutisch akzeptable Kompositionen können die Modifikationen als Salze, Ester, Amide und "Prodrugs" beinhalten, sofern sie nach zuverlässiger medizinischer Beurteilung keine übermäßige Toxizität, Irritationen oder allergische Reaktionen am Patienten auslösen.

Der Terminus "Prodrug" bezieht sich auf Verbindungen, die zur Verbesserung der Aufnahme transformiert werden, wie beispielsweise durch Hydrolyse im Blut.

Dosierungsformen für die örtliche Administration des Impfstoffes dieser Erfindung schließen Salben, Puder, Sprays oder Inhalationsmittel ein. Die aktive Komponente wird unter sterilen Bedingungen, mit einem physiologisch akzeptablen Trägerstoff und möglichen Preservativen, Puffern oder Treibmitteln, je nach Bedarf, vermischt.

Ausführungsbeispiele Beispiel 1 Herstellung und Anwendung eines Elastaseabhängigen rekombinanten Virus

Die Herstellung der rekombinanten Viren erfolgt beispielsweise unter Anwendung des plasmidbasierten Systems der reversen Genetik von Hoffmann et al., (PNAS 97, 6108-6113 (2000). Für ein aktuelles epidemisches Virus müssen alle 8 Gensegmente mittels RT-PCR amplifiziert und in den Plasmidvektor pHW2000 kloniert werden (Hoffmann et al., PNAS, Vo1.97, 6108–6113, 2000). Jedes Ausgangsmaterial (z.B. Allantoisflüssigkeit aus dem Hühnerei oder Zellkulturüberstände), von dem die Isolation der viralen RNA möglich ist, wäre geeignet. Diese Methodik ist dem Fachmann geläufig.

Das Verfahren gliedert sich in 3 Schritte:

  • 1. Mutagenese des Plasmides, welches das Haemagglutinin enthält
  • 2. Virusfreisetzung nach Transfektion von 8 Plasmidkonstrukten nach der Methode von Hoffmann et al., PNAS, Vo1.97, 6108–6113, 2000
  • 3. Virusvermehrung in Zellkultur in Gegenwart von Protease, beispielsweise Elastase aus Pankreas vom Schwein (Fa. Serva Electrophoresis GmbH, Heidelberg, Deutschland)

1. Mutagenese des Plasmides pHW184-HA

Das Plasmid pHW184-HA (beschrieben bei Hoffmann et al., PNAS, Vo1.97, 6108–6113, 2000), kodiert für das Oberflächenprotein Haemagglutinin (HA). Diese Sequenz wird beispielsweise mittels kommerziell erhältlicher QuikchangeTM-Mutagenese so modifiziert, daß die Nukleotide AG an den Positionen 1027 und 1028 im kodierenden Bereich des NA-Gens des Stammes A/WSN/33 (Accession J02176) gegen GT ausgetauscht werden. Der verwendete Kit QuikchangeTM-Kit ist bei Fa. Stratagene, La Jolla, Ca, USA erhältlich.

Laut Herstellerangabe wird folgender Reaktionsansatz pipettiert:

Als Template für die Reaktion wird Plasmid pHW184-HA (beschrieben bei Hoffmann et al., PNAS, Vo1.97, 6108–6113, 2000) eingesetzt. Die Primer für die Amplifikation zeigen die gegenüber dem Wildtyp veränderten Nukleotide in fetten Buchstaben:

M1Fo: CCCATCCATTCAATACGTAGGTCTATTTGGAGCCA Valin

M1Re: TGGCTCCAAATAGACCTACGTATTGAATGGATGGG

Der spezifische Einsatz weiterer Primer mit anderen Nukleotiden im markierten Bereich ist ebenso möglich führt dann zu anderen Aminosäuren-Austauschen, wie z.B. Alanin, Glycin u.ä. Es ist weiterhin mit modifizierten Primern leicht möglich, anstelle des Elastase-Motives, das Spaltmotiv für TEV-Protease, Thermolysin oder einer anderen Protease einzubringen.

Der Reaktionsansatz wird in einem Thermocycler unter folgendem Temperaturprofil inkubiert:

Danach erfolgt eine weitere Inkubation mit dem Restriktionsenzym Dpn I (5U/&mgr;l, Fa. New England Biolabs Inc., Berverly, MA, USA) zur Entfernung des Wildtypplasmides und von Hybridmolekülen, die methyliert sind, aus dem Reaktionsansatz. Dazu werden 2 &mgr;l Dpn I in den Reaktionsmix hinzu gegeben und anschließend erneut inkubiert: 1 h 37°C.

Die Transformation von 2 &mgr;l Reaktionsansatz in kompetente E.coli-Zellen erfolgt nach den Empfehlungen des Herstellers Stratagene. Nach Transformation werden Kulturen (5 ml) in LB-Medium über Nacht angeimpft und die Plasmid-DNA mittels einer geeigneten Methode isoliert, beispielsweise mit dem Qiaprep8-MiniprepTM-Kit (Fa. Qiagen, Hilden, Deutschland). Per Sequenzierung werden die Klone auf eine korrekte Mutation überprüft. Positive Klone mit der gewünschten Mutation werden mit Hilfe des Qiafilter Plasmid MaxiTM-Kits der Fa. Qiagen oder einer ähnlichen Methode expandiert, um Plasmid-DNA im Mikrogrammbereich je Mikroliter für die Transfektionen zur Verfügung zu haben.

2. Virusfreisetzung

Die Transfektion der insgesamt 8 Plasmidkonstrukte inklusive dem mutierten Plasmid pHW 184-HA erfolgt exakt nach der Methode von Hoffmann et al., PNAS, Vo1.97, 6108–6113, 2000.

3. Virusvermehrung in Zellkultur

Die Virusvermehrung in Zellkultur erfolgt in Gegenwart von Protease, hier beispielsweise Elastase aus Pankreas vom Schwein (Fa. Serva Electrophoresis GmbH, Heidelberg, Deutschland), modifiziert nach Klenk et al. (Virology Vol. 8: 426–439 (1975) indem statt Trypsin im Überstand Elastase (5 &mgr;g/ml) eingesetzt wird unter Verwendung geeigneter Zellen. Auch eine Vermehrung der Elastase-Viren im Ei unter Zugabe von Elastase (5 &mgr;g/ml) ist möglich (Orlich et al., Journal of General Virology Vol: 76: 625–633 (1995).

Neben der primären Einführung der Protease-Mutation führt eine Kombination mit weiteren attenuierenden, so z.B. temperatursensitiven Mutationen zur Herstellung eines mehrfach attenuierten Virus. Um ein solches Virus zu erzeugen, wird der Zellkultur bei einer entsprechend reduzierten Temperatur zusätzlich Protease, im besonderen Elastase zugesetzt.

Der Fachmann kennt viele Entsprechungen oder kann diese mit Hilfe üblicher Experimente zu den spezifischen Anwendungen der hier beschriebenen Erfindung feststellen. Solche Entsprechungen liegen beabsichtigterweise im ahmen der folgenden Ansprüche.


Anspruch[de]
  1. Verfahren zur Herstellung eines attenuierten, rekombinanten Influenza-Virus, gekennzeichnet durch die Schritte

    a) Bereitstellen des aktuellen epidemischen Wildtyp-Influenza-Virus

    b) Isolierung des Gensegmentes für HA

    c) Mutagenese einer Nukleinsäure-Sequenz, die ein HA-Spaltmotiv darstellt

    d) Transfektion von 8 Plasmidkonstrukten

    e) Virusfreisetzung

    f) Virusvermehrung in Zellkultur in Gegenwart von Protease, beispielsweise Elastase
  2. Verfahren gemäß Anspruch 1, gekennzeichnet dadurch dass die Mutagenese des HA-Spaltmotives im Wildtyp-Influenza-Virus aus einer Insertion einer Nukleinsäure-Sequenz, die eine künstliche proteolytische Schnittstelle für eine Protease codiert besteht, wobei die künstliche proteolytische Schnittstelle für eine Protease so inseriert ist, so dass das virale monobasische oder polybasische HA-Spaltmotiv zerstört wird.
  3. Verfahren gemäß Anspruch 1, gekennzeichnet dadurch dass künstliche proteolytische Schnittstelle für eine Protease eine Schnittstelle für Elastase, Thermolysin oder TEV-Protease ist.
  4. Verfahren gemäß Anspruch 1, gekennzeichnet dadurch dass die Mutation des HA-Spaltmotives im Wildtyp-Influenza-Virus die Aminosäure Arginin im kodierenden Bereich des HA-Gens betrifft.
  5. Verfahren gemäß Anspruch 1, gekennzeichnet dadurch dass die Mutation des HA-Spaltmotives im Wildtyp-Influenza-Virus eine Substitution der Aminosäure Arginin gegen Valin ist.

    Verfahren gemäß Anspruch 1 zur Mutagenese des HA-Spaltmotives im Wildtyp-Influenza-Virus, gekennzeichnet durch zwei mutagene Primer in der PCR-Reaktion

    M1F-o: CCCATCCATTCAATACGTAGGTCTATTTGGAGCCA

    M1Re: TGGCTCCAAATAGACCTACGTATTGAATGGATGGG
  6. Verfahren gemäß Anspruch 1, gekennzeichnet dadurch dass die Virusvermehrung in Zellkultur in Gegenwart von Elastase, Thermolysin oder TEV-Protease erfolgt
  7. Attenuiertes Influenza-Virus, hergestellt nach einem Verfahren gemäß Anspruch 1, gekennzeichnet dadurch, dass

    a) es das Genom des Ausgangsvirus enthält und

    b) eine Nukleinsäure-Sequenz, die eine künstliche proteolytische Schnittstelle für eine Protease codiert,

    wobei (b) an einer Stelle im Genom des Ausgangsvirus inseriert ist, so dass das virale HA-Spaltmotiv unterbrochen ist und eine Aktivierung des HA unterbunden ist.
  8. Attenuiertes Influenza-Virus, gemäß Anspruch 8, gekennzeichnet dadurch, dass

    a) es das Genom des Ausgangsvirus enthält und

    b) eine Nukleinsäure-Sequenz, die eine künstliche proteolytische Schnittstelle für eine zelluläre TEV Protease, für Thermolysin oder insbesondere Elastase codiert,

    wobei (b) an einer Stelle im Genom des Ausgangsvirus inseriert ist, so dass das virale NA-Spaltmotiv unterbrochen ist und eine Aktivierung des HA unterbunden ist.
  9. Attenuiertes Influenza-Virus, nach einem der Ansprüche 8 und 9, gekennzeichnet dadurch, dass das Genom des Ausgangsvirus ein Genom des aktuellen epidemischen Influenza-Virusstammes oder ein Derivat davon ist.
  10. Attenuierte Influenza-Viren gemäß der Ansprüche 8 bis 10 zur Verwendung als einen Impfstoff.
  11. Impfstoffzusammensetzung, die ein attenuiertes rekombinantes Influenza-Virus gemäß der Ansprüche 8 bis 11 umfasst und einen physiologisch geeigneten Träger.
  12. Verwendung von attenuierten Influenza-Viren gemäß der Ansprüche 8 bis 12 zur Immunisierung eines Patienten gegen das Influenza-Virus.
  13. Verwendung von attenuierten Influenza-Viren gemäß der Ansprüche 8 bis 13 zur Immunisierung insbesondere von Kindern, älteren Menschen und Immundefizienten Personen.
Es folgen 7 Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com