Warning: fopen(111data/log202009200424.log): failed to open stream: No space left on device in /home/pde321/public_html/header.php on line 107

Warning: flock() expects parameter 1 to be resource, boolean given in /home/pde321/public_html/header.php on line 108

Warning: fclose() expects parameter 1 to be resource, boolean given in /home/pde321/public_html/header.php on line 113
VERÄNDERTE, KLEINE RNA-VIREN - Dokument DE69728447T2
 
PatentDe  


Dokumentenidentifikation DE69728447T2 05.01.2005
EP-Veröffentlichungsnummer 0001015560
Titel VERÄNDERTE, KLEINE RNA-VIREN
Anmelder Commonwealth Scientific and Industrial Research Organisation, Campbell, AU
Erfinder GORDON, Heinrich, Karl, Weston, AU;
HANZLIK, Nelson, Terry, Chapman, AU
Vertreter Uexküll & Stolberg, 22607 Hamburg
DE-Aktenzeichen 69728447
Vertragsstaaten AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 02.06.1997
EP-Aktenzeichen 979236692
WO-Anmeldetag 02.06.1997
PCT-Aktenzeichen PCT/AU97/00349
WO-Veröffentlichungsnummer 0097046666
WO-Veröffentlichungsdatum 11.12.1997
EP-Offenlegungsdatum 05.07.2000
EP date of grant 31.03.2004
Veröffentlichungstag im Patentblatt 05.01.2005
IPC-Hauptklasse C12N 7/00
IPC-Nebenklasse C12N 7/01   C12N 7/04   C12N 15/33   A61K 39/12   A61K 39/125   A01N 63/00   C07K 14/08   C12N 15/86   

Beschreibung[de]
Gebiet der Erfindung

Die vorliegende Erfindung betrifft kleine RNA-Viren und virusartige Partikel (VLPs) mit veränderten oder ersetzten Ig-ähnlichen Domänen, um den Wirtszelltropismus, oder anders ausgedrückt, die Spezifität von Wirtszellbindung und Wirtszellinfektion, zu modifizieren. Die Erfindung betrifft auch die Verwendung von solchen kleinen RNA-Viren und VLPs für Anwendungen in der Insektenbekämpfung und in der Medizin.

Allgemeiner Stand der Technik

Zu den offiziell anerkannten kleinen RNA-Viren zählen Mitglieder der Picornaviridae, die Nodaviridae und die Tetraviridae. Es existieren jedoch viele nicht anerkannte Insektenviren, die ebenfalls zu dieser Gruppe zählen. Bei den Tetraviridae handelt es sich um eine Familie von kleinen isometrischen Insektenviren mit nackten, ikosaedrischen Capsiden mit einem Durchmesser von 35–41 nm und Genomen aus einzelsträngiger RNA in positiver Orientierung (ss + RNA). Bis jetzt haben Virologen ihnen nicht viel Beachtung geschenkt. Erwiesen ist, daß sich ihr bekannter Wirtsbereich lediglich auf einige wenige Mottenfamilien in einer einzigen Insektenordnung, den Lepidoptera (Schmetterlinge und Motten) erstreckt, was bedeutet, daß sie die einzige Familie an kleinen RNA-Viren sind, die sich auf Insekten als Wirte beschränken. Obwohl sie offenbar mehrere ihrer Wirte, bei denen es sich um wichtige Schädlingsinsekten handelt, wirksam bekämpfen, wurden sie diesbezüglich wenig verwendet. Dadurch, daß es an einem Zellkultursystem bzw. bis vor kurzem an einer verläßlichen Methode zur Gewinnung des Virus aus Insekten aus Laborzuchten fehlte, mußte man sich mit sporadisch verfügbarem Feldmaterial behelfen, dessen Qualität ungewiß war. Dieses Problem war so ausgeprägt, daß es sich erst in jüngster Zeit herausstellte, daß eigentlich zwei Gruppen von Tetraviren existieren, nämlich Nudaurelia-&bgr;-ähnliche Viren mit einem einteiligen Genom von ungefähr 6 kb und Nudaurelia-&ohgr;-ähnliche Viren mit einem zweiteiligen Genom, das ss-RNAs mit einer Größe von 5,3 bzw. 2,5 kb umfaßt. Es ist lediglich die Existenz von zwei bekannten Nudaurelia-&ohgr;-ähnlichen Viren bekannt. Das vollständige Genom eines Mitglieds (Helicoverpa armigera stunt virus – HaSV) ist bereits von den Erfindern der vorliegenden Erfindung sequenziert worden. Das andere Mitglied ist das Nudaurelia-&ohgr;-Virus [N&ohgr;V], das teilweise sequenziert wurde.

Einer der interessantesten Aspekte beim Befall durch Tetraviren ist, daß sie offenbar nur einen einzigen Gewebetyp infizieren, der bei HaSV der Mitteldarm ist. Die Erfinder der vorliegenden Erfindung zeigten in einem maßgeblichen Experiment, bei dem die Spezifität des HaSV besonders hervorgehoben wird, daß auch dann Spezifität für den Mitteldarm herrschte, wenn das Virus in das Hämocoel von Larven injiziert wurde, wobei Nichtmitteldarmzellen des Wirts, die normalerweise keinen Kontakt mit dem HaSV haben, mit dem Virus in Kontakt kamen. Das Vorhandensein von Virus wurde mit klonierten cDNA-Sonden überprüft, und zwar anhand von Northern-Blots von RNA, die aus dem Mitteldarm und dem Rest des Kadavers von drei Larvengruppen, nämlich einer mit HaSV injizierten Gruppe, einer Gruppe, der HaSV verfüttert worden war, und nichtinfizierten Kontrollen, extrahiert worden war. Ein positives Signal wurde ledigich bei Mitteldarm-RNA der beiden mit HaSV behandelten Larvengruppen beobachtet.

Ein weiterer Beweis für die spezifische Bindung von HaSV-Partikeln an einen bestimmten Zelltyp ergibt sich aus einer genauen Überprüfung von mit HaSV infizierten H. armigera-Larven. Verschiedene Quer- und Sagittalschnitte von infizierten Larven wurden mit der empfindlichen immunhistochemischen Technik der Immungoldfärbung mit Silberverstärkung verwendet. Schnitte aus dieser Reihe wurden auch unter dem Elektronenmikroskop untersucht. Trotz genauester Untersuchung der Gewebe aus Vorderdarm-, Fett-, Körper-, Speicheldrüsen- und Gehirngewebe wurde eine Färbung nur in Mitteldarmzellen beobachtet. Es wurde gefunden, daß beide Arten der differenzierten Mitteldarmzellen, nämlich die Säulen- und Becherzellen, sowie die viel kleineren, nicht differenzierten Regenerationszellen an der Basalmembran infiziert waren. Obwohl herausgefunden wurde, daß alle diese Mitteldarmzellen infiziert waren, ergab die Analyse der Virusbindung an Zellen in Schnitten von in Wachs eingebettetem Mitteldarm, daß nur Becherzellen und nicht Säulenzellen das primäre Ziel der HaSV-Bindung darstellten.

Die beiden bekannten &ohgr;-ähnlichen Viren weisen starke Sequenzidentität auf. Das heißt, daß die Aminosäuresequenzen der Hüllproteine der beiden &ohgr;-ähnlichen Viren eine Identität von insgesamt 67% (Ähnlichkeit: 76%) aufweisen. Dieser Vergleich definierte vier Domänen in dem Hüll-(Capsid-)Protein mit zwei Regionen hoher Homologie (ungefähr 80% Identität und mit beträchtlichen Sequenzabschnitten, in denen eine Identität von über 95% erreicht wird) (Hanzlik et al., 1995). Eine aminoterminale Domäne mit 49 Resten weist niedrigere Homologie auf; dies ist auch bei einer Sequenz mit 165 Resten, die sich ungefähr in der Mitte der Sequenz befindet und 33% Identität aufweist, der Fall. Überraschenderweise spiegelt sich die hohe Sequenzidentität insgesamt nicht in einer nachweisbaren serologischen Beziehung wider, was darauf schließen läßt, daß die zentrale Domäne mit der niedrigen Sequenzhomologie als einziger immunogener Teil des intakten Virions auf der Capsidoberfläche präsentiert wird. Diese Region ist für die unterschiedlichen Wirtsspezifitäten der beiden Viren verantwortlich, wie zuerst von Hanzlik et al. (1995) vorgeschlagen wurde.

Von den Erfindern der vorliegenden Erfindung wurde nun überraschenderweise festgestellt, daß die zentrale HaSV-Domäne (die den Resten 287 bis 416 entspricht) eine Struktur ausbildet, die zu der Immunglobulin-(Ig-) Superfamilie gehört. Zu weiteren Proteindomänen, deren Strukturen eine Ig-ähnlich Faltung aufweisen, zählen die variablen (V) und die konstanten (C) Domänen, die auf Antikörpern vorhanden sind (z. B. das Fab-Fragment von IgGs), die HLA-Oberflächenantigene des MHC-Komplexes sowie Zelladhäsionsproteine und -Rezeptoren (z. B. der von HIV gp 120 erkannte CD4-Rezeptor). Die Vermittlung der Adhäsion von Zellen an andere Zellen oder die extrazelluläre Matrix, die diese Proteine verursachen, spielt für die Entwicklung, Differenzierung, Immunreaktion sowie für die Gewebestruktur und -heilung eine wesentliche Rolle. Viele dieser Proteine werden auch von Viren als Rezeptoren verwendet (Lentz (1990)).

In jüngeren Untersuchungen, die auf Zelladhäsionsassays und der Analyse von auf Platten haftenden künstlichen Lipid-Doppelschichten beruhen, wurde die Grundlage für die Zelladhäsion aufgeklärt, die durch die Bindung von Oberflächenproteinen verstärkt wird. Ein Beispiel für diese Untersuchungen sind die Arbeiten, die sich mit der Bindung zwischen MHC-Klasse II- und CD4-Proteinen, die die Adhäsion von antigenpräsentierenden Zellen (APCs) und CD4+ T-Zellen bei der Immunreaktion vermitteln, befassen. Die MHC-Klasse-II-spezifische Proliferationsreaktion von T-Zell-Klonen (Hussey et al., 1988) bzw. die Bindung von MHC-Klasse-II+-B-Zellen an CD4-transfizierte COS-7-Zellen wird in Zelladhäsionsassays von löslichem (monomerem) CD4 (sCD4) nicht inhibiert, nicht einmal bei einer Konzentration von 100 &mgr;m (Sakihama et al., 1995a). Dies legt den Schluß nahe, daß die Affinität von monomerem sCD4 für die MHC-Klasse-II-Proteine > 10–4 M beträgt. Es wurde nun gezeigt, daß für eine stabile Bindung an MHC-Klasse-II-Proteine eine Oligomerisierung von CD4-Molekülen an der Oberfläche von CD4+-Zellen erforderlich ist, und zwar dadurch, daß die Avidität der Wechselwirkung zwischen diesen Zelladhäsionsproteinmolekülen erhöht wird (Sakihama et al., 1995 a, b). Die Oligomerisierung schließt sich an eine zu Beginn stattfindende Wechselwirkung zwischen ein oder zwei CD4-Molekülen und MHC-Klasse-II-Dimeren an. Eine Charakterisierung von CD4-Hybridmolekülen hat gezeigt, daß die membranproximalen Domänen 3 und/oder 4 an der Oligomerisierung beteiligt zu sein scheinen.

Von den Erfindern der vorliegenden Erfindung wurde nun erkannt, daß es der Mangel an Sequenzähnlichkeit zwischen der Ig-ähnlichen Domänen von HaSV und der entsprechenden Domäne von N&ohgr;V ermöglichen könnte, Tetraviruspartikel als ikosaedrische Träger zu verwenden, die veränderte Ig-ähnliche Domänen oder ersetzte Tertiärstrukturen aufweisen können und daher modifizierte Wirtszellbindungsspezifität zeigen.

Die Ig-ähnliche Domäne bildet einen ausgeprägten Vorsprung, der entweder mit praktisch 3fach oder ikosaedrisch 3fach verwandten Untereinheiten an der Oberfläche des Tetraviruscapsids interagiert. Die Ikosaederpartikel weisen daher eine definierte oligomere Form der Ig-ähnlichen Domäne auf, die wahrscheinlich (analog zur Bindung zwischen CD4- und MHC-Klasse-II-Oligomeren) eine stabile Bindung des gesamten Capsids an den Zelloberflächenrezeptor ermöglicht. Diese Annahme wird von den Ergebnissen von Weber und Karjalainen (1993) gestützt; diese Autoren berichteten, daß ein lösliches pentameres Immunfusionskonstrukt aus Maus-CD4 und Human-C&mgr; die Wechselwirkung zwischen polymergebundenen B-Zellen und sCD4-Zellen der Maus verhindern konnten, während ein lösliches monomeres Immunfusionskonstrukt aus Maus-CD4 und Maus-C&kgr; dazu nicht im Stande war.

Beschreibung der Erfindung

In einem ersten Aspekt stellt die vorliegende Erfindung daher ein isoliertes, kleines RNA-Virus eines Typs bereit, der eine Ig-ähnliche Domäne innerhalb des/r Wildtyp-Hüllproteins/e aufweist, wobei die Ig-ähnliche Domäne verändert oder substituiert wurde, um so den Wirtszelltropismus zu modifizieren.

Unter „Ig-ähnlicher Domäne" wird eine ausgeprägte strukturelle Domäne verstanden, die eine Kernstruktur mit sieben bis neun antiparallelen &bgr;-Strängen, die eine faßähnliche („barrel-like") Form bilden. Da sich jedoch keine Wasserstoffbrückenbindungen um dieses Faß („Barrel") erstrecken, existieren praktisch zwei getrennte &bgr;-Faltblätter und es handelt sich bei der Faltung physikalisch um ein &bgr;-Sandwich (Bork et al. 1994). Manche Ig-ähnliche Domänen, die von dieser Definition umfaßt sind (wie die Tetravirus-Ig-ähnliche Domäne), können zusätzlich noch &bgr;-Stränge außerhalb der Kernstruktur aufweisen.

Unter „Wirtszelltropismus" wird die Fähigkeit von Viren (und der wie nachfolgend beschriebenen virusähnlichen Partikeln (VLPs)) verstanden, an bestimmte Zellpopulationen innerhalb eines Organismus zu binden, in diese einzudringen und mit der Infektion zu beginnen.

Vorzugsweise wird die Ig-ähnliche Domäne so verändert, daß das Virus selektiv einen vorgegebenen Zelltyp bindet und befällt, bei dem es sich nicht um den/die normalen Wirtszelltyp/en des Virus handelt. Mit einer solchen Zielsteuerung („targeting") lassen sich z. B. die insektiziden Eigenschaften des kleinen RNA-Virus bei der Bekämpfung von Schädlingsinsekten außerhalb des normalen Wirtsspeziesbereichs verwenden. Erfindungsgemäße kleine RNA-Viren könnten daher vielversprechende Insektizide darstellen.

Obwohl die Erfindung besonders in bezug auf Tetraviridae beschrieben wird, wird angenommen, daß auch andere kleine RNA-Viren Ig-ähnliche Domänen aufweisen. Das kleine RNA-Virus gemäß dem ersten Aspekt ist daher aus den Mitgliedern der Picornaviridae, den Nodaviridae und den Tetraviridae ausgewählt. Vorzugsweise handelt es sich bei dem kleinen RNA-Virus um ein Mitglied der Tetraviridae-Familie, wie ein Nudauvrelia-&bgr;-ähnliches Virus (insbesondere N&bgr;V). Stärker bevorzugt handelt es sich bei dem kleinen RNA-Virus um ein Mitglied der Gattung der Nudaurelia-&ohgr;-ähnlichen Viren. Am stärksten bevorzugt wird das kleine RNA-Virus aus Helicoverpa armigera stunt virus (HaSV) und Nudaurelia &ohgr;-Virus (N&ohgr;V) ausgewählt.

Die Ig-ähnliche Domäne des HaSV-Wildtyp-Hüllproteins (p71) befindet sich an den Resten 281 bis 414 der in 1 dargestellten Aminosäuresequenz. Die Ig-ähnliche Domäne des N&bgr;V-Wildtyp-Hüllproteins befindet sich innerhalb der Reste 285 bis 433 der 634 Aminosäuren langen Sequenz, die in 2 dargestellt ist. Die Ig-ähnliche Domäne des N&ohgr;V-Wildtyp-Hüllproteins befindet sich an den Resten 280 bis 413 der von Agrawal und Johnson (1995) beschriebenen Sequenz.

Veränderungen oder Substitutionen der Ig-ähnlichen Domäne lassen sich dadurch erzielen, daß man das/die Wildtyp-Hüllproteingen(e) durch (ein) Hybridgen(e) ersetzt, die Nukleotidsequenzen einschließen, die für die gesamten oder für einen funktionellen Abschnitte) der Ig-ähnlichen Domänen codieren, die von anderen als den oben genannten Proteinen abgeleitet sind. Der Ausdruck „funktionelle(r) Abschnitt(e)" bedeutet in diesem Zusammenhang (einen) Abschnitte) von Ig-ähnlichen Domänen, die dem kleinen RNA-Virus noch ermöglichen, eine oder mehrere Zelltypen spezifisch zu binden und zu befallen.

Für die Zielsteuerung des kleinen RNA-Virus an Zelltypen von Schädlingsinsekten außerhalb des normalen Wirtsspeziesbereichs kann das Hybridgen bzw. können die Hybridgene Nukleotidsequenzen einschließen, die für die gesamten oder für (einen) funktionelle(n) Abschnitt(e) der variablen (V) oder konstanten (C) Domänen von Antikörpern codieren, die für Darmzelltypen des als Ziel dienenden Schädlingsinsekts spezifisch sind. Das Hybridgen bzw. die Hybridgene kann/können jedoch auch Nukleotidsequenzen einschließen, die für die gesamten oder für (einen) funktionelle(n) Abschnitte) der Ig-ähnlichen Domänen codieren, die von Proteinen, die an der Zelladhäsion beteiligt sind oder von monoklonalen Antikörpern, die für Zellenoberflächenepitope spezifisch sind, abgeleitet sind.

Obwohl die Ig-ähnliche Domäne vorzugsweise unter Verwendung von Nukleotidsequenzen, die für Ig-ähnliche Domänen oder deren funktionelle(n) Abschnitte) codieren, die von anderen Proteinen abgeleitet sind, verändert oder ersetzt wird, muß betont werden, daß die Erfindung eine Veränderung und Ersetzung der Ig-ähnlichen Domäne unter Verwendung von Nukleotidsequenzen, die für nicht-Ig-ähnliche Tertiärstrukturen codieren, vorsieht, um eine günstige Modifikation des Wirtszelltropismus zu erzielen. So kann die Ig-ähnliche Domäne z. B. durch Zufügen von bzw. durch Ersatz gegen eine Peptidschleife (wie sie z. B. auf dem Hüllprotein von Nodaviren vorliegen), ein kleines Protein oder Lectin verändert werden.

Geeignete Veränderungen der Ig-ähnlichen Domäne könnten auch durch Techniken wie der ortsgerichteten Mutagenese des Wildtyp-Hüllproteingens bzw. der Wildtyp-Hüllproteingene erzielt werden.

In einem zweiten Aspekt stellt die vorliegende Erfindung ein Verfahren zur Bekämpfung der Proliferation eines Schädlingsinsekts bereit, bei dem ein mit dem Schädlingsinsekt befallener Bereich mit einem kleinen RNA-Virus gemäß dem ersten Aspekt, gegebenenfalls unter Beimischung eines landwirtschaftlich akzeptablen Trägers, behandelt wird.

Die Hüllproteine von sowohl N&ohgr;V als auch von HaSV können bei Expression in einem Baculovirus-Expressionssystem virusähnliche Partikel (VLPs) bilden. Die Ergebnisse der Erfinder der vorliegenden Erfindung bieten daher die Möglichkeit, VLPs als spezifische Abgabemittel für z. B. Nukleinsäuremoleküle herzustellen. Diese VLPs können sich daher als Insektizide oder als Mittel für die Abgabe von spezifischen Genen, z. B. für die Gentherapie, eignen. Die Herstellung von VLPs von kleinen RNA-Viren wird in der Internationalen Patentanmeldung Nr. PCT/AU93/00411 diskutiert.

Die Eigenschaften der HaSV-VLPs sind den Eigenschaften von HaSV-Virionen sehr ähnlich. Dazu zählen Widerstandsvermögen gegen proteolytischen Abbau, Auftrieb in CsCL-Lösungen, Morphologie und Abmessungen, die Fähigkeit, eingekapselte RNA gegen Abbau zu schützen, sowie Affinität für den H. armigera-Darmzellenrezeptor für HaSV. Diese letztgenannte Eigenschaft wurde durch die Beobachtung nachgewiesen, daß VLPs in Wachsquerschnitten von Larven auf gleiche Weise an Rezeptoren von H. armigera-Darmzellen banden. Dies zeigt, daß VLPs zum Eindrigen in die Zellen und zum Exprimieren von RNAs innerhalb dieser Zellen fähig sein werden.

In einem dritten Aspekt stellt die vorliegende Erfindung daher einen virusähnlichen Partikel (VLP) bereit, der aus Expression eines/von Hüllproteingens/Hüllproteingenen hergestellt ist, das/die von einem kleinen RNA-Virus eines Typs abgeleitet ist/sind, welcher eine Ig-ähnliche Domäne innerhalb des/r Wildtyp-Hüllproteins/e aufweist, wobei das/die Gen/e so verändert wurde/n, daß die Ig-ähnliche Domäne des exprimierten Hüllproteins zum Modifizieren des Wirtszelltropismus verändert oder ersetzt ist.

Vorzugsweise wird das VLP aus Expression eines/von Hüllproteingens/Hüllproteingenen hergestellt, das/die so verändert wurde/n, daß die Ig-ähnliche Domäne des exprimierten Hüllproteins so verändert oder ersetzt wurde, daß das VLP selektiv einen vorgegebenen bzw. vorgegebene Zelltypen bindet und befällt, bei dem/denen es sich nicht um einen/die Wirtszelltypen handelt, den/die das VLP ohne die Veränderung oder Ersetzung der Ig-ähnlichen Domäne seines/sein Hüllproteinproteins/Hüllproteine binden und befallen würde.

Vorzugsweise leitet/leiten sich das Hüllproteingen/die Hüllproteingene von einem Mitglied der Picornaviridae, den Nodaviridae und den Tetraviridae, ab. Vorzugsweise leitet/leiten sich das Gen/die Gene von einem Mitglied der Tetraviridae-Familie, wie dem Nudaurelia-&bgr;-ähnlichen Virus (insbesondere N&bgr;V), ab. Stärker bevorzugt leitet/leiten sich das Gen/die Gene von einem Mitglied der Gattung der Nudaurelia-&ohgr;-ähnlichen Viren ab. Am stärksten bevorzugt leitet/leiten sich das Gen/die Gene vom Helicoverpa armigera Stunt-Virus (HaSV) oder Nudaurelia-&ohgr;-Virus (N&ohgr;V) ab.

Das/die für die Expression des VLP verwendete Hüllprotein(e) kann/können dadurch hergestellt werden, daß man das/die Wildtyp-Hüllproteingen(e) durch (ein) wie oben in bezug auf den ersten Aspekt beschriebene(s) Hybridgen(e) ersetzt.

VLPs gemäß dem dritten Aspekt der vorliegenden Erfindung bieten eine beachtliche Möglichkeit für die spezifische Abgabe von Nukleinsäuremolekülen an einen vorgebenen Zelltypen bzw. an vorgegebene Zelltypen. Als Insektizide kann die Nukleinsäure z. B. für ein Toxin wie Ricin, Neurotoxine, Gelonin und Diphtherietoxine codieren. Bei medizinischen Anwendungen können die Nukleinsäuremoleküle z. B. je nach Bedarf für ein Cytotoxin (z. B. für die Behandlung von Krebs) oder ein anderes Peptid, Polypeptid oder Protein (z. B. für die Gentherapie) codieren.

Obwohl von den Erfindern gelegentlich beobachtet wurde, daß VLPs des HaSV-Hüllproteins niedermolekulare RNA ohne Virussequenzen einkapseln, ist es (wenn sich die VLPs gemäß dem dritten Aspekt für die Abgabe von gewünschten Genen an Zielzellen eignen sollen) vermutlich erforderlich, daß Verkapselungs-(und Replikations-)Signalsequenzen auf der Virus-RNA verwendet werden. Das heißt, es ist vermutlich erforderlich, daß Verkapselungs-(und Replikations-)Signale verwendet werden müssen, um die Produktion von VLPs, die exprimierbare RNA exogenen Ursprungs spezifisch verkapseln und abgeben, zu gestatten, was die Abgabe von gewünschten Aktivitäten an Zielzellen ermöglicht. Dies kann in Form einer mRNA, die bei Translation in der Zielzelle ein funktionelles Protein produzieren soll, oder in Form von Retrovirus- oder Retrotransposon-RNA, die in das Zielzellengenom, von dem aus das Produkt schließlich exprimiert werden wird, eingebaut werden wird, der Fall sein.

Die Möglichkeit, die Ig-ähnliche Domäne von Hüllproteinen kleiner RNA-Viren zu verändern oder zu ersetzen, bietet auch die Möglichkeit der Entwicklung von VLPs, die antigene Tertiärstrukturen aufweisen. Solche VLPs könnten vielversprechende Impfstoffe sein.

Gemäß einem vierten Aspekt stellt die vorliegende Erfindung daher einen Impfstoff bereit, der einen virusähnlichen Partikel (VLP) aufweist, der durch Expression eines/von Hüllproteingens/Hüllproteingenen hergestellt ist, das/die von einem kleinen RNA-Virus eines Typs abgeleitet ist/sind, welcher eine Ig-ähnliche Domäne innerhalb des/r Wildtyp-Hüllproteins/e, wobei das/die Gen/e so verändert wurde/n, daß die Ig-ähnliche Domäne des exprimierten Hüllproteins so verändert oder substituiert ist, daß der VLP ein auf der Oberfläche befindliches Antigen zum Auslösen einer Immunreaktion in einem Wirtsorganismus präsentiert.

Bei dem Antigen kann es sich um ein vollständiges Protein oder um einen antigenen Teil eines Proteins von z. B. einem Virus (z. B. HIV, HCV, CMV) oder von Bakterien (z. B. Mycobakterien, Streptokokkus, Haemophilias) handeln.

Anhand von Untersuchungen, die an Tetravirushüllproteinen und VLPs durchgeführt wurden, wurde von den Erfindern der vorliegenden Erfindung eine einzigartige Gruppe von sechs Eigenschaften bzw. Charakteristika identifiziert, wodurch die Produktion der von der vorliegenden Erfindung vorgesehenen VLPs für die spezifische RNA-Abgabe ermöglicht wird. Diese Charakteristika lassen sich folgendermaßen zusammenfassen:

  • 1. Die Fähigkeit von Tetravirushüllproteinen, bei Expression aus exogenen Expressionssystemen leicht VLPs zu produzieren.
  • 2. Die Fähigkeit von Tetravirus-VLPs, exogene mRNAs, die Viruswerkapselungs-Signalsequenzen einschließen und für Peptide, Polypeptide und Proteine für unterschiedliche Aktivitäten codieren, leicht zu verkapseln.
  • 3. Die Fähigkeit von Tetravirus-VLPs, exogene mRNAs so abgeben zu können, daß die Translation der codierten Peptide, Polypeptide oder Proteine spezifisch in denjenigen Zellen stattfindet, an die die VLPs binden und die von diesen infiziert werden.
  • 4. Bereitstellung einer klar erkennbaren Region innerhalb der Tetravirus-Hüllproteine, die eine für den Wirtszelltropismus verantwortliche Ig-ähnliche Domäne bildet.
  • 5. Die Möglichkeit, die Ig-ähnliche Domäne auf Tetravirus-Hüllproteinen mit anderen Ig-ähnlichen Domänen und Strukturen exogenen Ursprungs zu verändern bzw. sie durch diese zu ersetzen.
  • 6. Die Möglichkeit, Tetravirus-VLPs mit wenig Reaktivität gegenüber dem Immunsystem von Wirbeltieren herzustellen.

Diese Charakteristika sowie die Möglichkeit, VLPs mit spezifischer RNA-Abgabe herzustellen, wird nun nachfolgend anhand der folgenden nicht als Einschränkung aufzufassenden Beispiele und beigelegten Abbildungen beschrieben.

Kurze Beschreibung der Abbildungen

1 zeigt die Nukleotidsequenz einer cDNA, die für RNA-Virus 2 des HaSV-Genoms codiert (die Nukleotidsequenz einer cDNA, die für RNA1 codiert, ist aus der oben angeführten Patentanmeldung Nr. PCT/AU93/00411 ersichtlich). Die putativen Aminosäuresequenzen der Hüllproteine p71 und p17 sind ebenfalls dargestellt. p71 beinhaltet eine Ig-ähnliche Domäne an den Resten G281 bis E414.

2 zeigt die Nukleotidsequenz einer cDNA, die für das RNA-Genom von N&bgr;V codiert. Die putativen Aminosäuresequenzen der codierten Proteine sind ebenfalls dargestellt. Das Hüllprotein (p70) beinhaltet eine Ig-ähnliche Domäne an den Resten P285 bis K433 der 634 Reste lange Sequenz.

BEISPIEL 1 Herstellung von VLPs in exogenen Expressionssystemen

Nach Expression durch exogene Expressionssysteme produzieren die Tetravirus-Hüllproteine leicht VLPs und, was wichtig ist, es findet eine Assemblierung zu RNA-haltigen VLPs unter in-vitro-Bedingungen statt. Die in-vitro-Assemblierung ermöglicht die kostengünstige großtechnische Produktion von VLPs mit mRNAs, die für verschiedene erwünschte Peptide, Polypeptide oder Proteine codieren, darunter für Cytotoxine, von denen man erwarten würde, daß sie aufgrund ihrer Wirtstoxizität die in-vivo-Produktion behindern würden. Die in-vitro-Produktion von VLPs kann bei medizinischen Anwendungen auch deshalb wichtig sein, weil dadurch die strengen Anforderungen bezüglich der Elimination von kontaminierenden Organismen/Faktoren leicht erfüllbar sein müßten.

Die in-vivo-Produktion von Tetravirus-VLPs in eukaryontischen Expressionssystemen wie Baculoviren, Hefe und Pflanzenzellen, wird in der obenerwähnten Internationalen Patentschrift Nr. PCT/AU/93/00411 und bei Hanzlik und Gordon, 1997, beschrieben. Kurz gesagt beinhaltet die Produktion von Tetravirus-VLPs in diesen Systemen die Expression des Hüllproteinvorstufengens (z. B. für HaSV p71 der RNA2) mit einem starken Promoter und die anschließende Aufreinigung der VLPs als – bei HaSV – Virionen oder nach der Vorschrift von Agrawal und Johnson (1995). Zur Produktion von Tetravirus-VLPs unter in-vitro-Bedingungen kann man sich nach Expression der Hüllproteinvorstufe in einem prokaryontischen Wirt wie E. coli des von Yusibov et al. (1996) beschriebenen Verfahrens bedienen.

BEISPIEL 2 Herstellung von HaSV-VLPs, die exogene RNA verkapseln

Die von Tetravirus-Hüllproteinen hergestellten VLPs nehmen leicht exogene mRNAs mit gewissen Virusverkapselungssignalsequenzen auf. Solche mRNAs können verschiedene erwünschte Peptide, Polypeptide und Proteine codieren. Dies kann in dem folgenden Versuch nachgewiesen werden, in dem das Nicht-Virusgen E. coli &bgr;-Glucuronidase (GUS) in HaSV-VLPs eingebracht wird.

HaSV-VLPs, in denen GUS-mRNA vorliegt, können dadurch hergestellt werden, daß man Sf9-Zellen mit zwei rekombinanten Baculoviren unter Verwendung des im Handel erhältlichen Baculovirus-Vektors pFastBac des Bac-to-Bac-Expressionssystems (Gibco-BRL) koinfiziert. Baculovirus 1 wurde dadurch konstruiert, daß man das offene Leseraster (ORF) des p71-Hüllproteins (siehe 1) hinter den Polyhedrinpromotor plazierte. Wenn Baculovirus 1 für sich alleine Sf9-Zellen infiziert, werden VLPs gebildet, die die transkribierten mRNAs des Hüllprotein-ORF selektiv verkapseln. Dies zeigt, daß innerhalb des Hüllprotein-ORF eine Verkapselungssignalsequenz vorliegt. Mit dieser Information wurde Baculovirus 2, das eine GUS-Aktivität exprimierende verkapselbare RNA produzierte, konstruiert.

Baculovirus 2 bzw. pFBGUSp71-Virus wurde dadurch konstruiert, daß man den GUS-ORF (&bgr;-Glucoronidase, Jefferson et al., 1986) zwischen den Hüllprotein-ORF und den Polyhedrinpromotor plazierte, so daß das AUG-Initiationskodon mit der Translation des GUS-ORF anstelle des Hüllprotein-ORF beginnt. Findet während der Baculovirus-Infektion eine Transkription statt, so wird also mRNA produziert, die als GUS exprimiert wird. Diese mRNA weist auch die Verkapselungssignalsequenzen auf, die der hinter den GUS-ORF plazierte HaSV-p71-Hüllprotein-ORF aufweist. Infizieren nun Baculovirus 1 und Baculovirus 2 die gleiche. Zelle, verkapseln von Baculovirus 1 produzierte VLPs selektiv RNAs, die nur den Hüllprotein-ORF enthalten, sowie die RNAs mit dem GUS-ORF, an den sich der Hüllprotein-ORF anschließt.

Die Verkapselung der GUS-mRNA wird durch Northern-Blots von RNA bestätigt, wobei die RNA aus aufgereinigten VLPs, die von mit beiden Baculoviren koinfizierten Sf9-Zellen produziert wurden, extrahiert wurde. Zur Aufreinigung der VLPs werden Sf9-Zellen mit den beiden Viren infiziert, und nach vier Tagen werden die Zellen durch Gefrieren/Tauen sowie Vortex-Mischen in Tris-Puffer (50 mM Tris pH 7,4) mit 0,2% Nonidet P40-Dergens lysiert. Nach 10minütigem Sedimentieren bei 10 000 × g wird der Überstand des Homogenats drei Stunden lang bei 100 000 × g durch ein 10%-Saccharosekissen pelletiert. Das Pellet, das durch Inkubation über Nacht resuspendiert wird, wird direkt auf einen Zentrifugenbecher mit gleichen Volumina 30% und 60% CsCl in Tris-Puffer direkt schichtförmig aufgetragen, wonach 12 Stunden lang bei 200 000 × g zentrifugiert wird. Die opaleszierende Bande wird dann drei Stunden lang bei 100000 × g pelletiert und anschließend wiederum in Tris-Puffer suspendiert. Wird die extrahierte RNA mit einer radioaktiv markierten Nur-GUS-Sonde untersucht, so hybridisiert die RNA der VLPs stark mit einer 4,6 kb-Bande, was die Größe der erwarteten mRNA, die von dem pFBGUSp71-Virus transkribiert wird, darstellt. Diese GUS-RNA-haltigen VLPs binden ebenfalls, ganz ähnlich wie HaSV-Virionen, an H. armigera-Mitteldarmzellen. Dies kann dann beobachtet werden, wenn die Partikel mit Wachsquerschnitten von H. Armigera-Mitteldärmen inkubiert und nach der Vorschrift von Bravo et al. (1992) immunologisch nachgewiesen werden.

Zu alternativen Konstruktionen von Baculovirus 2 könnte folgendes zählen: die gesamte HaSV-RNA2 (1) wird hinter den GUS-ORF plaziert, oder der GUS-ORF wird innerhalb der RNA2 so plaziert, daß sich das AUG-Initiationskodon an der Stelle des AUG-Initiationskodons des p17-ORF oder des p71-ORF befindet.

VLPs, die beinahe jede beliebige mRNA enthalten, lassen sich dadurch in vitro herstellen, daß man zuerst gecappte RNA in vitro mit T7-Polymerase transkribiert und anschließend die Transkripte mit gereinigten Hüllproteinen nach Yusibov (1996) assembliert.

BEISPIEL 3 Abgabe von in HaSV-VLPs verkapselter exogener RNA

Tetravirus-VLPs können verkapselte mRNAs so abgeben, daß sie spezifisch in Zellen, an die sie binden und befallen, translatiert werden. Dieses Phänomen wurde dadurch beobachtet, daß man GUS-mRNA-haltige VLPs, die gemäß Beispiel 2 mit HaSV-p71 hergestellt wurden, an neonatale H. armigera-Larven verfütterte.

Neonatale Larven wurden nach dem Tröpfchenfütterungsverfahren (Hughes and Wood, 1981) mit einer 10%igen Saccharoselösung mit einer GUS-VLPs-Konzentration von 100 &mgr;g/ml (mRNA) gefüttert und anschließend nach drei Stunden bei Raumtemperatur getötet. Elf (11) mit GUS-VLP gefütterte Larven wurden entnommen und getrennt in GUS-Extraktionspuffer (Jefferson et al., 1986) mit 1 mM X-Glucose (50 mM NaHPO4, pH 7,0, 5 mM Dithiothreitol, 1 nM Na2EDTA, 0,1% Triton X-100) homogenisiert. Eine deutliche Blaufärbung, die sich über Nacht in dem Extrakt entwickelte, zeigte das Vorhandensein von GUS an, während ein ähnlicher Extrakt, der von Kontrollarven (11), die mit VLPs ohne GUS-mRNA gefüttert worden waren, erhalten wurde, farblos blieb. Das Ergebnis wurde dadurch bestätigt, daß man den Mitteldarm der neonatalen Larven, an die GUS-mRNR-haltige VLPs verfüttert worden waren, herausschnitt und in X-Gluc-Assaypuffer (2 mM X-Gluc, 50 mM NaHPO4, pH 7,0, 0,1% Triton X-100) legte. Nach Inkubation über Nacht wurde direkt hinter der Stromadealklappe ein blauer Fleck sichtbar, der GUS-aktivität anzeigte. Bei den Kontrollen wurde keine blaue Farbe beobachtet.

BEISPIEL 4 Ersatz der Ig-ähnlichen Domäne von HaSV- und N&ohgr;V-VLPs

Tetravirus-Hüllproteine weisen in der Aminosäuresequenz, die an der Oberfläche des VLP eine Domäne, die für den Wirtszelltropismus verantwortlich ist, bildet, eine klar gekennzeichnete Region auf. Aus Röntgenkristallographie-untersuchungen geht hervor, daß diese Domäne eine immunglobulinähnliche (Ig-ähnliche) Tertiärstruktur aufweist (Munshi et al., 1996). Wie wichtig die Ig-ähnliche Domäne für den Wirtszelltropismus ist, geht aus der folgenden Versuchstätigkeit hervor, mit der bewiesen wird, daß die Ig-ähnliche Domäne von HaSV hochspezifisch an einen Faktor in der Höhlung der Mitteldarmbecherzellen bindet.

H. armigera-Mitteldärme wurden herausgeschnitten und in Wachs eingebettet, und anschließend wurden damit auf übliche Art und Weise Schnitte angefertigt. Gemäß Beispiel 2 hergestellte HaSV-Virionen und GUS-VLPs wurden anschließend 30 Minuten lang mit den Schnitten inkubiert, gewaschen und anschließend histochemisch nach der Methode von Bravo et al. (1992) auf das Vorhandensein von HaSV-Virionen bzw. VLPs untersucht. Die erzielten Ergebnisse zeigten, daß eine spezifische Bindung von HaSV-VLPs nur mit dem Becherzellenfaktor eingegangen wird. An anderen Geweben oder gezüchteten Zellen wird keine Bindung eingegangen. Außerdem gehen HaSV-VLPs keine Bindung mit anderen Schmetterlingsmitteldärmen, wie von Nudaurelia cyntheria capensis oder Galleria melonella, ein.

Die Versuchstätigkeit zeigte auch, daß die Bindung sättigbar ist. Dies wurde dadurch beobachtet, daß man einen Doppelmarkierungsversuch mit HaSV-Virionen und GUS-VLPs, die entsprechend den Herstellerangaben mit Photobiotin (Bresatec) markiert und auf übliche Art und Weise mit Avidinreagentien nachgewiesen wurden, beobachtet. Mit Mitteldarm-Wachsschnitten inkubierte biotinmarkierte Partikel wurden nur dann nachgewiesen, wenn keine 30minütige Vorinkubation mit nichtmarkierten HaSV-VLPs durchgeführt wurde.

Eine weitere Versuchstätigkeit mit dem oben beschriebenen Wachsschnitt-Bindungsassay zeigte, daß die Ig-ähnliche Domäne von HaSV für die Bindungsaktivität verantwortlich ist. Dieser Nachweis wurde dadurch geliefert, daß man hybride Nudaurelia-&ohgr;-Virus (N&ohgr;V)-VLPs mit der Ig-ähnlichen Domäne von HaSV produzierte und so die identische, spezifisch an H. armigera-Mitteldarmbecherzellen bindende Aktivität wie die der HaSV-Virionen und VLPs auf die N&ohgr;V-VLPs übertrug. Außerdem waren die Hybridpartikel dazu im Stande, GUS-mRNA mit der N&ohgr;V-RNA2-Sequenz (Agrawal und Johnson, 1992) auf dem Transkript 3'-seitig des GUS-ORF abzugeben. Dies wurde auch in einem ergänzenden Versuch gezeigt, bei dem HaSV-Hybridpartikel mit der Ig-ähnlichen Domäne von N&ohgr;V eine spezifische Bindung an Nudaurelia-Mitteldärme zeigten, was bei HaSV-VLPs nicht der Fall war.

Die N&ohgr;V-Hybridpartikel mit den Ig-ähnlichen Domänen von HaSV wurden dadurch hergestellt, daß man den N&ohgr;V-Hüllprotein-ORF (Agrawal und Johnson, 1995) in den Baculovirus-Expressionsvektor pFastBac (Gibco-BRL) plazierte, wodurch man pFBWCAP erhielt, und die von Padgett und Sorge (1996) beschriebene nahtlose Klonierung durchführte. Mit dem Primer Omega1 (ATGACTCTTCTCTGTGTGGTGGCGATCGGAGTAAG) und dem Primer Omega2 (AGTACTCTTCAACTACCGCTGCTTCTAATCGCAG) stellte man ein 6,4 kb langes PCR-Fragment aus pFBWCAP mit dem Vektor, der die N- und C-terminalen Regionen des Hüllprotein-ORF vor und nach der Ig-ähnlichen Domäne (von den Resten M1-Q274 und T415-Stop 445) enthielt, her. Auf ähnliche Weise stellte man mittels PCR mit Pfu-Polymerase aus den Primern StuntIgN (AGTACTCTTCGCAGTACGACGTCAGCGAGGCCGAC) und dem Primer StuntIgC (ATGACTCTTCGAGTCTCTAAGAGCGTGTTCCTAAA) ein 428 bp langes Fragment mit den Resten Q277-T420 des HaSV-Hüllproteins her. Beide Fragmente wurden mit Eam 1104 I verdaut und ligiert, wodurch man das Plasmid pFBWIg erhielt. Mit diesem Plasmid wurde dann gemäß dem Hersteller (Gibco-BRL) des Bac-to-Bac-Baculovirusexpressionssystems ein rekombinantes Baculovirus hergestellt. Die entstandenen Hybrid-VLPs wurden nach der zur Herstellung von HaSV-VLPs in Beispiel 2 verwendeten Vorgehensweise von Sf9-Zellen, die mit dem rekombinanten Baculovirus infiziert waren, hergestellt.

BEISPIEL 5 Veränderung der Ig-ähnlichen Domäne von HaSV-VLPs

Die Tetravirus-Ig-ähnliche Domäne kann, ohne daß die Partikelbildung gestört wird, durch andere Strukturen ersetzt werden.

(i) Substitution mit Schleifenstrukturen

Das Ziel dieses Versuchs bestand darin, zu zeigen, daß die für die Ig-ähnliche Domäne von Tetravirus-Hüllproteinen codierende Region durch eine minimale Schleifenstruktur ersetzt werden kann, ohne daß dies die Partikelbildung und RNA-Verkapselung beeinflußt. Solche Schleifen konnten zum Modifizieren des Wirtszelltropismus von VLPs verwendet werden.

Der ORF des HaSV-p71-Hüllproteins wurde dadurch modifiziert, daß man die Ig-ähnliche Domäne zwischen den Resten Q276-T416 entfernte und einen Linker mit fünf SGSGS-Resten einfügte. Dies wurde nach dem Verfahren von Imai et al. (1991) mit den Primern HR2noIgL (CTGCGGTAGGCTAGTCGGGGT) und HR2loop (AGTGGAAGTGGCACTACTCGACCCTCCTCTCGTAGG) durchgeführt, wobei der letztgenannte Primer eine Ankersequenz, die für den SGSGS-Linker codiert, aufweist. Die PCR mit kinasebehandelten Primern wurde an dem Plasmid pFBp71, das den p71-ORF enthielt, durchgeführt, und die Enden des erhaltenen 6,8 kb langen Fragments wurden ligiert, in E. coli transformiert und durchmustert. Mit dem erhaltenen Plasmid pFBHloop wurde mit dem Bac-to-Bac-System (Gibco-BRL) ein rekombinantes Baculovirus hergestellt. Die Partikel wurden wie HaSV-Virionen gereinigt und wiesen die erwarteten Abmessungen bzw. die erwartete Morphologie mit einem Durchmesser von 32–34 nM sowie ein glatteres Erscheinungsbild als nicht modifizierte VLPs auf. Wie aus dem Vorhandensein von RNA auf einem Formaldehyd-RNA-Gel nach der Extraktion von RNA aus den Partikeln hervorgeht, verkapselten auch die Partikel mit modifiziertem p71 RNA.

Das Hloop-Konstrukt kann auch dadurch hergestellt werden, daß man an anderen Stellen des Tetravirus-Hüllproteins eine SGSGS-Schleifendomäne einfügt. So kann z. B. eine SGSGS-Schleife ähnlich wie oben für HR2loop beschrieben zwischen G281 und E414 plaziert werden oder alternativ als Zusatz zu einer der Schleifen der endogenen Ig-ähnlichen Domäne selbst, z. B. D353 und E358.

Vergleicht man die Kristallstrukturen von Nodavirus- und Tetravirus-Hüllproteinen, so wird deutlich, daß Schleifenstrukturen mit großer Wahrscheinlichkeit Tetravirus-VLPs einen vorgegebenen Wirtszelltropismus verleihen (Munshi et al., 1996). Am analogen Bereich der Ig-ähnlichen Domäne des Tetravirus-Hüllproteins weist Nodavirus-Hüllprotein aber eine Pentapeptidschleife mit unterschiedlichen Sequenzen auf (Dasgupta und Sgro, 1989). Ein Ersatz der Tetravirus-Ig-ähnlichen Domäne durch die Pentapeptidschleife ATTFA des Flock House Virus (Wery et al., 1994) verleiht daher mit großer Wahrscheinlichkeit den enstandenen VLPs eine Bindungs- und Eindringaffinität für Drosophila-Zellen ähnlich wie dies bei FHV der Fall ist. Eine andere Möglichkeit zur Modifikation des Wirtszelltropismus von Tetravirus-VLPs besteht darin, die Tripeptid-Sequenz RGD an eine zugängliche Stelle am Hüllprotein zu plazieren. Dies wird mit großer Wahrscheinlichkeit den entstandenen VLPs eine Bindungsaffinität für RGD-Rezeptoren der auf vielen Humanzellen befindlichen Proteinfamilie der Integrine vermitteln (Pierschbacher und Ruoslahti, 1984). Dies kann entweder mit der Nodavirus-ähnlichen Schleifenstruktur durchgeführt werden oder dadurch, daß man eine vorhandene Tripeptid-Sequenz an einen der auf der endogenen Tetravirus-Ig-ähnlichen Domäne befindlichen Schleifen durch RGD ersetzt.

Schleifenstrukturen mit Bindungsaffinität für Zellen mit bestimmten Zelloberflächenepitopen müßten leicht mit stochastischen Verfahren erhältlich sein. Eine dieser Methoden könnte auf der pSKAN-Vorgangsweise (MoBiTec) beruhen, die eine Schleife mit 6–8 Resten, die gewünschte Bindungsaffinität aufweist, mit einem Phasmid-Display-System bereitstellt (Rottgen und Collins, 1995). Ein zweites Verfahren könnte auf der Verwendung des Tetravirus-Hüllproteins selbst beruhen, um VLPs mit variablen Schleifenregionen zu bilden, die dann auf erwünschte Bindungsaffinitäten selektiert werden. Die Gewinnung von VLPs mit einer gewünschten Affinität, die mit diesem zweiten Verfahren produziert werden, wird durch die Tatsache, daß die VLPs die für die erwünschte Schleifenregion codierende mRNA einkapseln, erleichtert. Mit einem Näherungsverfahren lassen sich die VLPs mit der gewünschten Affinität anreichern. Dies kann durch ein Verfahren erreicht werden, das der pSKAN-Vorgehensweise ähnlich ist, jedoch dahingehend modifiziert wird, daß man der Tatsache, daß VLPs nicht replizieren, Rechnung trägt.

Genauer gesagt kann man mit einer veränderten Schleifenversion des HaSV-p71, nämlich pFBHLoop, eine hypervariable Region, die von einem Schleifenprimer abstammt, in die Schleifenregion plazieren. Der Primer HR2noIgL (CTGCGGTAGGCTAGTCGGGGT) kann dann zusammen mit HR2LoopVar (NNNNNNNNNNNNNNNACTCGACCCTCCTCTCGTAGG) für die PCR eines 6,8 kb langen pFBp71-Fragments verwendet werden, das dann mit sich selbst ligiert wird und so eine Reihe von Plasmiden mit p71 mit unterschiedlichen Schleifenregionen hinter dem Polyhedrin-Promotor herzustellen. Mit diesen Plasmiden kann man anschließend Pools von Kolonien mit rekombinanten Baculoviren, die mit dem Bac-to-Bac-System hergestellt wurden, herstellen. Rekombinante Baculoviren könnten dann aus den Pools hergestellt werden und für die Transfektion von Sf9-Zellen verwendet werden. Nach 6 Tagen könnten die Sf9-Zellen mittels Gefrieren/Tauen und Ultraschallbehandlung lysiert werden (0,1% Triton X-100 in Tris-Puffer pH 8,0) und die Partikel durch 1wöchige Inkubation bei 4°C reifen gelassen werden. Das Lysat kann anschließend mit dem gewünschten Liganden oder Oberflächenepitopprotein, der bzw. das an magnetische Perlen gebunden ist, nach Herstellerangaben (Dynal) inkubiert werden. Die gebundenen Partikel werden gründlich, jedoch sanft, gewaschen und die RNA direkt ohne Elution extrahiert. Mit der RNA kann man anschließend eine RT-PCR mit den Primern HR236F5 (AGAAGAAACCAACGGCGT) und HR2R2140 (AGGACGTTGCCTCCGACTTC) durchführen, wodurch man zu einem 1,7 kb langen Fragment gelangt, das mit den Enzymen EcoRI und NotI verdaut und dann mit dem größeren pFBp71-Fragment, das durch Verdauen mit den gleichen beiden Enzymen erhältlich ist und den Rest des HaSV-p71-ORF aufweist, ligiert werden. Mit dem entstandenen Plasmid beginnt man nun einen zweiten Näherungszyklus mit Produktion von rekombinantem Baculovirus/Transfektion/Partikelbindung/RT-PCR/Plasmidpräparation.

Um zu Partikeln mit Schleifen mit Affinität für den erwünschten Oberflächenepitop zu gelangen, wären mindestens drei Zyklen rekombinante Baculovirusproduktion/Transfektion/Partikelbindung/RT-PCR/Plasmidpräparation erforderlich.

(ii) Substitution durch kleine Proteine

Der Zweck dieses Versuchs bestand darin, nachzuweisen, daß kleine Proteine mit einem Molekulargewicht von unter 30 kD in die Ig-ähnliche Domäne von Tetravirus-Hüllproteinen insertiert werden können, so daß bei der Herstellung von VLPs das kleine Protein außen an den Partikeln präsentiert wird. Damit kann nun entweder der Wirtszelltropismus modifiziert werden, oder es können Impfstoffe gegen das Protein hergestellt werden. So wurde z. B. nachgewiesen, daß das 27 kD große Green Fluorescent Protein (GFP) (Prasher et al., 1992) außen an den N&ohgr;V-VLPs präsentiert werden konnte. Dies gelang mit Hilfe einer ähnlichen Verfahrensweise, wie sie in Beispiel 4 für die Einbringung der Ig-ähnlichen Domäne von HaSV in das N&ohgr;V-Hüllprotein beschrieben wurde. Bei der Vorgangsweise bediente man sich der Primer WGFPN (AGTACTCTTCGCAGAGTATGAGTAAAGAGAAGAACTT) und WGFPC (ATGACTCTTCGAGTACTGCCACTTCCACTTTTGTATAGTTCATCCATGCC) für die Durchführung einer PCR mit gfp10-cDNA (Prasher et al., 1992), wodurch man ein 750 bp langes Fragment erhielt, das bei Eam-1104I-Verdau komplementäre Enden in bezug auf das mit Eam 1104I verdaute 6,4 kb lange PCR-Fragment, das mit &ohgr;1 und &ohgr;2 aus pFBWCAP hergestellt wurde, aufwies. Bei gemeinsamer Ligation in pFBWGFP entstand ein N&ohgr;V-Hybrid-Hüllprotein mit der Primärstruktur (N&ohgr;V M1-Q280)-(GFP)-(Linker-Peptid SGSGS)-(N&ohgr;V T415-Stop 445). Mit diesem Plasmid erzeugte man mit dem Bac-to-Bac-System ein rekombinantes Baculovirus.

Das Hybridprotein wurde ähnlich wie pFBWCAP exprimiert, und bei Bestrahlung mit UV-Licht waren fluoreszierende Zellen sichtbar. Bei transmissionselektronenmikroskopischer Untersuchung (TEM) ergaben sich Partikel innerhalb der Zellen, obwohl sich diese bei Aufreinigung als unstabil erwiesen. Wurde jedoch ein Partikel mit einer Kombination von Proteinen, die von pFBWloop-Virus und PFBWGFP-Virus im Verhältnis 3 : 1 produziert wurden, gebildet, so ergab sich ein stabiles VLP, das aufgereinigt werden konnte. Das Virus pFBWloop ist die analoge N&ohgr;V-VLP-Version von Hloop mit der Schleifenstruktur, die auf gleiche Art und Weise hergestellt wurde und bei der die SGSGS-Reste statt der Ig-ähnlichen Domäne von N&ohgr;V eingefügt wurden. Der Partikel wies einen größeren Durchmesser, nämlich 45 nm, auf, und die Morphologie zeigte größere Vorsprünge an der Oberfläche der aufgereinigten Partikel. Es wurde nachgewiesen, daß die Partikel RNA verkapselten.

Der erfolgreiche Nachweis von Tetravirus/GFP-Hybridpartikeln zeigte, daß Proteine von unter 30 kD außen am Tetraviruspartikel präsentiert werden konnten. Weisen solche Proteine Bindungsaffinität für Zelloberflächenproteine auf, dann müßte der Tropismus der VLPs vorbestimmt werden können.

Bei Immunglobulindomänen oder Lektinen handelt es sich um ausgezeichnete Beispiele für solche Proteine, die in die als Ig-ähnliche Domäne vom Tetravirus-Hüllproteinen beschriebene Region insertiert werden könnten. Vor der Insertion der Proteine in den Tetravirus-Hüllprotein-ORF können jedoch gewisse Modifikationen dieser Proteine erforderlich sein, nämlich deshalb, weil das N-terminale Ende und das C-terminale Ende in der Tertiärstruktur des Proteins benachbart sein müssen, da diese Konformation aus der Tertiärstruktur augenscheinlich wird. Diese Konformation ermöglicht es nämlich, die Ig-ähnliche Domäne gegen andere Proteine auszutauschen, und zwar ohne einen umfassenden Umbau, der für die Konformation des Tetravirus-Hüllproteins nachteilig wäre. Proteine, die zu modifizieren sind, um das N- und das C-terminate Ende nebeneinander zu bringen, sind z. B. die Typ-V- und Typ-C-Domänen der Immunglobulin-Superfamilie und Ig-ähnliche Domänen von Antikörpern, wo die N-terminalen Enden von den C-terminalen Enden durch beinahe die Gesamtlänge des Proteins getrennt sind (Bork et al., 1994, Williams und Barclay, 1988). Eine Untersuchung der dreidimensionalen Struktur von Proteinen, die sich möglicherweise für die Insertion in Tetravirus-Hüllproteine eignen, wird zeigen, ob Modifikationen erforderlich sind. Ein Beispiel dafür, wie Proteine mit Ig-ähnlichen Domänen für die Insertion in Tetravirus-Hüllproteine modifiziert werden können, findet sich unten.

(iii) Substitution durch exogene Ig-ähnliche Domänen

Die Verwendung von Proteinmitgliedern der Immunglobulin-Superfamilie ist insbesondere für die Bestimmung von Tropismen für Tetravirus-VLPs erwünscht, da bekannt ist, daß viele dieser Proteine an der Zelloberflächenerkennung (Williams und Barclay, 1988) und an Bindungsvorgängen, wie sie zwischen Antikörpern und ihren jeweiligen Antigenen (Rees et al., 1994), beteiligt sind. Es ist daher wahrscheinlich, daß das Vorhandensein von solchen Proteinen an der äußeren Oberfläche der Tetravirus-VLPs die Bindung der VLPs an die gleichen Zellen, die normalerweise von den Proteinen gebunden werden, verursacht.

Bei den meisten dieser Ig-ähnlichen Proteine befinden sich jedoch das N- und das C-terminale Ende an den gegenüberliegenden Enden der dreidimensionalen Struktur des Proteins, und eine Modifikation des Ig-ähnlichen Proteins ist daher erforderlich, bevor es wie im Abschnitt oben diskutiert in das Tetravirus-Hüllprotein insertiert wird. Die Modifikation kann dadurch erzielt werden, daß man einen 15–20 Reste langen Peptidlinker, der den letzten Rest des Tetravirus-Hüllproteins vor Beginn der Tetravirus-Ig-ähnlichen Domäne mit dem N-terminalen Ende der nominierten, in den Bereich der Tetravirus-Ig-ähnlichen Domäne zu insertierenden Ig-ähnlichen Domäne verbindet. Auf diese Weise ist das N-terminale Ende, das sich normalerweise am nicht-proximalen Ende der Ig-ähnlichen Domäne befinden würde, mit der Oberfläche des Tetravirus-Capsids verbunden. Das C-terminale Ende der nominierten Ig-ähnlichen Domäne wird dann mit dem Rest, der die Tetravirus-Ig-ähnliche Domäne beendet, mittels eines kürzeren Peptidlinkers, der 3–5 Reste umfaßt, verbunden. Für eine optimale Konformation der Ig-ähnlichen Domäne an der VLP-Oberfläche muß die Länge der Linker empirisch bestimmt werden. Bei der Zusammensetzung der Peptidlinker kann es sich nach Bird et al. (1988) um abwechselnde Ser-Gly-Reste in der erforderlichen Länge handeln.

In manchen Fällen können andere Linkerzusammensetzungen besser sein, wie z. B. (Gly 4Ser) 4 (Somia et al., 1995). So wäre z. B. die Konstruktion solch eines hybriden Tetravirus-Hüllproteins, bei dem das N&ohgr;V-Hüllprotein verwendet wird, (N&ohgr;V M1-Q280)-(Linkerpeptid [SerGly]8)-(N-Term.-V-Typ Ig-Domäne-C-Term.)-(Linkerpeptid SerGlySer)-(N&ohgr;V T415-Stop 445).

Ein Beispiel dafür, wie ein V-Typ-Ig in das Tetravirus-Hüllprotein plaziert werden kann, um den Tropismus des VLP für menschliche Zellen mit dem Low-Density-Lipoprotein-Rezeptor zu modifizieren, beruht auf dem Arbeiten von Somia et al. (1995). Ein 400 bp langes Fragment, das die gamma-Ig-Region des C7-Hybridoms enthält, wird mittels PCR ausgehend von pBS(Gly 4Ser) 4 Somia et al. (1995) mit dem Primer GlySer (GGCGGTGGCGGATCGGGCGGT) und GammaC GCCTTTAATTAATGAGGAGAC) hergestellt und mit den Primern HR2noIgL (CTGCGGTAGGCTAGTCGGGGT) und HR2LoopIg (AGTGGCACTACTCGACCCTCCTCTCGTAGG), wobei letzterer über eine Ankersequenz, die für einen SGS-Linker codiert, verfügt, glattendig in das 6,8 kb lange PCR-Fragment von pFBp71 kloniert. Das entstandene Plasmid produziert ein Protein mit der Primärstruktur (HaSV p71 M1-Q276)-(Gly 4Ser) 4-(gamma V-Typ Ig-Domäne)-(SerGlySer)-(HaSV p71 T421-N446), wenn damit mittels des Bac-to-Bac-Systems ein rekombinantes Baculovirus produziert wird. Bei Expression dieses Proteins müßten stabile VLPs, die RNA verkapseln und zur Bindung an QT6-Zellen fähig sind, produziert werden (Somia et al., 1995). Geeignete Ig-ähnliche Domänen mit Bindungsspezifität für gewünschte Zelltypen lassen sich stochastisch mittels Phage-Display-Techniken ableiten (Clackson et al. 1991).

BEISPIEL 6 Herstellung von HaSV-VLPs mit geringer Reaktivität

gegenüber dem Immunsystem von Wirbeltieren: Mit Tetravirus-Hüllproteinen produzierte VLPs können dergestalt sein, daß sie niedrige Reaktivität gegenüber dem Immunsystem von Wirbeltieren aufweisen.

Das menschliche Immunsystem stellt eines der größten Hindernisse für Therapeutika, die auf nukleinsäurehaltigen Partikeln beruhen, dar. Dadurch wird ihre Verwendung auf nur wenige Anlässe eingeschränkt, weil eine Immunreaktion die Partikel neutralisiert, bevor sie in die Zellen eindringen. Hybride Tetravirus-VLPs könnten jedoch dadurch, daß sie für das menschliche Immunsystem „unsichtbar" sind, über ein Mittel verfügen, um diesem Phänomn entgegenzuwirken. Im folgenden beschriebene Versuche zeigen, daß > 98% der Immunogenität von VLPs für das Immunsystem beim Kaninchen und bei der Maus der Tetravirus-Ig-ähnlichen Domäne innewohnt und daß die durchgehende Oberfläche der VLPs (d. h. die von den schleifenartigen Konstrukten des Tetravirus-Hüllproteins erzeugte Oberfläche) wenig bzw. gar keine Immunogenität bei Vorhandensein eines Ig-ähnlichen Charakteristikums an der Oberfläche aufweist. Hieraus läßt sich der Schluß ziehen, daß die Plazierung einer Ig-ähnlichen Domäne humaner Herkunft das menschliche Immunsystem, das auf das Vorhandensein solcher Proteine konditioniert ist, nicht induzieren wird (also ähnlich wie bei einer Bluttransfusion mit unterschiedlichen menschlichen Antikörpern mit human-Ig-ähnlichen Domänen).

Um die Region des Tetravirus-Hüllproteins, die für die Immunogenität des Partikels verantwortlich ist, zu identifizieren, wurde der folgende Versuch durchgeführt. Das Plasmid pT7T2p69 wurde wie von Hanlik et al. (1995) für das Plasmid pT7T2p71 beschrieben konstruiert. Statt jedoch, wie dies bei pT7T2p71 der Fall ist, HaSV-p71 in Bakterien zu exprimieren, exprimierte das Plasmid pT7T2p69 aufgrund einer Leserastermutatioin nach Nukleotid C569, wo ein zusätzliches C insertiert worden war, eine Fusion aus einem Teil von HaSV-p17 (Hanzlik et al., 1995) und dem p71-Hüllprotein. So beinhaltete das produzierte Fusionsprotein M1-P96 von p17 und N70-N646 von p71.

Die für die Ig-ähnliche Domäne von p71 codierende Region wurde nach dem Verfahren von Imai et al. (1991) mittels pFBp71 und den Primern HR2noIgR und HR2noIgL (Sequenzen siehe oben) deletiert. Dadurch wurden die Reste Q280-T418 aus dem erhaltenen Protein, das von dem rekombinanten Baculovirus, das ausgehend von dem Plasmid mit dem Bac-to-Bac-System hergestellt worden war, exprimiert wurde, entfernt. Wurde ein Western-Blot auf zwei verschiedenen Membranen durchgeführt, wobei Anti-p17- bzw. Anti-p71-Antiseren (Hanzlik et al., 1995) einzeln als Sonden verwendet wurden und der Nachweis mittels mit alkalischer Phosphatase induzierter Lumineszenz auf einem Film erfolgte, betrug das Signal des deletierten Proteins, bei dem Anti-p71 als Sonde verwendet wurde, weniger als 2% als das des nicht deletierten Proteins. Eine Normalisierung des Anti-p17-Signals, das unterschiedliche Antigenmengen auf der Membran Rechnung trug, wurde mit dem Signal von p17, das von der Deletion nicht betroffen war, erzielt. Bei zwei unterschiedlichen polyklonalen Kaninchen-Antiseren und drei unterschiedlichen polyklonalen Maus-Antiseren galt, daß die Ig-ähnliche Domäne für > 98% der Immunogenität verantwortlich war. Diese Beobachtung wird von der Beobachtung von Hanzlik et al. (1995) gestützt, die feststellten, daß die Antiseren gegen N&ohgr;V und HaSV trotz > 80% Identität in Regionen des Hüllproteins, mit Ausnahme der Ig-ähnlichen Domäne, die eine Identität von < 35% aufwies, keine Kreuzreaktion eingingen.

Literatur
  • Agrawal, D. K. und Johnson, J. E. (1992), Virology 190, 89–97
  • Agrawal, D. K. und Johnson, J. E. (1995). Virology 207, 89–97.
  • Bird. R. E. und Walker, B. W. (1988) TibTech 9, 132–137.
  • Bork, P., Holm, L., und Sander, C. (1994) J. Mol. Biol. 242, 309–320
  • Bravo, A., Hendrick, K. Jansens, S. und Peferaen, M. (1992). J. of Invert. Pathal. 60, 247–253.
  • Clackson, T., Hoogenboom, H. R., Griffiths, A. D. und Winter, G. (1991) Nature 352, 624–628
  • Dasgupta, R. and Sgro, J-Y. (1989) Nuc. Acids Res. 17, 7525–7526.
  • Hanzlik und Gordon, (1997) Advances in Virus Research (in press)
  • Hanzlik, T. N., Dorrian, S. J., Gordon, K. H. J. und Christian, P. D. (1993). J. Gen. Virol. 74, 1105–1110.
  • Hanzlik, T. N., Dorrian, S. J., Johnson, K. N., Brooks. E. M. und Gordon, K. H. J. (1995). J. Gen. Virol. 76, 799–811.
  • Hughes, P. R. und Wood, H. A. (1981) J. Invert. Pathol. 37, 154–159.
  • Hussey, R. E., Richardson, N. E., Kowalski, M., Brown, N. R., Chang, H.-C., Siliciano, R. F., Dorfman, T., Walker, B., Sodroski, J. & Reinherz, E. L. (1988). Nature 331, 78–81.
  • Imai, Y., Matsushima, Y. Sugimura, T., und Terada, M. (1991) Nuc. Acids Res. 19, 2785.
  • Jeffersan, R. A., Burgess, S. M. und Hirsh, D. (1986) Proc. Natl. Acad. Sci USA 86, 8447–8451.
  • Lentz (1990) J. Gen. Virol. 71, 751–766.
  • Munshi, S., Liljas, L., Cavarelli, J., Bomu, W., McKinney, B., Reddy, V. und Johnson, J. F. (1996). J. Mol. Biol. 261, 1–10.
  • Padgett, K. A. und Sorge, J. A. (1996) Gene 168, 31–35.
  • Prasher, D. C., Eckenrode, V. K. Ward, W. W., Prendergast, F. G. und Cormier, M. J. (1992) Gene 141, 229–233
  • Pierschbacher, M. D. und Ruoslahti, E. (1984) Nature 309, 30–33.
  • Rees. A. R., Staunton, D., Webster, D. M., Searle, S. J., Henry, A. H., Pedersen, J. T. (1994) TibTech 12, 199–206.
  • Rottgen, P., und Collins, J. (1995) Gene 164, 243–250.
  • Sakirhama, T., Smolyar, A. & Reinherz; E. L. (1995a). Proc. Natl. Acad. Sci. USA 92, 6444–6448.
  • Sakihama, T., Smolyar, A. & Reinherz, E. L. (1995b). Immunology Today 16, 581–587.
  • Somia, N. V., Zoppe, M., Verma, I. M. (1995) Proc. Natl. Acad. Sci. USA 92, 7570–7574
  • Weber. S. & Karjalainen, K. (1993). Int. Immunol. 5, 695–698.
  • Williams, A. F. und Barclay, A. N. (1988) Ann. Rev. Immunol. 6, 381–405
  • Yusibov, V. Kumar, A. North, A. Johnson, J. E. und Loesch-Fries, S. (1996) J. Gen Virol. 77, 567–573.

Anspruch[de]
  1. Isoliertes, kleines RNA-Virus eines Typs, welcher eine Ig-ähnliche Domäne innerhalb des/r Wildtyp-Hüllproteins/e aufweist, wobei die Ig-ähnliche Domäne zum Modifizieren des Wirtszellentropismus verändert oder ersetzt wurde.
  2. Isoliertes Virus nach Anspruch 1, bei welchem die Ig-ähnliche Domäne so verändert wurde, dass das Virus selektiv einen vorgegebenen Zelltyp bindet und befällt, bei dem es sich nicht um den/die normalen Wirtszellentyp/en des Virus handelt.
  3. Isoliertes Virus nach Anspruch 2, bei welchem der vorgegebene Zelltyp ein Zelltyp ist, der zu einer Insektenspezies außerhalb des normalen Wirtsspeziesbereich des Virus gehört.
  4. Isoliertes Virus nach einem der vorhergehenden Ansprüche, wobei das Virus aus Picornaviridae, Nodaviridae und Tetraviridae ausgewählt ist.
  5. Isoliertes Virus nach Anspruch 4, wobei das Virus ein Mitglied der Nudaurelia-&bgr;-ähnlichen oder Nudaurelia-&ohgr;-ähnlichen Virusfamilie ist.
  6. Isoliertes Virus nach Anspruch 5, wobei das Virus aus Helicoverpa armigera Stunt-Virus (HaSV), Nudaurelia-&ohgr;-Virus (N&ohgr;V) und Nudaurelia-&bgr;-Virus (N&ohgr;V) ausgewählt ist.
  7. Isoliertes Virus nach einem der Ansprüche 1 bis 6, bei welchem die Ig-ähnliche Domäne durch das Einschließen aller oder eines funktioneller/n Abschnitte/Abschnittes einer Ig-ähnlichen Domäne, welche aus einem exogenen Protein abgeleitet ist, verändert oder ersetzt ist.
  8. Isoliertes Virus nach Anspruch 7, bei welchem die von einem exogenen Protein abgeleitete Ig-ähnliche Domäne aus variablen (V) oder konstanten (C) Domänen von Antikörpern und Ig-ähnlichen Domänen von Zelladhäsionsproteinen und -rezeptoren ausgewählt ist.
  9. Isoliertes Virus nach einem der Ansprüche 1 bis 6, wobei die Ig-ähnliche Domäne durch das Einschließen einer nicht-Ig-ähnlichen Tertiärstruktur verändert oder ersetzt ist.
  10. Isoliertes Virus nach Anspruch 9, wobei die nicht-Ig-ähnliche Tertiärstruktur aus Peptidschleifen, Proteinen von < 30 kDa und Lektinen ausgewählt ist.
  11. Isoliertes Virus nach Anspruch 9 oder 10, wobei die nicht-Ig-ähnliche Tertiärstruktur antigen ist.
  12. Verfahren zum Steuern der Proliferation eines Schädlingsinsekts, welches die Anwendung des kleinen RNA-Virus nach einem der Ansprüche 1 bis 10, gegebenenfalls unter Beimischung eines landwirtschaftlich akzeptablen Trägers, auf einen mit dem Schädlingsinsekt befallenen Bereich aufweist.
  13. Virusähnlicher Partikel (VLP), das aus Expression eines/von Hüllproteingens/Hüllproteingenen hergestellt ist, das/die von einem kleinen RNA-Virus eines Typs abgeleitet ist/sind, welcher eine Ig-ähnliche Domäne innerhalb des/r Wildtyp-Hüllproteins/e aufweist, wobei das/die Gene so verändert wurde/n, dass die Ig-ähnliche Domäne des exprimierten Hüllproteins zum Modifizieren des Wirtszellentropismus verändert oder ersetzt ist.
  14. VLP nach Anspruch 13, bei welchem die Ig-ähnliche Domäne so verändert wurde, dass das Virus selektiv einen vorgegebenen Zelltyp bindet und befällt, bei dem es sich nicht um einen/die Wirtszellentyp/en handelt, welche/n der VLP ohne die Veränderung oder Ersetzung der Ig-ähnlichen Domäne sonst binden und befallen würde.
  15. VLP nach Anspruch 14, wobei der vorgegebene Zelltyp ein Zelltyp ist, der zu einer Insektenspezies gehört.
  16. VLP nach einem der Ansprüche 13 bis 15, wobei das Virus, aus welchem das/die Hüllproteingen/e abgeleitet wird/werden, aus Picornaviridae, Nodaviridae und Tetraviridae ausgewählt ist.
  17. VLP nach Anspruch 16, wobei das Virus ein Mitglied der Nudaurelia-&bgr;-ähnlichen oder Nudaurelia-&ohgr;-ähnlichen Virusfamilie ist.
  18. VLP nach Anspruch 17, wobei das Virus aus Helicoverpa armigera Stunt-Virus (HaSV), Nudaurelia-&ohgr;-Virus (N&ohgr;V) und Nudaurelia-&bgr;-Virus (N&bgr;V) ausgewählt ist.
  19. VLP nach einem der Ansprüche 13 bis 18, bei welchem die Ig-ähnliche Domäne durch das Einschließen aller oder eines funktioneller/n Abschnitte/Abschnittes einer Ig-ähnlichen Domäne, welche aus einem exogenen Protein abgeleitet ist, verändert oder ersetzt ist.
  20. VLP nach Anspruch 19, bei welchem die von einem exogenen Protein abgeleitete Ig-ähnliche Domäne aus variablen (V) oder konstanten (C) Domänen von Antikörpern und Ig-ähnlichen Domänen von Zelladhäsionsproteinen und -rezeptoren ausgewählt ist.
  21. VLP nach einem der Ansprüche 13 bis 18, bei welchem die Ig-ähnliche Domäne durch das Einschließen einer nicht-Ig-ähnlichen Tertiärstruktur verändert oder ersetzt ist.
  22. VLP nach Anspruch 21, bei welchem die nicht-Ig-ähnliche Tertiärstruktur aus Peptidschleifen, Proteinen von < 30 kDa und Lektinen ausgewählt ist.
  23. VLP nach Anspruch 21 oder 22, bei welchem die nicht-Ig-ähnliche Tertiärstruktur antigen ist.
  24. VLP nach einem der Ansprüche 13 bis 22, wobei der VLP ein exogenes Nukleinmolekül einschließt, welches exprimiert wird, wenn der VLP eine Wirtszelle bindet und befällt.
  25. VLP nach Anspruch 24, wobei das exogene Nukleinsäuremolekül insektentötend ist oder ein insektentötendes Toxin codiert.
  26. VLP nach Anspruch 24, wobei das exogene Nukleinsäuremolekül ein Zytotoxin codiert.
  27. Impfstoff, der einen virusähnlichen Partikel (VLP), das aus der Expression eines/von Hüllproteingens/Hüllproteingenen hergestellt ist, das/die von einem kleinen RNA-Virus eines Typs abgeleitet ist/sind, welcher eine Ig-ähnliche Domäne innerhalb des/r Wildtyp-Hüllproteins/e aufweist, wobei das/die Gene so verändert wurde/n, dass die Ig-ähnliche Domäne des exprimierten Hüllproteins so verändert oder ersetzt ist, dass der VLP ein auf der Oberfläche befindliches Antigen zum Auslösen einer Immunreaktion bei einem Wirtsorganismus darstellt.
  28. Impfstoff nach Anspruch 27, bei welchem das Virus, aus welchem das/die Hüllproteingen/e abgeleitet ist/sind, aus Picornaviridae, Nodaviridae und Tetraviridae ausgewählt ist.
  29. Impfstoff nach Anspruch 28, bei welchem das Virus ein Mitglied der Nudaurelia-&bgr;-ähnlichen oder Nudaurelia-&ohgr;-ähnlichen Virusfamilie ist.
  30. Impfstoff nach Anspruch 29, bei welchem das Virus aus Helicoverpa armigera Stunt-Virus (HaSV), Nudaurelia-&ohgr;-Virus (N&ohgr;V) und Nudaurelia-&bgr;-Virus (N&bgr;V) ausgewählt ist.
  31. Impfstoff nach einem der Ansprüche 27 bis 30, bei welchem die Ig-ähnliche Domäne durch das Einschließen einer nicht-Ig-ähnlichen Tertiärstruktur verändert oder ersetzt ist.
  32. Impfstoff nach Anspruch 31, bei welchem die nicht-Ig-ähnliche Tertiärstruktur aus Peptidschleifen, Proteinen von < 30 kDa und Lektinen ausgewählt ist.
Es folgen 11 Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com