PatentDe  


Dokumentenidentifikation DE60018920T2 13.04.2006
EP-Veröffentlichungsnummer 0001181382
Titel REKOMBINANTE ADENOVIRALE VEKTOREN, DIE CHIMÄRE FIBERPROTEINE EXPRIMIEREN, FÜR DIE ZELLSPEZIFISCHE INFEKTION UND GENOMISCHE INTEGRATION
Anmelder University of Washington, Seattle, Wash., US
Erfinder LIEBER, Andre, Seattle, US;
SHAYAKHMETOV, Dmitry, Seattle, US;
FARRAR, Denise, Seattle, US;
PAPAYANNOPOULOU, Thalia, Seattle, US
Vertreter Dr. Volker Vossius, Corinna Vossius, Tilman Vossius, Dr. Martin Grund, Dr. Georg Schnappauf, 81679 München
DE-Aktenzeichen 60018920
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 01.06.2000
EP-Aktenzeichen 009395708
WO-Anmeldetag 01.06.2000
PCT-Aktenzeichen PCT/US00/15442
WO-Veröffentlichungsnummer 0000073478
WO-Veröffentlichungsdatum 07.12.2000
EP-Offenlegungsdatum 27.02.2002
EP date of grant 23.03.2005
Veröffentlichungstag im Patentblatt 13.04.2006
IPC-Hauptklasse C12N 15/861(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 15/864(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/10(2006.01)A, L, I, 20051017, B, H, EP   A61K 48/00(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]

Die Erfindung wurde zumindest teilweise mit Zuwendungen des National Institute of Health (Grant Nr. R01 CA 80192-01 und R21 DK 55590-01) gemacht. Somit hat die Regierung der Vereinigten Staaten gewisse Rechte an dieser Erfindung.

GEBIET DER ERFINDUNG

Die Erfindung bezieht sich auf das Gebiet der Gentherapie, und insbesondere auf neue adenovirale (Ad) Vektoren, die Zellen für die Gentherapie selektiv infizieren, und auf Ad Vektoren, die Modifikationen des Fiberproteins enthalten, um das „Retargeting" eines Serotyps von Adenovirus zu ermöglichen.

HINTERGRUND DER ERFINDUNG

Vektoren für den Gentransfer erfordern die wirksame Transduktion von Zielzellen, die stabile Assoziation mit dem Wirtsgenom, und eine adäquate Expression des Transgens in der geeigneten Zielzelle, ohne gleichzeitige toxische oder immunologische Nebenwirkungen. Gegenwärtig erhältliche virale Vektorsysteme, einschließlich Retroviren, Adenoviren und Adeno-assoziierte Viren, sind für den effizienten Gentransfer in viele Zelltypen nicht geeignet. Retrovirale Vektoren benötigen für die stabile Integration Zellteilung. Rekombinante Adenoviren können viele Zelltypen, die für die Gentherapie wichtig sind, nicht infizieren, einschließlich hämatopoietischer Stammzellen, Monozyten, T- und B-Lymphozyten. Weiterhin integrieren rekombinante Adeno-assoziierte Vektoren (AAV) mit niedriger Frequenz.

Die erste Generation von Adenoviren hat eine Anzahl von Eigenschaften, die sie zu einem attraktiven Vehikel für den Gentransfer machen (Hitt, M.M. et al., 1997, Advances in Pharmacology 40:137-205). Diese umfassen die Fähigkeit, aufgereinigtes Virus mit einem hohen Titer zusammen mit hoch wirksamen Gentransfer von bis zu 8 kb langen Expressionskassetten in eine Vielzahl von Zelltypen in vivo, einschließlich sich nicht teilender Zellen, zu gewährleisten. Die Beschränkungen dieser ersten Generation umfassen die Entstehung von Immunantworten gegen exprimierte virale Proteine, was zu Toxizität und Virus-Clearance führt. Der episomale Status adenoviraler DNA innerhalb von transduzierten Zellen ist eine weitere Beschränkung der Ad Vektoren der ersten Generation. Stabile Integration von Adenovirus DNA in das Wirtsgenom wird nur für Wildtypen spezifischer Subtypen berichtet und scheint nicht in nachweisbarer Weise bei E1/E3-deletierten Ad 5 (Adenovirus Serotyp 5) Vektoren aufzutreten, die häufig für den in vitro und in vivo Gentransfer verwendet werden (Hitt, M.M. et al., 1997, Advances in Phamacology 40:137-205).

Rekombinante AAV Vektoren (rAAV) integrieren mit einer niedrigen Frequenz (etwa 1 aus 20000 Genomen) zufällig als Concatamere in das Wirtsgenom (Rutledge, E.A.; Russel, D.W. 1997, J. Virol 71, 8429-8436). Die Gegenwart von zwei AAV invertierten terminalen repeats (ITRs) und von noch unbekannten zellulären Faktoren des Wirts scheinen das einzige Erfordernis für die Integration des Vektors zu sein (Xiao, X. et al., 1997, J. Virol. 71, 941-948; Balague, C. et al., 1997, J. Virol. 71, 3299-3306; Yang, C.C. 1997, J. Virol. 71, 9231-9247). In Gegenwart des großen AAV Rep Proteins integriert AAV präferentiell in einen spezifischen Ort auf dem menschlichen Chromosom 19, AAVS 1 (Berns, K.I., 1996, Fields Virology, Fields, B.N. et al., (Hrsg), Band 2, Lippincott-Raven, Philadelphia, PA, 2173-2220). Das AAV Kapsid wird aus drei Hüllproteinen (VP1-3) gebildet, die mit spezifischen Heparinsulfaten auf der Zelloberfläche und wahrscheinlich mit einem/mehreren spezifischen Rezeptoren) interagieren. Auf vielen Zelltypen, auch auf hämatopoietischen Stammzellen fehlen diese Strukturen, so dass rAAV Vektoren, die auf AAV2 basieren, diese Zellen weder transduzieren noch infizieren können. (Malik P. et al., 1997, J. Virol., 1971, 1776-1783; Quing, K. Y. et al., 1998, J. Virol 72, 1593-1599). Andere Nachteile von rAAV Vektoren sind die limitierte Insertgröße (4,5-5kb), die in rAAV Vektoren aufgenommen werden kann, in denen ale viralen Gene fehlen und die niedrigen Transduktionstiter von rAAV-Zubereitungen.

Adenovirus-Infektion wird initiiert durch Anheftung von Ad 5 an die Zelloberfläche über das Fiberprotein (siehe Shenk, T. 1996, Fields Virology, Band 2, Fields, B.N. et al. (Hrsg), Band 2, Lippincott-Raven, Philadelphia, PA, 2111-2148). Die distale, C-terminale Domäne des trimeren Fibermoleküls endet in einem „Knob", der an einen spezifischen zellulären Rezeptor bindet, der kürzlich als der Coxsackie-Adenovirusrezeptor (CAR) (Bergelson, J.M. et al. Science, 275, 1320-1323) identifiziert wurde. Nach der Bindung interagieren in einem Ereignis, das von der Virusanheftung unabhängig ist, Arg-Gly-Asp (RGD-Motive) in der Pentonbase mit zellulären Integrinen der &agr;3- und &bgr;5-Typn. Diese Wechselwirkung löst die zelluläre Internalisierung aus, wodurch das Virion eine Lokalisation im Endosom erreicht. Die endosomale Membran wird in einem durch die Pentonbase vermittelten Prozess lysiert, wodurch der Inhalt des Endosoms in das Zytoplasma freigesetzt wird. Während dieser Vorgänge wird das Virion schrittweise enthüllt und die adenovirale DNA wird in den Nukleus transportiert, in dem die Replikation stattfindet. Das terminale Protein, welches kovalent an das virale Genom angeheftet ist und das Kernprotein V, das auf der Oberfläche der Kerne lokalisiert ist, haben Kernlokalisationssignale (NLSs) (van der Vliet, B. 1995, The Molecular Repertoire of Adenoviruses, Band 2, Doerfler W. und Boehm. P. (Hrsg). Springer-Verlag, Berlin 1-31). Diese NLSs spielen eine entscheidende Rolle bei der Ausrichtung des viralen Genoms zum Kern und stellen wahrscheinlich das strukturelle Element dar, das es den Adenoviren ermöglicht, sich nicht teilende Zellen zu transduzieren. Sobald die doppelsträngige, lineare DNA den Nukleus erreicht, bindet sie durch ihr terminales Protein an die nukleäre Matrix.

Da die Zelltypen, die mit Ad5 oder Ad2 Vektoren infiziert werden können, auf die Anwesenheit von CAR und spezifischen Integrinen beschränkt sind, wurden Versuche unternommen, den Tropismus von Ad Vektoren zu erweitern. Die genetische Modifikation von Adenovirushüllproteinen, um auf neue Zelloberflächenrezeptoren ausgerichtet zu sein, wurde für die Fiber- (Krasnykh, V. et al. 1998 J. Virol. 72, 1844-1852, Krasnykh, V. et al., 1996, J. Virol 70, 6839-6846, Stevenson, S.D. et al., 1997, J. Virol. 71, 4782-4790) Penton-Base (Wickham, T.J. et al., 1996, J. Virol. 70, 6831-6838; Whickham, T.J. et al., 1995, Gene Therapy 69, 750-756) und Hexonproteine (Crompton, J. et al., 1994, J. Gen Virol. 75, 133-139) berichtet. Die vielversprechendste Modifikation scheint die funktionelle Modifikation des Fiberproteins oder spezifischer des Fiber-Knob als der Teil zu sein, der die primäre Anheftung vermittelt. Zwei Gruppen haben die Erzeugung von Fibern berichtet, bestehend aus dem Ad5 Schwanz/Schaft und der Knob-Domäne von Ad3 (Krasnykh, V. et al., 1996, supra, Stevenson, S.D. et al., 1997, supra). Kürzlich wurden rekombinante Adenoviren mit Fibern erzeugt, die C-terminales Poly-Lysin, Gastrin-freisetzendes Peptid, Somatostatin, E-Selectinbindendes Peptid oder Oligo-Histidine enthalten, um den nativen Tropismus von Ad5 zu verändern. Krasnikh et al. fanden (Krasnykh, V. et al.1998, supra), dass in den H1 Loop der Fiber Knob-Domäne heterologe Peptidliganden inseriert werden konnten, ohne die biologische Funktion der Fiber zu beeinflussen. Basierend auf Untersuchungen mit anderen Ad Serotypen scheint es, dass die Länge des Fiberschafts ein kritisches Element ist, welches die Effizienz der Wechselwirkung mit den Zelloberflächenintegrinen und den Internalisierungsprozess bestimmt.

US 5,856,152 stellt ein hybrides Adenovirus/AAV virales Partikel bereit, umfassend ein Adenovirus-Kapsid enthaltend ausgewählte Teile einer Adenovirus Sequenz, 5' und 3' ITR Sequenzen, die ein ausgewähltes Transgen unter der Kontrolle eines ausgewählten Promoter und anderen herkömmlichen regulatorischen Bestandteilen flankieren. Diese hybride virale Partikel ist gekennzeichnet durch einen Transgentransport in die Zelle mit hohem Titer und durch die Fähigkeit, das Transgen stabil in das Wirtszellchromosom zu integrieren.

WO 97/38723 stellt adenovirale Vektoren mit einem modifizierten Fiber-Knob bereit, der die Spezifität für den natürlichen Rezeptor verringert. Die Vektoren transfizieren selektierte Zelltypen und treten in Zellen nicht über die Mechanismen ein, die normalerweise den Eintritt des entsprechenden Virus in die Zelle ermöglichen. Die Vektoren der Erfindung haben eine Nukleinsäure, und ein virales Partikel mit einem „targeting"-Liganden. Das Partikel hat im wesentlichen keine funktionelle virale Wildtyp-Zellbindungsstelle. Der targeting Ligand bindet an ein Protein, das auf der Oberfläche einer Zielzelle exprimiert wird, wodurch der Vektor zur Zielzelle orientiert wird. Es gibt bisher keine Daten, die das erfolgreiche „Retargeting" von Ad5 Vektoren für einen spezifischen Zelltyp zeigen.

Somit besteht gegenwärtig ein Bedarf nach einem verbesserten Adenovirusvektor, der wirksam für eine Vielzahl von Zellen und Geweben „getargeted" werden kann und mit minimaler Antigenität im Wirtsgenom stabil integriert verbleibt. Die gegenwärtige Erfindung offenbart neue chimäre adenovirale (Ad) AAV-Vektoren, die auf ihrem Kapsid ein modifiziertes Fiberprotein exprimieren, zum spezifischen Targeting des Vektors. Verfahren zur Herstellung, Verwendung und Vorteile dieser Vektoren werden beschrieben. Zusätzlich stellen die für die Knob- und Schaft-Domäne beschriebenen Änderungen einen neuen Ansatz dar, einen Adenovirus-Serotyp für die zellspezifische Infektion zu „retargeten".

ZUSAMMENFASSUNG DER ERFINDUNG

Die vorliegende Erfindung stellt neue chimäre Ad-Vektoren bereit, die Transgene tragen, oder Teile von Transgenen für den stabilen und wirksamen Gentransfer in verschiedene Zelltypen oder Gewebe in einer von CAR- und/oder &agr;v&bgr;3/5-unabhängigen Weise. Es werden auch Verfahren zur Herstellung solcher Vektoren und deren Verwendung für die Gentherapie zum Behandeln eines spezifischen Zelltyps oder eines Gewebes bereitgestellt.

Insbesondere stellt die vorliegende Erfindung bereit:

einen rekombinanten, doppelsträngigen Adenovirusvektor, wobei der erste Strang umfasst:

  • a. eine linke invertierte terminale Wiederholungssequenz von Adenovirus
  • b. eine Adenovirus-Verpackungssequenz
  • c. eine erste Adenovirus-assoziierte invertierte terminale Wiederholungssequenz
  • d. eine erste invertierte Wiederholungssequenz
  • e. eine heterologe Promotersequenz, die die Transkription in eine Richtung zur adenoviralen linken invertierten terminalen Wiederholungssequenz aus a. steuert
  • f. eine fremde Gensequenz
  • g. eine zweite invertierte Wiederholungssequenz
  • h. eine zweite adeno-assoziierte invertierte terminale Wiederholungssequenz
  • i. eine Nukleotidsequenz, die die Replikation eines Adenovirus in einer transduzierten Zelle steuert; und
  • j. eine adenovirale rechte invertierte terminale Wiederholungssequenz.
und wobei der zweite Strang eine Nukleotidsequenz umfasst, die für ein modifiziertes adenovirales Fiberprotein kodiert, das den Tropfismus des Adenovirus-Vektors ändert, und wobei das modifizierte adenovirale Fiberprotein ein modifizierter Fiber-Knob ist, ein modifizierter Fiberschwanz oder ein modifizierter Fiber-Schaft.

Weiterhin stellt die vorliegende Erfindung einen rekombinanten, doppelsträngigen adenoviralen Vektor bereit, wobei der erste Strang umfasst:

  • a. eine linke invertierte terminale Wiederholungssequenz von Adenovirus
  • b. eine Adenovirus-Verpackungssequenz
  • c. eine erste Adenovirus-assoziierte invertierte terminale Wiederholungssequenz
  • d. eine erste invertierte Wiederholungssequenz
  • e. eine heterologe Promotersequenz, die die Transkription in eine Richtung von der adenoviralen linken invertierten terminalen Wiederholungssequenz aus a. weg steuert
  • f. eine fremde Gensequenz
  • g. eine zweite invertierte Wiederholungssequenz
  • h. eine zweite adeno-assoziierte invertierte terminale Wiederholungssequenz
  • i. eine Nukleotidsequenz, die die Replikation eines Adenovirus in einer transduzierten Zelle steuert; und
  • j. eine adenovirale rechte invertierte terminale Wiederholungssequenz,
und wobei der zweite Strang eine Nukleotidsequenz umfasst, die für ein modifiziertes adenovirales Fiberprotein kodiert, das den Tropfismus des Adenovirusvektor ändert, und wobei das modifizierte adenovirale Fiberprotein ein modifizierter Fiber-Knob ist, ein modifizierter Fiberschwanz oder ein modifizierter Fiber-Schaft.

Die rekombinanten adenoviralen erfindungsgemäßen Vektoren (Beispiel 1) stellen ein neues Design bereit, das die leichte Produktion und den Transport eines „gutless" adenoviralen Vektors ermöglicht, mit dem zusätzlichen Vorteil der stabilen Integration des Transgens in das Wirtsgenom von verschiedenen Zelltypen. Der beschriebene adenovirale Vektor ist frei von alen adenoviralen Sequenzen, abgesehen von den 5' und 3' cis-Elementen, die für die Replikation und die Einkapselung des Virions nötig sind. Die Adenovirus-assoziierten Sequenzen umfassend die 5' (rechts) und 3' (links) invertierten terminalen Wiederholungen (ITRs) flankieren die Transgenkassette in einer solchen Weise, dass sie die homologe Rekombination während der viralen Rekombination und die virale Integration in das Wirtsgenom steuern. In einer Ausführungsform werden AAV-ITR flankierende Sequenzen verwendet. Der Vektor enthält auch ein selektiertes Transgen, das funktionell an ein ausgewähltes regulatorisches Element gekoppelt ist und ein Polyadenylierungs-Stopsignal, das wiederum durch die oben beschriebenen flankierenden Sequenzen flankiert wird. Die ausgewählten Transgene können unter den gleichen regulatorischen Elementen gekoppelt sein oder unter getrennten regulatorischen Elementen in gleicher Orientierung oder in gegenseitig gegensätzlicher Orientierung. Die ausgewählten Transgene sind ein Gen oder Gene, die in einer Wirtszelle oder Gewebe für therapeutische, Reporter- oder Selektionszwecke exprimiert werden. Der Vektor ist durch einen hohen Titer gekennzeichnet, mit dem das Transgen in eine Wirtszelle transportiert wird und durch die Fähigkeit, stabil in das Wirtsgenom zu integrieren. Es wird auch ein Verfahren bereitgestellt zur Verbesserung der Integrationsfrequenz und der ortsspezifischen Integration durch Einbau eines AAV rep Proteins in den rekombinanten hybriden Vektor.

Die Erfindung stellt auch chimäre Fiberproteine bereit (Beispiel II), umfassend natürlicherweise auftretende Fiberproteine, in denen ein Teil oder Teile der Sequenz modifiziert wurden, um die Zell- oder Gewebe-Spezifität der Infektion zu verändern. Veränderte Fiberproteinsequenzen umfassen Fiberprotein Domänen (die Knob-Domäne, die Schaft-Domäne, und die Schwanzdomäne) aus anderen oder aus gleichen Adenovirus-Serotypen oder aus zufällig ausgewählten Peptiden. Die Erfindung bezieht sich weiterhin auf Nukleinsäuresequenzen, die für die chimären Fiberproteine kodieren. Diese Nukleinsäuresequenzen können natürlich auftretende, ein Gemisch aus natürlich und nicht natürlicherweise auftretenden oder komplett nicht natürlicherweise auftretende Sequenzen sein.

Die hier beschriebenen heterologen Fiberproteine können in jeden auf Adenovirus basierenden Vektor inseriert werden, der ein Kapsid enthält, wodurch das Virus in die Lage versetzt wird, eine spezifische gegebene Zelle oder ein Gewebe zu infizieren. Adenovirus Vektoren mit solchen heterologen Fibersequenzen können dazu verwendet werden, Gentransfer in gewünschte Zellen zu dirigieren. Für die stabile Integration der Transgenkassette in das Wirtsgenom wird der hier beschriebene Ad-AAV Vektor bevorzugt verwendet.

Die Erfindung umfasst auch eine Bibliothek von Adenoviren, die zufällige Peptide in ihren Fiber-Knobs aufweisen, die als Ligand verwendet werden können, für eine Adenovirus-Variante mit Tropfismus für einen bestimmten Zelltyp in vitro oder in vivo zu screenen.

Die hier beschriebenen chimären Ad Vektoren umfassen das Ad.AAV Genom mit einem modifizierten Fiberprotein, das auf seinem Kapsid exprimiert wird. Diese chimären Vektoren sind dazu entwickelt, eine Vielzahl von Zellen zu infizieren, insbesondere die Zellen, die durch die herkömmlich verwendeten retroviralen, AAV und adenoviralen Vektoren nur schwach transduziert werden können. Diese Zellen umfassen in nicht beschränkender Weise hämatopoietische Stammzellen, Lungenepithelzellen, dendritische Zellen, lymphoblastoide Zellen und endotheliale Zellen. Hämatopoietische Stammzellen wie CD34+ Zellen können mit dem hier beschriebenen Vektor für die Gentherapie von Sichelzellanämie und Thalassämie „getargeted" werden. Der chimäre Ad-AAV Vektor, der in der Lage ist, Gene in endotheliale Zellen zu transduzieren, kann in der Gentherapie für vaskuläre Erkrankungen wie Arteriosklerose oder Restenose nach koronarer Arterienchirurgie verwendet werden.

KURZE BESCHREIBUNG DER ABBILDUNGEN

1A1C zeigen einen angenommenen Mechanismus zur Bildung des &Dgr;Ad.AAV-Genoms.

2A und 2B zeigen elektronenphotomikroskopische Aufnahmen von hybriden Viruspartikeln: 2A zeigt Ad.AAV1 und 2B zeigt &Dgr;Ad.AAV1

3 veranschaulicht die Analyse von &Dgr;Ad.AAV1 Genomen nach der Transduktion von SKHepl-Zellen. Pulsfeldgelelektrophorese (PFGE). 1 × 106 Kontrollzellen Sk Hep1 Zellen (SKHep1) (Spuren 1–3, 5, 9). SKHep1 Zellen aus G418 resistenten Pools (&Dgr;Ad.AAV1) (infiziert mit &Dgr;Ad.AAV1 und selektiert für 4 Wochen) (Spuren 6–8, 10–– 12), oder SKHep1 Zellen, geerntet 3 Tage nach Infektion mit 2000 Genomen Ad.AAV1 (Ad) Spuren 4–13) werden in Agaroseplatten versiegelt, in situ lysiert und mit oder ohne vorherigen Verdau mit Restriktionsendonukleasen einer PFGE unterzogen. Mit einer für SEAP spezifischen Sonde wird ein Southern Blot durchgeführt. U = unverdaut, P = verdaut mit PI-Sec1, I = I-CeuI, E = EcoRI.

4A und 4B zeigen die Antwort von K562 und CD34+-Zellen nach Infektion mit &Dgr;Ad.AAVBG. Zellen werden für 6 Stunden unter Rühren mit dem Virus inkubiert. Am Tag 3 nach der Infektion wird die Transduktionsfrequenz basierend auf der Anzahl von X-Gal positiven Zellen berechnet. Die Lebensfähigkeit wird durch Trypanblau-Ausschluß berechnet, N=3, SEM< 10%.

5 zeigt die Expression von Rep in SKHep 1 und 293-Zellen nach der Plasmidtransfektion. 5 × 105 Zellen werden mit pAAV/Ad, pRSVrep oder pPGKrep durch Ca-Phosphat-Copräzipitation transfiziert. Drei Tage nach der Transfektion werden die Zellen geerntet. Lysate werden auf einem 10 % PA-Gel aufgetrennt, gefolgt von Western Blot mit Rep-spezifischen Antikörpern (03-65169, American Research Products), und mit ECL entwickelt (Amersham).

6 zeigt den Nachweis der Vektorintegration in AAVS1 durch PFGE.

7 zeigt die Strategie zur Erzeugung eines &Dgr;Ad.AAV Hybrid-Vektors, der zur ortsspezifischen Integration fähig ist. Pfeile stehen für Promotoren, (PA) = Polyadenylierungssignal. &psgr; = adenovirales Verpackungssignal.

8A8B zeigt Vektoren für Transduktionsstudien mit SNOri als Expressionseinheit und die Analyse der Vektorintegration in genomische DNA aus einer kleinen Zellzahl. Analoge Vektorsets können mit &bgr;-Galactosidase (BG) oder grün fluoreszierendem Protein (GFP) als Reportergene erzeugt werden.

9 zeigt die Strategie zum Ersatz der Ad5 Fibersequenz durch die heterologen Fiber X Gene unter Verwendung von Rekombination in E. coli.

10 zeigt die Expression von CAR und &agr;v-Integrinen auf Testzellen. Für die Flußzytometrie-Analyse wurden HeLa, CHO, K562 und CD34+-Zellen mit monoklonalen anti-CAR (RmcB, Verdünnung 1:4000) oder anti-&agr;v-Integrin-Antikörpern (L230, Verdünnung 1:30) inkubiert. Als negative Kontrolle wurden die Zellen mit einem irrelevanten monoklonalen Antikörper aus Maus (anti-BrdU, Verdünnung 1:100) inkubiert. Die Bindung der Primärantikörper wurde mit anti-Maus FITC-markierten Konjugaten (Verdünnung 1:100) entwickelt. Die gezeigten Daten stellen die durchschnittlichen Ergebnisse von Vierfach-Analysen dar, durchgeführt mit 104 Zellen.

11 zeigt Elektronenmikroskopie von Adenovirus-Partikeln. Aufgereinigte Partikel aus Ad5, 9 und 35 wurden negativ Kontrast-gefärbt und bei einer Vergrößerung von 85,000x analysiert. Defekte Partikel sind durch Pfeile gekennzeichnet.

12 zeigt die Analyse der Anheftung und der Internalisation von verschiedenen Serotypen an CHO, HeLa, K562 und CD34+ Zellen. Gleiche Mengen von [3H]-Thymidin-markierten Virionen von Ads 3, 4, 5, 9, 35 und 41 (gemessen durch OD260, und äquivalent zu einer MOI von 400 pfu pro Zelle für Ad5) wurden wie in Material und Methoden beschrieben, für eine Stunde auf Eis inkubiert. Die Zellen wurden dann gewaschen, und die Anzahl von gebundenen Virionen pro Zelle wurde bestimmt. Für Internalisierungs-Untersuchungen ließ man die Virionen zunächst für 1 h auf Eis an die Zellen anlagern. Dann wurden ungebundene Partikel ausgewaschen. Die Zellen wurden dann bei 37°C für 30 min inkubiert, gefolgt von Behandlung mit Trypsin-EDTA und Waschschritten, um nicht internalisierte virale Partikel auszuwaschen. Die Daten wurden aus zwei bis vier unabhängigen Experimenten gewonnen, die im dreifachen Ansatz durchgeführt wurden. Beachte die unterschiedliche Skala auf den Y-Achsen für CD34+ Zellen.

13A13C zeigen die Anheftung und die Internalisation von verschiedenen Adenovirus-Serotypen an HeLa, CHO bzw. 293 Zellen.

14A und 14B zeigen die Anheftung und die Internalisation von verschiedenen Adenovirus-Serotypen an CD34+ bzw. an K-562 Zellen.

15A15C zeigen die Analyse der viralen Replikation in K562 und CD34+ Zellen durch Southern Blot-Analyse von methylierter viraler DNA. Replikationsuntersuchungen wurden mit 1 × 105 K562 Zellen (A) oder CD34+ Zellen (B) durchgeführt, die mit methyliertem Ad5, Ad9 oder Ad35 infiziert waren. Die Spur, die als „load" markiert ist, stellt DNA dar, die unmittelbar nach Zugabe der angezeigten viralen Dosis zu den Zellen aus dem Medium/Zellgemisch extrahiert wurde. Die Intensitäten der Banden entsprechend methylierter und nicht methylierter viraler DNA zeigen, dass ~ 85% des eingesetzten Virus methyliert wurden. Zur Quantifizierung der Adsorption und der Internalisierung wurde eine DNA-Analyse nach vorheriger Inkubation des Virus mit Zellen bei 0°C (Adsorption) oder 37°C (Internalisation) durchgeführt. Für dosis-abhängige Replikationsuntersuchungen wurde die angezeigte virale Dosis (ausgedrückt als Anzahl von Genomen) zu den Zellen zugegeben, und zelluläre genomische zusammen mit viraler DNA wurde 16 Stunden oder 36 Stunden nach Infektion für K562 bzw. CD34+ Zellen extrahiert. Identische Mengen an Proben-DNA wurden durch Southern-Blot analysiert. Für Zwecke der Quantifizierung wurde die Replikation von Ad9 zusammen mit Ad5 analysiert, unter Verwendung einer Ad5/9 chimären Sonde, die an DNA beider Serotypen hybridisiert (C). Die Analyse von Ad5 gegenüber Ad35 Replikation wurde mit der entsprechenden Ad5/35 chimären Sonde durchgeführt. Da getrennte Hybridisierungen sowohl mit Ad5/35 als auch mit Ad5/9 Sonden identische Signalintensitäten für Ad5 DNA ergaben, wird nur eine Reihe der Ad5 Replikation in Testzellen gezeigt. Zur Erzeugung von unterscheidbaren Fragmenten, die spezifisch für den methylierten und den nicht methylierten Zustand von viralen Genomen sind, wurde Ad5 DNA mit XhoI verdaut, während Ad9 und Ad35 DNA mit XhoI und HindIII verdaut wurden. Die Banden, die spezifisch für methylierte (nicht replizierte) virale DNA waren, liefen bei ~ 12 kb für Ad9, 35 kb für Ad5 und ~ 12 kb für Ad35. Die für nicht methylierte DNA spezifischen Banden waren 5.8 kb für Ad9, 6.1 kb für Ad5 und 9.5 kb für Ad35. Chimäre Ad5/9 und Ad5/35 DNA-Fragmente (1.8 kb) wurden als Standards für die Quantifizierung verwendet und zusammen mit verdauter viraler/zellulärer DNA (dargestellt auf dem linken Teil der Abbildung) auf ein Gel aufgetragen.

16A und 16B zeigen die Struktur von Ad5GFP und Ad5GFP/F35 Vektoren. A) Schematisches Diagramm des ursprünglichen E1/E3-deletierten Ad5-basierten Vektors mit einer in den E3-Bereich eingesetzten GFP-Expressionskassette und der chimäre Vektor Ad5GFP/F35, der das Ad5/35 Fiber-Gen enthält. Das 2.2 kb Ad5 Fiber-Gen wurden durch ein 0.9 kb großes chimäres Fiber-Gen ersetzt, das für den kurzen Schaft und den Knob von Ad35 kodiert durch ein Verfahren mit PCR-Klonierung und Rekombination in E. coli. KpnI (K) und HindIII (H)-Stellen, die innerhalb oder um die Fiber-Gene herum lokalisiert sind, sind gekennzeichnet. Die untere Reihe zeigt die detaillierte Struktur des chimären Fiber-Bereichs. Der Ad5 Fiber-Schwanz [Aminosäuren (aa): 1-44] wurden im Leserahmen an den Ad35 Fiberschaft gekoppelt, beginnend mit den ersten beiden Aminosäuren (GV), die zwischen vielen Serotypen konserviert sind. Ein konservierter Bereich von Aminosäuren TLWT kennzeichnet die Grenze zwischen dem letzten &bgr;-Faltblatt des Ad35 Schafts und dem globulären Knob. Auf das Ad35 Fiberketten-Terminationskodon folgt das Ad5 Fiber-Polyadenylierungssignal. Der Bereich von AD5GFP/F35, der für die chimäre Fiber kodiert, wurde mit Ad5-spezifischen Primern vollständig sequenziert (siehe Material und Methoden). B). Restriktionsanalyse von viralen Genomen. Virale DNA wurde aus aufgereinigten AD5GFP und AD5GFP/F35-Partikeln wie anderswo beschrieben aufgereinigt. Ein Mikrogramm DNA wurde mit KpnI oder HindIII verdaut und in Ethidiumbromidgefärbten Gelen aufgetrennt (links), diese wurden anschließend geblottet und mittels Southern Blot analysiert mit einer für Ad5 E4 spezifischen Sonde (nt 32,7775-33,651) (rechts). Spezifische Muster wurden nachgewiesen, die die korrekte Struktur für beide viralen Vektoren zeigen. Die für AD5GFP und AD5GFP/F35 spezifischen HindIII-Fragmente waren 2,9 kb bzw. 4,9 kb. Das KpnI-Fragment, das die richtige AD5GFP/F35-Struktur bestätigte, war 1,6 kb groß, verglichen mit einem 7.6 kb großen Fragment für Ad5GFP. M = 1 kb Leiter (Gibco-BRL, Grand Island, NY).

17 zeigt die Erzeugung von &Dgr;Ad.AAV Genomen durch Rekombination zwischen invertierten Homologiebereichen. Rekombination zwischen zwei invertierten Wiederholungen (IR) anwesend in einem &Dgr;Ad.AAV Vektor. Der &Dgr;Ad.AAV Vektor (~34 kb) der ersten Generation enthält zwei 1.2 kb große invertierte Homologieelemente, die die Transgenkassette flankieren. Ein AAV-ITR ist zwischen das Ad-Verpackungssignal (&psgr;) und das linke IR inseriert. Während der Ad-Replikation vermittelt die Rekombination zwischen den IRs die Bildung von &Dgr;Ad.AAV-Genomen mit dem Transgen, das von IRs flankiert wird, AAVITRS, Ad-Verpackungssignalen und Ad ITRs. Diese Genome werden effizient in Ad Capside verpackt.

18 zeigt die Struktur von Ad5/11, Ad5/35. Schematisches Diagramm des ursprünglichen E1/E3-deletierten auf AD5 basierenden Vektors mit einer GFP-Expressionskassette, die in den E3-Bereich (Ad5GFP) inseriert ist und des chimären Vektors Ad5GFP/F35, der das Ad5/35 Fiber-Gen enthält. Das 2.2kb Ad5 Fiber-Gen wurde durch ein 0.9 kb chimäres Fiber-Gen ersetzt, das für den kurzen Schaft und den Knob von Ad35 kodiert, durch eine Technik mit PCR-Klonierung und Rekombination in E. coli. KpnI (K) und HindIII (H)-Stellen, die innerhalb oder um die Fiber-Gene herum lokalisiert sind, sind gekennzeichnet. Die untere Reihe zeigt die detaillierte Struktur des chimären Fiber-Bereichs. Der Ad5 Fiber-Schwanz [Aminosäuren (aa): 1-44] wurde im Leserahmen an den Ad35 Fiberschaft gekoppelt, beginnend mit den ersten beiden Aminosäuren (GV), die zwischen vielen Serotypen konserviert sind. Ein konservierter Bereich von Aminosäuren TLWT kennzeichnet die Grenze zwischen dem letzten &bgr;-Faltblatt des Ad35 Schafts und dem globulären Knob. Auf das Ad35 Fiberketten-Terminationskodon folgt das Ad5 Fiber-Polyadenylierungssignal.

19 zeigt die Kreuz-Kompetition um die Anheftung und Internalisierung von markiertem Ad5GFP, Ad35 und chimären Ad5GFP/F35 Virionen um unmarkierte Viren, und mit anti-CAR oder anti-&agr;v-Integrin-Mab. (A) Für Anheftungsuntersuchungen wurden 105 K562 Zellen mit einem 100fachen Überschuss von unmarkiertem Kompetitorvirus bei 4°C für 1 h inkubiert. Dann wurden gleiche Mengen an [3H]-markierten Viren, in einer Dosis, die äquivalent zu einer MOI von 100 pfu pro Zelle ist und für Ad5GFP bestimmt wurde, zu den Zellen gegeben, gefolgt von Inkubation bei 4°C für 1h. Zellen wurden dann mit eiskaltem PBS gewaschen, pelletiert und der Prozentsatz an angeheftetem Virus (zellassoziierte Zähler pro Minute) wurde bestimmt. Zur Analyse der Kreuz-Kompetition um die Internalisierung wurden die Zellen mit einem 100fachem Überschuss von Kompetitorvirus bei 37°C für 30 Minuten inkubiert, bevor das markierte Virus zugegeben wurde. Nach einer zusätzlichen Inkubation bei 37°C für 30 Minuten wurden die Zellen für 5 min bei 37°C mit Trypsin-EDTA behandelt, mit eiskaltem PBS gewaschen, pelletiert und der Prozentsatz an internalisiertem Virus wurde bestimmt. Vorläufige Experimente hatten gezeigt, das die für die Kompetitionsuntersuchungen gewählten Bedingungen die Sättigung bei der Anheftung/Internalisierung auf K562 Zellen für ale unbehandelten Kompetitoren ermöglichte. (B). 105 K562 Zellen wurden für 1 Stunde bei 4°C mit anti-CAR Mab (RcmB, verdünnt 1:100) oder mit anti-&agr;v-Integrin Mab (L230, verdünnt 1:30) präinkubiert, gefolgt von Inkubation mit markierten Viren gemäß den zuvor beschriebenen Protokollen für Anheftung oder Internalisierung. Für jeden bestimmten Serotyp wurde der Prozentsatz an angeheftetem/internalisiertem Virus mit den Kontrolleinstellungen verglichen, wobei Zellen unter den gleichen Bedingungen mit einer 1:100 Verdünnung eines irrelevanten Antikörpers (anti-BrdU Mab) vor der Zugabe des markierten Virus inkubiert wurden. Es ist zu beachten, dass die spezifischen Kompetitoren, aber nicht die entsprechenden Kontrollen die Internalisierung von Ad5 in einem Ausmaß signifikant hemmten, die mit veröffentlichten Daten übereinstimmt (59). N>/=4.

20. Kreuz-Kompetition um Anheftung und Internalisierung von [3H]-markierten Ad5GFP, Ad35 und chimären Ad5GFP/F35 Virionen um unmarkiertes Ad3 Virus (A), und von [3H]]-markierten Ad3 Virionen um unmarkierte Viren (B). 105 K562 Zellen wurden mit einem 100fachen Überschuss unmarkierter viraler Partikel gemäß den für 6 beschriebenen Anheftungs- oder Internalisierungsprotokollen präinkubiert. Gleiche Mengen an [3H]]-markierten AD5GFP, AD5GFP/F35 oder Ad35(A) oder [3H]]-markierten Ad3 (B) wurden zu den Zellen in einer Dosis gegeben, die äquivalent zu einer MOI von 100 pfu pro Zelle für Ad5GFP ist. In Kontrolleinstellungen wurden die Zellen mit markierten Viren ohne Kompetitoren inkubiert. N=4.

21 zeigt die Transduktion von CD34+, K562 und HeLa Zellen mit Ad5GFP und chimären Ad5GFP/F35 Vektoren. 1 × 105 Zellen wurden mit unterschiedlichen MOIs (pfu/Zelle) von Viren in 100 &mgr;l Medium für 6h infiziert. Virus-enthaltendes Medium wurde dann entfernt, und die Zellen wurden in frischem Medium resuspendiert, gefolgt von Inkubation für 18h bei 37°C. Der Prozentsatz an GFP-exprimierenden Zellen wurde durch Flußzytometrie bestimmt. N=3.

22 zeigt die Verteilung von GFP-positiven Zellen in Subpopulationen von menschlichen CD34+ Zellen, die CAR oder &agr;v-Integrin exprimieren. 1 × 105 Zellen wurden wie für 8 beschrieben mit Ad5GFP oder Ad5GFP/F35 bei einer MOI von 200 pfu/Zelle infiziert. 24 h nach der Infektion wurden die Zellen mit anti-CAR (Verdünnung 1:100) oder anti-&agr;v-Integrin (Verdünnung 1:100) primären monoklonalen Antikörpern für 1 Stunde bei 37°C inkubiert. Die Bindung primärer Antikörper wurde mit einem anti-Maus IgG-PE-markierten sekundären Mab (Verdünnung 1:100) bei 4°C für 30 min entwickelt. Für jede Variante wurden104 Zellen durch Flußzytometrie untersucht. Die scheininfizierten Varianten stellen die Zellen dar, die nur mit Verdünnungspuffer inkubiert wurden. Die Quadranten-Grenzen wurden basierend auf den Hintergrundsignalen gesetzt, die sowohl mit den GFP- als auch den PE-gematchten Kontrollen erhalten wurden. Die in jedem Quadranten gefundenen gefärbten Zellen sind gezeigt. Die Daten sind repräsentativ für 3 unabhängige Experimente.

23A23B zeigen die Verteilung von GFP-positiven Zellen in einer Subpopulation von humanen CD34+ Zellen, die CD34 und Cd117 (c-kit) exprimieren. (A) Kolokalisation von Expression von GFP mit Expression von CD34 oder CD117: CD34+ Zellen wurden mit Ad5GFP oder Ad5GFP/F35 bei einer MOI von 200 pfu pro Zelle unter den für 8 beschriebenen Bedingungen infiziert. 24 h nach Infektion wurden die Zellen mit anti-CD34 PE-markierten Mabs (Verdünnung 1:2) oder mit anti-Cd117 PE-konjugierten Mabs (Verdünnung 1:5) für 30 min auf Eis inkubiert, und pro Variante wurden 104 Zellen einer Zwei-Farben Flußzytometrie-Analyse unterworfen. Für die Negativkontrollfärbung wurde vor der Analyse kein Antikörper zu den Zellen zugefügt. Die Scheininfektions-Varianten stellen Zellen dar, die nur mit Virusverdünnungspuffer inkubiert wurden. Die Quadrantengrenzen wurden gesetzt basierend auf den Signalen, die man sowohl mit GFP- als auch mit PE-gematchten Kontrollen erhalten hat. Der in jedem Quadranten gefundene Prozentsatz an gefärbten Zellen ist gezeigt. Das Experiment wurde zweimal im Dreifachansatz durchgeführt und typische Ergebnisse werden gezeigt. Die Standardabweichung betrug weniger als 10% des statistischen Durchschnitts. (B) Transduktion von CD34+/CD117+ Zellen mit Ad5GFP und Ad5GFP/F35 chimären Virusvektoren: CD34+ Zellen, die über Nacht vor der Färbung in Medium ohne SCF inkubiert wurden, wurden für 30 min auf Eis mit PE-markiertem anti-CD117 Mab inkubiert. Die Fraktion CD117-positiver Zellen wurde durch FACS sortiert. Mehr als 97% der gesorteten Zellen waren positiv für CD117. 1 × 105 CD117+/CD34+ Zellen wurden mit Ad5GFP oder Ad5GFP/F35 bei einer MOI von 200 pfu/Zelle wie in 8 infiziert. 24 Stunden nach Infektion wurde der Anteil an GFP-positiven Zellen durch Flußzytometrie bestimmt. Für die Scheininfektion wurden CD117+/CD34+ Zellen nur mit dem Virus-Verdünnungspuffer inkubiert. Die Infektion wurden dreifach durchgeführt, und der durchschnittliche Prozentsatz der GFP-exprimierenden Zellen ist auf dem entsprechenden Histogramm gezeigt. Die Standardabweichung betrug weniger als 10% des statistischen Durchschnitts.

24 zeigt die Southern Analyse von viralen Genomen in GFP-positiven und GFP-negativen Fraktionen von CD34+ Zellen, die mit dem Ad5GFP und dem chimären Ad5GFP/F35 Vektor infiziert wurden. CD34+ Zellen wurden mit Viren in einer MOI von 100 wie für 21 beschrieben infiziert. 24 h nach der Infektion wurden die Zellen durch FACS auf GFP-positive und GFP-negative Zellen sortiert. 105 Zellen aus jeder Fraktion wurden dazu verwendet, genomische DNA zusammen mit viraler DNA zu isolieren. Vor der Zelllyse wurde eine rigorose Behandlung mit Trypsin und DNase, gefolgt von Waschschritten durchgeführt, um die Kontamination genomischer DNA-Proben mit extrazellulärer viraler DNA auszuschließen. A) Das obere Gel zeigt das Ethidiumbromid-gefärbte 1 % Agarosegel vor dem Blotting und zeigt, das gleiche Mengen an DNA geladen wurden. Diese Menge entsprach DNA , die aus ~ 25,000 GFP+ oder GFP- Zellen isoliert wurde. Die Spur, die als Aload@ bezeichnet ist, stellt virale DNA dar, die aus Ad5GFP oder Ad5GFP/F35 Virionen isoliert wurde, vermischt mit pBluescript Plasmid-DNA (Stratagene) als Träger und aufgetragen auf ein Gel in der Menge, die tatsächlich dazu verwendet wurde, 25,000 Zellen zu infizieren. Als Standard für die Konzentration wurde eine serielle Verdünnung von Ad5GFP Genomen auf ein Gel geladen (linke Seite). Für die Southern Analyse (untere Reihe) wurde ein 8kb langes HindIII-Fragment, das dem E2-Bereich von Ad5 entspricht, als markierte Sonde verwendet. Hybridisierte Filter wurden einer Analyse mit dem Phosphorimager unterzogen, dann wurde ein Kodak-X-OMAT Film für 48 h bei –70°C aufgelegt. Die zelluläre/virale DNA ist durch einen Pfeil gekennzeichnet. (B) Zum Nachweis von Ad5GFP-Genomen in transduzierten Zellen wurde eine PCR-Amplifikation, gefolgt von einer Southern Analyse mit den gleichen Proben durchgeführt, die für die quantitative Southern Blot Hybridisierung in (a) verwendet wurden. DNA, aufgereinigt aus ~ 2500 Zellen wurde einer PCR unterzogen (95°C 1 min, 53°C 1 min, 72°C 1 min, 20 Zyklen mit Primern Ad5-F1 und Ad5-R1). Ein Fünftel der PCR-Reaktion wurden einer Elektrophorese auf einem Agarosegel unterzogen (obere Reihe). Ein 0.9 kb langes DNA-Fragment, das spezifisch für den E4-Bereich von Ad5 ist, wurde für die transduzierten Ad5GFP/F35 Genome nachgewiesen. DNA wurde dann auf Nybond-N+ Membranen geblottet und eine Southern Blot Hybridisierung (untere Reihe) mit einer Ad5 E4 spezifischen DNA-Sonde wurde durchgeführt. Zusätzlich zu dem 0.9 kb Fragment erzeugten die PCR-Primer ein kleineres 0,5 kb großes Fragment, das ebenfals mit der E4-Bereichssonde hybridisierte.

25 zeigt die Rolle der Fiberschaft-Länge bei Ad-Infektionsstrategien. CAR-Binde (Ad5 und Ad9)-Varianten und Ad35, der mit einem non-CAR Rezeptor interagiert, wurden auf CAR-exprimierenden Zellen (293, Y79) und K562 Zellen analysiert, die keine signifikanten Mengen an CAR exprimieren. Alle Vektoren enthalten eine GFP-Expressionskassette, verpackt in ein Ad5 Capsid mit modifizierten Fibern.

26 zeigt die tertiäre Struktur des Ad5 Knob: Lokalisation von CAR-Bindestellen. H-I Schleife und G-H Schleife.

27 zeigt den Austausch des G-H Loops gegen heterologe Peptide.

28 zeigt die Anheftung und die Internalisierung metabolisch markierter Serotypen mit menschlichen Zelllinien.

29A29 Dzeigen die Erzeugung von Rep78-exprimierenden Ad Vektoren durch Rekombination zwischen zwei Vektoren. (A) Die gleiche Strategie wie in 15 wurde für Vektoren mit rep 78 als Transgen verwendet. Der Ad5'rep Vektor enthielt auch den ApoEhAAT Promoter, abgeschirmt durch einen HS-4 Insulator. Der Bereich an Homologie zwischen den beiden Fragment des rep78 Gens war 658 nt lang. Aus dem Rep78 Orf wurde der p5 Promoter deletiert. Das interne Rep40/52 Startcodon (an Position 993) wurde mutiert, um die Produktion von kleinen Rep Proteinen zu zerstören. Weiterhin wurde die Spleissstelle an nt1905 deletiert, wodurch die Expression von Rep68 eliminiert wird. Die einzelne Expression von rep78 wurde gezeigt. (B) Bildung von &Dgr;Ad.rep78 Genomen. Das erwartete 5,8 kb große &Dgr;Ad.rep78 Genom wurde nur nach Koinfektion sowohl mit Ad5'rep als auch mit Ad3'rep in 293 Zellen entdeckt, wie durch Southern gezeigt. (C) Southern Blot Analyse zum Rescue des rekombinanten AAV Genoms aus der Plasmid-DNA durch Rep78, das vom pCMVrep78 und &Dgr;Ad.rep78 exprimiert wurde. Das erwartete Rescue-Produkt ist 3,8 kb groß (R-Plasmid). (D) Southern Blot Analyse zur Rescue des rekombinanten AAV Genoms aus dem Ad.AAV viralen Vektorgenom.

AUSFÜHRLICHE BESCHREIBUNG DER ERFINDUNG

Alle in dieser Anmeldung verwendeten technischen und wissenschaftlichen Begriffe haben die im Stand der Technik bekannte Bedeutung, sofern nichts anderes angegeben ist. Die folgenden Wörter oder Ausdrücke, die in der vorliegenden Anmeldung verwendet werden, haben die angegebene Bedeutung.

Der Begriff Vektor umfasst in nicht-beschränkender Weise Plasmide, Cosmide, Phagemide und künstliche Chromosomen. Die Vektorsequenz kann als die virale „Basisvektor" Sequenz bezeichnet werden. Die Basisvektor-Sequenz hängt ab von dem spezifischen Serotyp und dem Virus, von dem die Basisvektor-Sequenz abgeleitet wurde. Die Basisvektor-Sequenz kann an non-Vektor oder Transgen-Sequenzen gekoppelt sein (z.B. heterologe Sequenzen).

Die Transgen-Sequenzen können Sequenzen umfassen, die Kompatibilität mit prokaryotischen oder eukaryotischen Wirtszellen verleihen, wobei Kompatibilität sich auf die Vektorreplikation innerhalb einer Wirtszelle bezieht. Daher kann die Transgensequenz eine Replikonsequenz sein, die die Replikation des Vektors innerhalb einer Wirtszelle steuert, woraus ein autonom replizierender Vektor resultiert. Alternativ kann die Transgensequenz Vektorreplikation ermöglichen, die von der Replikationsmaschinerie der Wirtszelle abhängt.

Die Basisvektorsequenzen können funktionell an eine Transgensequenz gekoppelt sein, die für ein Genprodukt kodiert, wie z.B. ein Polypeptid, rRNA oder tRNA. So kann z.B. das Transgen für ein Polypeptid wie z.B. ein virales Kapsidprotein, oder ein virales Fiberprotein kodieren. Das Transgen kann von dem gleichen oder von einem anderen Serotyp wie die Basisvektor-Sequenz abgeleitet sein.

Ein anderes Beispiel eines Transgens umfasst ein Reportergen, das für ein Genprodukt kodiert, das als selektierbarer Marker verwendet werden kann, wie ein Arzneistoffresistenzgen oder ein kolorimetrischer Marker. Das Reportergen kann für ein Genprodukt kodieren, das leicht durch z.B. einen visuellen mikroskopoischen, einen immunchemischen oder einen enzymatischen Assay nachgewiesen werden kann. Das bevorzugte Reportergen kodiert für ein Genprodukt, das durch ein nichtdestruktives Verfahren nachgewiesen werden kann, das die Zelle, die das Reportergen exprimiert, nicht zerstört.

Ein therapeutisches Gen ist ein weiteres Beispiel eines Transgen. Ein therapeutisches Gen kodiert für ein Genprodukt (z.B. Polypeptid oder RNA), das bei Expression in einer Wirtszelle einen therapeutischen Nutzen oder eine gewünschte Funktion an die Wirtszelle oder das Gewebe oder an den Organismus, der die Wirtszelle enthält, bereitstellt. Der therapeutische Nutzen kann aus der Modifikation der Funktion eines Gens im Wirtsgenom oder aus der zusätzlichen Funktion resultieren, die durch das therapeutische Protein, das Polypeptid oder die RNA bereitgestellt wird.

Die Basisvektorsequenz kann an eine Transgensequenz gekoppelt sein, die ein regulatorisches Element ist, wie Promotoren, Enhancer, Transkriptionsterminationssignale, Polyadenylierungssequenzen. Das regulatorische Element kann die Expression der Transgensequenz, die für ein Genprodukt kodiert, durch direkte Transkription oder Translation steuern. Das regulatorische Element kann die Menge oder den zeitlichen Ablauf der Expression des Transgens regulieren. Das regulatorische Element kann die Expression des Transgens in bestimmten Wirtszellen oder Geweben (z.B. Wirts-spezifische oder Gewebe-spezifische Expression) steuern.

Die Basisvektorsequenz kann an ein Transgen gekoppelt sein, das es dem Vektor ermöglicht, in eine andere Nukleotidsequenz zu integrieren. Die Integrationssequenz kann die Integration des gesamten Vektors oder von Teilen des Vektors ermöglichen. Die Integrationssequenz kann mit der Basisvektorsequenz verwandt sein oder nicht. So können die Integrationssequenz und die Basisvektorsequenz z.B. von gleichen oder verschiedenen viralen Serotypen abstammen. Die Integrationssequenzen können invertierte Wiederholungssequenzen (ITRs) von Adenovirus (Ad), Adeno-assoziiertem Virus (AAV) oder von HIV sein.

Die Basisvektorsequenz kann an eine Transgensequenz gekoppelt sein, die die homologe Rekombination des Vektors in das Genom einer Wirtszelle steuert. Solche Transgen-Sequenzen können von den gleichen viralen Serotypen wie die Basisvektorsequenz abstammen oder nicht.

Der Vektor kann multiple Endonukleaserestriktionsschnittstellen enthalten, die eine angenehme Insertion von exogenen DNA-Sequenzen ermöglichen.

Der Begriff „Hybridvektor" wie in der Erfindung verwendet bezieht sich auf einen Vektor, der eine Nukleinsäure enthält, die aus zwei verschiedenen Viren kombiniert ist (z.B. Adenovirus und AAV).

„Chimärer Vektor" bezieht sich auf einen Vektor, der Nukleinsäuresequenzen enthält, die nicht natürlicherweise zu diesem Vektor gehören (d.h., Sequenzen, die nicht natürlich auftreten oder Sequenzen, die nicht in ihrem natürlichen Hintergrund sind, heterologe Sequenzen eingeschlossen). Ein chimärer Vektor der vorliegenden Erfindung kann auch ein Hybridvektor sein. Ein Beispiel eines chimären Vektors ist ein Ad.AAV, der ein modifiziertes Fiberprotein in seinem Kapsid exprimiert.

Der Begriff „Transduktion" oder „Infektion" bezieht sich auf ein Verfahren zum Einbringen von viraler DNA innerhalb eines Viruspartikels in eine Wirtszelle. Die virale DNA ist dabei in Form eines rekombinanten Virus, der durch Kopplung eines Segments von interessierender DNA in das virale Genom in einer solchen Weise erreicht wird, so dass das Gen als funktionales Protein exprimiert werden kann.

Der Begriff „Transfektion" bezieht sich auf ein Verfahren zum Einbringen eines DNA-Fragments in eine Wirtszelle.

Der Begriff „heterolog" bedeutet, dass eine Nukleinsäuresequenz oder eine Peptidsequenz in einen Kontext gebracht wird, der für das Basis-Adenovirus oder für eine transduzierte Zelle nicht endogen ist. So kann z.B. eine Peptidsequenz von einem Protein zu einem anderen Protein transferiert werden, wobei das entstehende Protein dann als heterologes Protein bezeichnet wird. Ein chimäres Fiberprotein (z.B. eine Serotyp 5 Schwanzdomäne und eine Serotyp 35 Schaft- und Knobdomäne) wird für den Ad5 Vektor als heterolog bezeichnet. Der Begriff umfasst auch Nukleinsäuren (z.B. kodierende Sequenzen) von einem Stamm oder Serotyp eines Adenovirus, der in einen anderen Stamm oder einen anderen Serotyp von Adenovirus eingebracht wird.

Der Begriff „regulatorische Elemente" bezeichnet Promotoren, Enhancer, Transkriptionsterminationssignale, Polyadenylierungssequenzen und andere Expressionskontrollsequenzen. Erfindungsgemäße regulatorische Elemente umfassen in nicht beschränkender Weise jene, die die Expression von Nukleinsäuren nur in bestimmten Wirtszellen steuern (z.B. gewebespezifische regulatorische Sequenzen).

Der Begriff „funktional gekoppelt" sagt aus, dass eine Polynukleotidsequenz (z.B. eine kodierende Sequenz oder ein Gen) auf derartige Weise an ein regulatorisches Element gekoppelt ist, das die Sequenz des regulatorischen Elements die Transkription oder Translation oder beides der Polynukleotidsequenz lenkt. Die Orientierung des regulatorischen Elements kann variieren (z.B. in reverser Orientierung im Hinblick auf das rechte ITR). Der Begriff umfasst auch das Vorhandensein eines geeigneten Startsignals (z.B. ATG) vor der Polynukleotidsequenz, die exprimiert werden soll und das Aufrechterhalten des korrekten Leserahmens zur Ermöglichung der Expression der Polynukleotidsequenz unter der Kontrolle der Expressionskontrollsequenz und die Erzeugung des gewünschten Polynukleotids oder des Proteins. Regulatorische Sequenzen können auch 3'-Sequenzen umfassen, die die korrekte Termination gewährleisten (z.B. Polyadenylierungs-Stopsignal).

Der Begriff „Gentherapie" bezieht sich auf ein Verfahren, bei welchem ein Segment exogener DNA auf eine derartige Weise in eine Zelle eingebracht wird, dass es zu einer funktionellen Modifikation der Empfängerzelle durch Expression der exogenen Nukleinsäure führt. Die exogene Nukleinsäure ist typischerweise insofern therapeutisch, als das die Expression des kodierten Proteins, des Polypeptids oder der RNA die zelluläre Dysfunktion, die auf einem genetischen Defekt beruht, korrigiert wird, oder algemeiner, als das sie unerwünschten Funktionen, die mit einer genetischen oder einer erworbenen Krankheit zusammenhängen, entgegenwirkt. Der Begriff „exogene Nukleinsäure" bezieht sich auf DNA- oder RNA-Sequenzen, die in der behandelten transformierten Zelle normalerweise nicht exprimiert werden. Der Begriff bezieht sich auch auf DNA- oder RNA-Sequenzen, die in einer behandelten transformierten Zelle in einem stärkeren, schwächeren oder auf andere Weise anderen Muster als in der unbehandelten, untransformierten Zelle exprimiert werden. Diese unnatürliche Expression kann auch als heterologe Expression bezeichnet werden.

Ein „Gentherapievektor" bezieht sich auf einen Vektor für die Gentherapie, d.h., zur Einbringung von exogenen Nukleinsäuren in einen Empfänger oder in eine Wirtszelle. Die exogene Nukleinsäure kann transient exprimiert oder integriert und im Empfänger oder der Wirtszelle stabil integriert sein.

Der Begriff „Plasmid" bezieht sich auf ein Nukleinsäuremolekül, das unabhängig vom Wirt repliziert, eine hohe Kopienzahl beibehält und das als Klonierungswerkzeug verwendet werden kann.

„Paraleler DNA-Strang" und „anti-paraleler DNA-Strang" beziehen sich auf jeden DNA-Strang des doppelsträngigen Adenovirus. Die Abbildungen zeigen die Lokalisation bestimmter Nukleotide auf dem paralelen Strang der DNA. Der antiparalele Strang bezieht sich auf den anderen der zwei DNA-Stränge, der in den Abbildungen nicht gezeigt ist. Zur Vereinfachung der Vektor-Diagramme werden die Fibersequenzen auf dem Paralelstrang gezeigt, auch wenn das Gen auf dem Anti-Paralelen Strang lokalisiert ist.

„Reportergen" bezieht sich auf eine Nukleinsäuresequenz, die für ein Polypeptid oder für ein Protein kodiert, das z.B. durch visuelle, mikroskopische, immunchemische oder enzymatische Assays leicht nachgewiesen werden kann. Bevorzugte Reportergene sind solche, die durch ein nicht-destruktives Verfahren nachgewiesen werden können, dass die transformierten Zellen, Gewebe nicht zerstört.

„Selektionsgen" bezieht sich auf ein Nukleinsäurefragment, das für ein Polypeptid oder für ein Protein kodiert, dessen Expression dazu verwendet wird, eine Zelle zu markieren, die mit einem bestimmten Vektor transfiziert ist.

„Therapeutisches Gen" bezieht sich auf ein DNA-Fragment, das für ein funktionales Polypeptid, Protein oder für RNA kodiert, das bei Expression in einer Wirtszelle einen therapeutischen Nutzen oder eine gewünschte Funktion an die Wirtszelle bereitstellt oder an das Organ oder den Organismus, der die Wirtszelle umfasst. Der therapeutische Nutzen kann in der Modifikation der Funktion eines nativen Gens in einem Wirt oder aus der zusätzlichen Funktion resultieren, die durch das therapeutische Protein, das Polypeptid oder die RNA bereitgestellt wird.

„Wirtsgewebe" oder „Wirtszelle" bezieht sich auf eine Zelle oder ein Gewebe in dem ein therapeutisches Gen exprimiert wird, um seine Funktion zu modifizieren.

In der Biologie ist es gut bekannt, dass gewisse Aminosäuresubstitutionen durchgeführt werden können, ohne die Funktion des Proteins zu verändern. Im algemeinen werden konservative Aminosäuresubstitutionen oder Substitutionen ähnlicher Aminosäuren toleriert, ohne die Proteinfunktion zu beeinflussen. Ähnliche Aminosäuren sind jene mit ähnlichen Größen und/oder Ladungseigenschaften, z.B. Aspartat und Glutamat, und Isoleucin und Valin, die beide Paare ähnlicher Aminosäuren darstellen. Ähnlichkeit zwischen Paaren von Aminosäuren wurde auf viele Arten bewertet. ZB Dayhoff et al., (1978) in Atlas of Protein Sequence and Structure, Band 5, Ergänzung 3, Kapitel 22, Seiten 345-352, zeigt Häufigkeitstabellen für Aminosäuresubstitutionen, die als Maß für Aminosäureähnlichkeit verwendet werden können. Die Häufigkeitstabellen von Dayhoff et al. basieren auf Vergleichen von Aminosäuresequenzen für Proteine, die die gleiche Futnktion haben, aus einer Vielzahl von evolutionär unterschiedlichen Quellen. Daher werden ale offensichtlichen Veränderungen in den erfindungsgemäßen Aminosäuresequenzen beabsichtigt.

Polypeptide, die „im wesentlichen ähnlich" sind, teilen Sequenzen wie vorstehend mit der Ausnahme, dass nicht identische Restpositionen durch konservative Aminosäureveränderungen gekennzeichnet sein können. Konservative Aminosäureaustausche beziehen sich auf die Austauschbarkeit von Resten mit ähnlichen Seitenketten. So ist z.B. eine Gruppe von Aminosäuren mit aliphatischen Seitenketten von Aminosäuren, die aliphatische Hydroxyl-Seitenketten enthalten, Serin und Threonin; eine Gruppe von Aminosäuren mit Amid-haltigen Seitenketten ist Asparagin und Glutamin; eine Gruppe mit aromatischen Seitenketten ist Phenylalanin, Tyrosin und Tryptophan; eine Gruppe mit basischen Seitenketten ist Lysin, Arginin und Histidin; ein Gruppe mit Schwefel-haltigen Seitenketten ist Cystein und Methionin. Bevorzugte Gruppen für konservative Aminosäuresubstitutionen sind in nicht einschränkender Weise: Valin-Isoleucin-Leucin, Phenylalanin-Tyrosin, Lysin-Arginin, Alanin-Valin, Asparagin-Glutamin, und Aspartat-Glutamat. Daher werden Polypeptidsubstitutionen gegen im wesentlichen ähnliche Sequenzen (wie oben beschrieben) für die erfindungsgemäßen Aminosäuresequenzen bereits beabsichtigt.

Die nachfolgende Beschreibung dient dem vollständigeren Verständnis der vorliegenden Erfindung.

Die vorliegende Erfindung stellt einzigartige Gentransfervehikel bereit, die viele der Nachteile der bekannten Vektoren überwinden. Die Erfindung beschreibt die erste Generation von Adenovirus-Vektoren, die linke und rechte Ad ITRS, eine Ad-Verpackungssequenz, eine Transgenkassette mit regulatorischen Sequenzen, und ein Paar von ITR Kassetten umfassen, die die Transgenkassette flankieren, die vorhersagbare virale genomische Rearrangements während der viralen Replikation als auch die Integration der Transgenkassette in das Genom der Wirtszelle steuern.

Ein vorhersagbares Rearrangement, das während der viralen Replikation eintritt, ist die Erzeugung eines „gutless" adenoviralen Vektors (hier auch als &Dgr;Ad bezeichnet), der rechte und linke Ad ITRs, eine Ad Verpackungssequenz, eine Transgencasette, die von Kassetten-ITRs flankiert wird, enthält. Der gutless Vektor ist frei von alen anderen immunogenen viralen Genen.

Das Potential für ortsspezifische Integration ist ein wichtiges Charakteristikum der erfindungsgemäßen neuen Ad Vektoren. In einer Ausführungsform der Erfindung wird die Integration der Transgenkassette durch Co-Infektion mit einem Ad Vektor gesteuert, der z.B. das rep78 Protein exprimiert, um z.B. ortsspezifische Integration z.B. in die AAVS1 Stelle auf dem menschlichen Chromosom 19 zu erlangen.

Die Erfindung beschreibt weiterhin einen neuen Weg, diese rekombinanten Adenovirus Vektoren auf bestiummte Zellen zu richten durch Modifizierung des Fiberproteins, das auf dem Kapsid exprimiert wird. Veränderungen sowohl im Fiberschaft als auch in der Fiber-Knob-Domäne zeigten das erfolgreiche Retargeting des Ad Vektor zu einem gewünschten Zelltyp. Zusätzlich wurde der G-H-Loop innerhalb der Fiber-Knob-Domäne als eine neue Stelle identifziert, um die Bindeaffinität und die Spezifität des rekombinanten Adenovirus-Vektor zu beeinflussen. Austausch von Peptidsequenzen in den G-H-Loop retargeten den gutless Vektor zu einem gewünschten Zelltyp.

Es wurde eine Adenovirus-Display-Bibliothek erzeugt, die zufällige Peptide innerhalb des G-H-Loop des Fiberproteins exprimiert. Diese Art von Bibliothek wird verwendet als Ligand zum Screening auf Adenovirus-Vektoren, die an gewünschte ZellTypn binden. Ein Vorteil der Benutzung einer solchen Adenovirus-Bibliothel gegenüber einer Phagenbibliothek besteht darin, dass, sobald Adenovirus-Affinität zu einer bestimmten Zelle identifiziert ist, der getargetete Adenovirusvektor bereits fertig ist, um eine Transgencasssette aufzunehmen und dazu verwendet werden kann, einen gutless Adenovirusvektor zu erzeugen, der für die Gentherapie verwendet werden kann.

Die nachstehend beschriebenen chimären Ad Vektoren enthalten ein modifiziertes Fiberprotein im Capsid des Adenovirus, das dazu führt, das der Vektor in der Lage ist, gewünschte ZellTypn zu infizieren. Daher kann erfindungsgemäß ein gutless chimärer &Dgr;Ad-AVV Vektor erzeugt werden, um ein Transgen in eine Wirtszelle oder in ein Gewebe einzubringen, dass normalerweise für die meisten viralen Gentherapie-Vektoren nicht zugänglich ist. Zusätzlich ist der erfindungsgemäße &Dgr;Ad.AAV Vektor frei von adenoviralen Genen und enthält AAV ITR Sedquenzen, die die Transgenkassette flankieren, die die stabile Integration des Transgens in das Genom des Wirts steuern und eine Langzeit-Expression des Transgens ermöglichen.

Die erfindungsgemäße Transgencassette kann ein Transgen tragen, das entweder ein Reportergen, ein selektierbares Gen für die in vitro oder in vivo Selektion von transduzierten Zellen oder ein therapeutisches Gen ist. In einer Ausführungsform der Erfindung ist das verwendete Reportergen &bgr;-Galactosidase, ist aber nicht darauf beschränkt. Viele Reportergene werden häufig verwendet, und jedes davon könnte im erfindungsgemäßen Ad.AAV Vektor als Transgen vorliegen. Andere Beispiele für Reportergene sind GFP und alkalische Phosphatase.

Im folgenden wird eine Ausführungsform der ersten Generation von erfindungsgemäßen Ad Vektoren beschrieben, der ein Wildtyp-Capsid und eine Transgen-Cassette aufweist, die von Cassette-ITR-Sequenzen flankiert sind; (b) Fiberprotein, das modifiziert ist, um Ad Vektoren zu retargeten; und (c) die Kombination beider Technologien, die die Erzeugung von chimären &Dgr;Ad Vektoren einschließlich eines modifizierten Fasreprotein ermöglicht, das auf dem Capsid exprimiert wird und den Basisvektor zur Infektion und Transgenintegration zu einem gewünschten Zelltyp umleitet.

A. Integrierende erfindungsgemäße Ad Hybridvektoren:

Es wurde gezeigt, dass die Insertion von inverted repeats (IRS) in den E1 Bereich von AdE1 Vektoren vorhersagbare genomische Rearrangements vermitteln kann, die zu einem gutless Vektorgenom führen, das frei von alen Genen ist. Eine spezifische Ausführungsform solcher IR-vermittelter Rearrangements ist Adeno-AAV, ein Hybrid-Adenovirus Vektor der ersten Generation, der AAV inverted terminal repeats enthält (ITR), die eine Transgencassette flankieren. Die AAV ITRs vermitteln die Bildung eines Genoms, ähnlich zu dem des &Dgr;Ad.Ir Genom (Steinwaeder et al., 2000, J. Virol.). &Dgr;Ad Vektoren, die frei von alen viralen Genen sind, integrieren stabil in kultivierte Zellen und transduzieren diese mit Effizienzen, die ähnlich zu z.B. rAAV Vektoren sind. Die Beispiele zeigen durch Southern Blot Analyse, das die &Dgr;ad Vektoren zufällig in das Genom integrieren.

Die erfindungsgemäßen Ad Vektoren umfassen einen linken Ad ITR, ein Adenovirus-Verpackungssignal, das 3' zum Ad ITR lokalisiert ist, eine Transgencassette, die 3' vom Verpackungssignal liegt und ein Polyadenylierungssignal umfasst, ein Transgen, und einen heterologen Promoter, und sind flankiert von einem Paar von ITRs. Adenovirale Gene für die Replikation wie E1, E2, E3, E4 liegen 3' von der rechten Kassette ITR und eine rechte Ad ITR liegt 3' von den Replikationsgenen. Die erfindungsgemäßen Vektoren sind besonders dazu geeignet, um zu behandeln: genetische Erkrankungen, Krebs und Infektionskrankheiten (wie HIV, Embolie oder Malaria). Behandelbare genetische Krankheiten wie Hämophilie A und B, cystische Fibrose; Muskeldystrophie und &agr;1-Antitrypsin-Krankheit sind ideale Kandidaten für genetische Krankheiten, die durch die erfindungsgemäßen Vektoren behandelt werden können. Ein spezifisches Beispiel für ein therapeutisches Gen zur Bekämpfung einer genetischen Krankheit ist Gamma-Globin zur Linderung von Sichelzellanämie.

Zur Unterstützung bei der Auswahl von transduzierten Zellen und zur Charakterisierung der Integrationsstelle der Transgencassette umfasst eine Ausführungsform der Erfindung die Addition einer Sequenz, die einen bakteriellen Replikationsursprung und ein selektierbares Gen enthält. Eine Ausführungsform davon ist eine SNori Sequenz, die zur Transgencassette hinzugefügt wird. Dies ermöglicht die Expression von &Dgr;Ad in menschlichen und bakteriellen Zellen, wodurch die Selektion von transduzierten Zellen und die Charakterisierung der Integrationsstelle im Genom von transduzierten Säugerzellen ermöglicht wird.

Das Potential für eine ortsspezifische Intregration ist ein wichtiges Charakteristikum der neuen Ad Vektoren der Erfindung. In einer Ausführungsform wird die Integration von &Dgr;Ad.AAV durch Koinfektion mit Ad AAV gesteuert, der das rep 78 protein in 293 Zellen exprimiert, um die ortsspezifische Integration in die AAVS1 Stelle auf dem humanen Chromosom 19 zu erreichen. Damit diese Art der ortsspezifischen Integration in anderen Zellen als 293 Zellen auftritt, ist die Expression des E4 ORF6 nötig. Die Koinfektion mit &Dgr;Ad.AAV, &Dgr;Ad. Rep78 und &Dgr;Ad. E4-ORF6 ermöglicht die ortsspezifische Integration der &Dgr;Ad.AAV Transgencassette. Die Genome von &Dgr;Ad.rep78 und &Dgr;Ad.E4-ORF6 werden kurz nach der Transduktion abgebaut, wodurch mögliche Nebenwirkungen vermieden werden. Ortsspezifische Integration ist gegenüber der zufälligen Integration bevorzugt, die man bei rAAV und &Dgr;Ad.AAV sieht, um das Risiko von Insertionsmutagenese zu vermeiden.

Die Integration der Transgencassette, die in den adenoviralen Vektoren enthalten ist, in Chromosomen kann mit dem Silencing oder der Blockierung der Expression des Transgens exprimiert sein. Das Silencing von Transgenen kann durch Einbau von Insulatorelementen in die Transgencassette vermieden werden. So können z.B. von Hühner-Globin-LCR abgeleitete HS-4 Insulatorelemente in Ad Vektoren dazu dienen, heterologe Promoter vor adenoviralen Enhancern abzuschirmen. HS-4 Insulatoren oder das Gypsy gen von Drosophila können auch dazu verwendet werden, das Silencing von Transgenen zu verhindern.

Eine andere Ausführungsform der Erfindung besteht darin, die Transgencassette in zwei Teile des Transgens zu teilen, die beide in verschiedenen erfindungsgemäßen adenoviralen Vektoren vorliegen. Jeder Teil des Transgens hat einen überlappenden Homologiebereich. Nach Infektion mit beiden Vektoren, die beide einen unterschiedlichen, aber überlappenden Teil des Transgens tragen, kommt es zu einem Rekombinationsereignis, das zur Rekonstitution des vollständigen Transgens führt, das dann exprimiert wird. Diese Technik wird dazu verwendet, hybride adenovirale Vektoren zu erzeugen, die große Inserts aufnehmen, einschließlich in nicht beschränkender Weise ein 13 kb großes genomisches hAAT Gen oder 12 kb große y-Globin LCRyGlobin Expressionskassetten. Die Bildung von hybriden &Dgr;Ad Vektorgenomen nach Rekombination der beiden Vektoren ist effizienter, wenn der überlappende Homologiebereich innerhalb des Transgens länger ist.

Ein Vorteil der vorliegenden Erfindung besteht in einem Verfahren zur Isolierung von reinen gutless adenoviralen Vektoren wie &Dgr;Ad.AAV oder &Dgr;Ad.AAVfx Vektoren. Zur Minimierung der Kontamination von &Dgr;Ad mit Vektoren der ersten Generation (Ad Vektoren) wird in Beispiel 1H eine Strategie beschrieben. Es wird vorausgesetzt, dass diese Ansätze den gleichen Titer an &Dgr;Ad Vektoren erreichen werden, die Kontamination mit Gesamtlängengenom wird jedoch geringer sein. Diese verbesserte Isolierung der Vektoren ist extrem wichtig, um toxische Nebenwirkungen nach der in vivo Verabreichung zu verhindern.

B. Adenovirus-Vektoren mit modifiziertem Tropismus:

Die erfndungsgemäßen Ad Vektoren können so modifiziert werden, dass sie auf eine interessierende Wirtszelle gerichtet sind. Es gibt mehr als 50 menschliche Ad Serotypen (siehe Appendix I), einschließlich Varianten mit unterschiedlicher Gewebeselektivität oder -tropismus. Es ist im Stand der Technik anerkannt, dass unterschiedliche Ad Serotypen an verschiedene zelluläre Rezeptoren binden und verschiedene Eintrittsmechanismen verwenden. Die meisten rekombinanten Adenovirus-Vektoren verwenden Adenovirus Serotyp 5 als den Basisvektor Serotyp 5 (Ad5) (Hitt, M.M. et al., 1997, Adv. In Pharmacol 40, 137-205). Ad5 Infektion wird in erster Linie durch die Bindung seines Fiberproteins an CAR vermittelt und sekundär durch die Bindung seiner Pentonbase an Integrin. Da auf vielen Zellen CAR und/oder Integrin nicht exprimiert werden, ist der Ad5-vermittelte Gentransfer in vielen Zellen ineffektiv, die wichtige Ziele für die Gentherapie sind, wie Endothel, glatter Muskel, Hautepithel, differenziertes Atemwegsepithel, Gehirngewebe, periphere Blutzellen oder Knochenmark. Im folgenden werden Ad5 Vektoren beschrieben, die als Ergebnis einer Veränderung der Fiberproteinsequenz eine Veränderung der Infektiosität und des Tropismus aufweisen.

Die Infektiosität verschiedener Ad Serotypen ist auf eine Anzahl menschlicher Zelllinien beschränkt. Infektionsstudien zeigten, dass Ad5 und Ad3 insbesondere dazu geeignet sind, endotheliale und lymphoide Zellen zu infizieren, während Ad9, Ad11 und Ad35 menschliche Knochenmarkszellen effizient infizieren. Daher sind die Knob-Domäne des Fiberproteins von Ad9, Ad 11 und Ad35 exzellente Kandidaten für das Retargeting des Ad5 Vektors auf menschliche Knochenmarkszellen. Andere mögliche Serotypen umfassen Ad7.

Im modifizierten erfindungsgemäßen Fiberprotein wurde die Fiber-Knob-Domäne der Ad5 Fiber gegen die eines anderen Serotyps ausgetauscht. Eine Ausführungsform der Erfindung ist das modifizierte Ad5/35 Fiberprotein (ein rekombinanter Ad5 Vektor, der ein modifiziertes Fiberprotein exprimiert, das aus der Fiberschwanzdomäne von Ad5 und dem Fiberschaft und den Knob-Domänen von Ad35 besteht). Das Ad5/35 chimäre Fiberprotein zeigt ein breiteres Spektrum der Infektiosität für eine Untergruppe von CD34+ Zellen, einschließlich jener Zellen, die Stammzellaktivität haben. Das Ad5/ 11 chimäre Fiberprotein (ein rekombinanter Ad5 Vektor, der ein modifiziertes Fiberprotein exprimiert, das aus der Fiberschwanzdomäne von Ad5 und dem Fiberschaft und den Knob-Domänen von Ad11 besteht) zeigt ähnlichen Tropismus.

Zusätzlich zu den Modifikation der Knob-Domäne beschreibt die Erfindung den zusätzlichen Vorteil der Modifikation sowohl der Fiberschaftdomäne als auch der Fiber-Knob-Domäne zur Erzeugung eines verkürzten Fiberproteins. Die Länge der Fiberschaftdomäne spielt eine Schlüsselrolle für die Wirtsrezeptoren, die für den Eintritt des viralen Vektors in die Zelle ausgewählt werden. Um dies zu zeigen wurden Ad5, Ad5/9 und Ad5/35 Varianten mit langen (22&bgr;-Faltblätter) und kurz (7&bgr;-Faltblätter)-Schaft-Fibern erzeugt. Diese Analysen zeigten, dass für eine effiziente virale Infektion über CAR als primärer Rezeptor für Ad5, Ad5/9 ein Fiberprotein mit langem Schaft erforderlich ist, während die Zelleintrittsstrategie von Ad5/35 (der an ein bisher nicht charakterisiertes non-Car Rezeptorprotein bindet) nicht von der Länge des Schafts abhängt (3). Die Modifikation sowohl in der Schaftlänge (zwischen 5>10 &bgr;-Faltblätter) und der Fiber-Knob-Domäne (von einem anderen Ad-Serotyp als der Basis-Vektor) ist eine neue Art, den Ad Tropismus zu ändern.

Zur Verbreiterung des Repertoires von ZellTypn, die von Ad Vektoren infiziert werden können, wurde eine spezifische Binderegion innerhalb der Knob-Domäne, der G-H Loop identifiziert, die die Bindeaffinität und Spezifität verbessert. Eine Veränderung innerhalb dieses Bereichs führt dazu, dass der Ad Vektor auf einen bestimmten Zelltyp gesteuert wird. So beschreibt die Erfindung z.B. die G-H Loop Sequenz innerhalb der Fiber-Knob-Domäne, die mit heterologen Peptidligandensequenzen ersetzt werden kann, ohne die Funktionalität der Tertiärstruktur der Ad Fiber-Knob-Domäne zu verändern, während die Bindeaffinität und Spezifität des Vektors verändert wird (6, 7). Dieser G-H Loop ist auf dem zentralen Teil der Knob-Oberfläche exponiert und kann strategisch eine bessere Stelle für den Einbau von heterologen Liganden sein als der periphere H-I-Loop (Krasnykh, V. et al., 1998, J. Virol., 72: 1844-52) des Knob-C-Terminus (Michael, S. I., et al., 1995, Gene Ther, 2: 660-8., Wickham, T. J. et al.,1996, Nat. Biotech Vol, 14:1570-3.), von anderen verwendete Substitutionsstellen. Somit werden diese G-H-Loop Modifikationen innerhalb der Fiber-Knob-Domäne es ermöglichen, den Ad Vektor zur Infektion bestimmter ZellTypn umzuleiten, so lange wie die G-H Loop-Ligandensequenz an wenigstens ein Oberflächenprotein des gewünschten Zelltyps bindet. Einige mögliche Substitutionen sind in 7 gezeigt. Beispiel II J zeigt, dass das Virion die Insertion eines zyklierenden Peptids (12 Aminosäuren) mit einer beschränkten Sekundärstruktur erlaubt, die die Exposition auf der Knob-Oberfläche ermöglicht. Ein definierter Ligand (RGD) kann in den G-H und den H-I Loop eines Ad5 Kapsids integriert werden, dem CAR und Tropfismus für Integrin fehlen. Infektionsuntersuchungen zeigen den möglichen Vorteil dieser neuen Insertionsstelle.

Verwendung der erfindungsgemäßen Vektoren für die „Gentherapie"

Die Leber ist das Hauptorgan für die Proteinsynthese. Somit besteht ein wichtiges Ziel der Gentherapie darin, Gentherapievektoren zur Leber zu dirigieren. Zur genetischen Korrektur von vielen Arten von mutierten Proteinen müssen Hepatocyten mit Gentherapievektoren infiziert werden, die ein korrigiertes Transgen tragen. Beispiel II J beschreibt eine G-H Loop Substitution in der Knob-Domäne des Fiberproteins gegen RI und RII+ (des Malaria Circumsporozoiten-Oberflächenproteins) in einem Fiberprotein mit kurzem Schaft, das dazu führt, dass der Vektor Affinität und Spezifität für Hepatozyten hat.

Beispiel II K wendet ein ähnliches Protokoll zur Veränderung der Fiber-Knob-Domäne in der G-H Loop Domäne mit Peptiden an, die den Vektor zu Brustkrebszelllinien steuern (MDA-MB-435). Diese neuartigen Ansätze zur Umleitung von Vektoren ermöglichen es, dass eine niedrigere Dosis an Gentherapievektoren mit einem höheren Sicherheitsprofil verabreicht werden kann.

In Beispiel II L wird ein Protokoll zur Herstellung einer Adenovirus Display-Bibliothek beschrieben, die das Fiber-Knob Protein dazu verwendet, eine Bibliothek von zufälligen Peptidsequenzen innerhalb des G-H Loops darzustellen. Diese Bibliothek von modifizierten Adenoviren mit modifizierten Fiberproteinen wird auf Affinität und Spezifität auf einen bestimmten Zelltyp gescreent. Es gibt zwei hauptsächliche Vorteile, diese Adenovirus-Displaybibliothek für das Screening auf Targetpeptide zu verwenden, die Bindung an einen gewünschten Zelltyp erlauben gegenüber einer Phagenbibliothek., Zunächst wird ein Ligandenpeptid identifiziert, das an den gewünschten Zelltyp bindet und bereits in dem gewünschten Gentherapievektor inseriert ist. Das Peptid muss nicht in einen anderen Vektor umgesetzt werden, wie es bei Phagendisplay-Vektoren der Fal ist. Dies vermindert die Schritte, die nötig sind, um ein Fiberprotein für einen gewünschten Zelltyp zu identifizieren. Der zweite Vorteil dieses Verfahrens besteht darin, dass die Adenoviren in der Lage sind, viele Kopien des modifizierten Fiberproteins auf ihrer Oberfläche zu präsentieren. Dies ermöglicht die Dimerisierung und Trimerisierung des Fiberproteins mit dem Wirtszellrezeptor. Die Multimerisierung der Fiberproteine ist eine realistische, in vivo Wechselwirkung des trimeren Fiberproteins mit dem Wirtszellrezeptor. Dagegen können Phagenvektoren nur eine Fiber-Peptidsequenz auf ihrer Oberfläche präsentieren, was die Möglichkeit zur Interaktion mit Oberflächenrezeptoren des Wirts signifikant beschränkt.

C. Ein chimärer Adenovirus Vektor mit selektivem Tropismus:

Die erfindungsgemäßen chimären Vektoren kombinieren zwei Vektoren: einen Ad.ITR und einen Ad.fx wobei fx ein modifiziertes Fiberprotein beschreibt. Eine erste Generation von Adenovirus-Vektoren des Serotyps 5 ist der Basisvektor, der eine Transgenkassette, flankiert von heterologen ITRs trägt. Diese spezifischen ITRs, wie AAV ITRs steuern die stabile Integration der Transgenkassette in das Wirtsgenom und kontrollieren auch vorhersagbare genomische Rearrangements, die während der Virusreplikation auftreten. Dieser Vektor kann auch ein modifiziertes Fibergen enthalten (wie in Beispiel II beschrieben). Während der Replikation ereignen sich vorhersagbare genomische Rearrangements, die in der Erzeugung eines gutless Adenovirus-Vektor resultieren (z.B. &Dgr;Ad.AAVfx), der das modifizierte Fiberprotein auf seinem Capsid exprimiert. Das modifizierte Fiberprotein ermöglicht es dem gutless Vektor, auf einen bestimmten Zelltyp gerichtet zu sein. Der gerichtete Vektor ist ein gutless adenovirus Vektor, der frei von adenoviralen Genen ist und in das Wirtsgenom integrieren kann. Die Transgenkassette kann Reporter, selektierbare oder therapeutische Gene enthalten.

In einer Ausführungsform der Erfindung trägt der &Dgr;Ad.AAVfx gutless targeted Vektor das Reportergen &bgr;-Galactosidase, &Dgr;Ad.AAVfx-BG). Für die einfache in vitro Selektion menschlicher und bakterieller Zellen, die mit dem hybriden Ad Vektor transduziert sind, kann eine bakterielle Sequenz für den Replikationsursprung zu den hybriden Ad Vektoren zugegeben werden. Ein Beispiel davon ist &Dgr;Ad.AAVfx-Snori, in dem eine SNori-Cassette zur Transgenkassette hinzugefügt ist. Diese Stelle ermöglicht die G418 Selektion von Zellen, die mit &Dgr;Ad.AAVfx-Snori transfiziert sind. Diese in vitro Selektion ermöglicht ein Werkzeug zur Analyse der Transgenintegration und der flankierenden chromosomalen Bereiche. Fluoreszenzin situ Hybridisierung (FISH) ist ein alternatives Verfahren zur Bestätigung der Vektorintegration.

Ein Vorteil des &Dgr;Ad chimären Vektor für den Gentransfer ist die wirksame und stabile Integration einer großen Transgenkassette bis zu 22 kb, die signifikant größer als die Kapazität retroviraler Vektoren ist. Dies ist für die Gentherapie von besonderem Interesse. So kann z.B. zur Linderung der Sichelzellanämie &Dgr;Ad.AAVfx-yGlobin, eine Expressionskassette mit dem gamma-Globin Gen, das integriert, für eine Langzeitexpression des Globingens in Knochenmarksstammzellen inseriert werden.

Zum Erreichen einer ortsspezifischen Integration wird das rep78 Protein zur Integration in die AAVS1 Stelle (siehe Beispiel 1D) verwendet. Dies kann jedoch zum Silencing der Genexpression führen. Um das Silencing von Transgenen durch Wirtsfaktoren zu verhindern (wie positionelle Effekte oder stromabwärts Effekte), können LCRs oder Insulatorelemente in die Transgenkassette eingebaut werden.

Die folgenden Beispiele sind veranschaulichend gedacht und zur Anleitung für den Fachmann, die Erfindung durchzuführen. Die Beispiele sind nicht in beschränkender Weise aufzufassen.

BEISPIEL 1 NEUER ADENOVIRALER VEKTOR Ad.AAV A. Integrierende &Dgr;Ad.AAV Vektoren, die frei von alen adenoviralen Genen sind

In vitro und in vivo Untersuchungen mit rAAV zeigen, dass das einzige Erfordernis für rAAV Integration die AAV ITRs und andere, bisher unbekannte zelluläre Faktoren des Wirts sind. Man nimmt an, dass spezifische Sequenzen oder sekundäre Strukturen, die in AAV ITRs anwesend sind, dazu veranlagt sind, in chromosomale DNA des Wirts zu integrieren. Um die Vorteile von adenoviralen Vektoren (hoher Titer, hohe Infektiosität, große Kapazität) und die Integrationsfähigkeit von AAV ITRs, AAV Vektor-DNA mit AAV ITRs flankierenden Kassetten zu kombinieren, wurde eine Reportergenkassette, umfassend sekretierte menschliche alkalische Phosphatase (SEAP) – Neomycin Phosphotransferase (neo) (Alexander, I. E., et al. 1996, Gene Therapy, 7, 841-850) in den E1-Bereich von E1/E3 deletierten adenoviralen Vektoren eingebaut (Ad.AAV1) (1, oben).

VERFAHREN Herstellung/Charakterisierung von viralen Vektoren Plasmide:

Die AAV1 Vektorkassette, die AAV ITRs und SEAP/neo Expressionseinheiten enthält, wird durch AseI/ScaI Verdau des Plasmids pALSAPSN (Alexander, I.E. et al., 1996, Human Gene Therapy, 7:841-50) erhalten. Das 4.4 kb große AAV Vektorfragment wurde durch NotI Adapterlinker in pXJCL1 (Microbix, Toronto, Canada) (pAd.AAV1) kloniert. Ein anderer shuttle Vektor (pAd.AAV1-&Dgr;2ITRs), der keine AAV ITRs enthält, wird durch Insertion eines 3.7 kb großen AflII/BsmI Fragments von pALSAPSN in pXJCL1 erhalten. Für pAd.AAV1&Dgr;IITR wird ein Konstrukt verwendet, in dem eine spontane Deletion in den linken AAV ITRs zwischen den A und A' Bereichen aufgetreten ist. Zur Erzeugung eines zweiten hybriden Vektors (Ad.AAV2) wird die von Rutledge entwickelte AAVSNori Kassette verwendet. AAV Vektor DNA wird aus pASNori (Rutledge, E. A., Russell, D. W. 1997. Journal of Virology 71: 8429-8436) als ein 3.4 kb großes BsaI/SCAI Fragment erhalten und in die EcoRV Stelle von pXCJLi inseriert. Wie man es im algemeinen für AAV Vektorpeptide weiß, sind AAV ITRs prädisponiert für Rearrangements. Zur Minimierung von Deletionen in diesen funktionellen kritischen Regionen werden ale Konstrukte zur Erzeugung von Hybridvektoren in Plasmiden mit niedriger Kopiezahl assembliert, die in E. coli Top 10, JC811 oder XL1 Bluecell (Stratagene, La Jolla, Calif) kultiviert werden. Weiterhin werden nach jedem Klonierungsschritt oder nach jeder Plasmidamplifikation in großem Maßstab ale AAV ITRs durch Restriktionsanalyse mit Enzymen, die innerhalb oder benachbart zu den ITRs schneiden (BssHII, AhdI, SmaI, BgII, BsmI, AflII und ScaI), gemappt.

Adenoviren:

Viren der ersten Generation, in die verschiedene Transgenkassetten in den E1 Bereich eingebaut sind werden durch Rekombination der von p&Dgr;E1aSpla- oder pXCJL1 abgeleiteten Shuttleplasmide und pJM17 (Microbix) in 293 Zellen wie zuvor beschrieben (Lieber, A., et al., 1996, J. of Virology, 70, 8782-8791) erzeugt. Für jedes Virus werden wenigstens 20 Plaques gepickt, amplifiziert und durch Restriktionsverdau analysiert. Viren, die zwei AAV ITRs enthalten, tendieren zum Rearrangement zwischen den ITRs mit anderen adenoviralen Sequenzen oder mit adenoviralen Sequenzen, die im Zellgenom von 293 Zellen vorhanden sind. Nur Plaques aus intakten Viren werden amplifiziert, in CsC1-Banden aufgetrennt und wie früher beschrieben titriert (Kay, M. A., et al. 1995. Hepatology 21: 815-819; Lieber, A., et al. 1996. Journal of Virology 70: 8944-8960). Alle untersuchten Viruszubereitungen sind für RCA und für bakterielles Endotoxin negativ (Lieber, A., et al.1997. Journal of Virology 71: 8798-8807). Virus wird bei –80°C in 10mM Tris-HCl, pH 7,5-1mM MgCl2-10% Glycerin gelagert.

Zur Erzeugung von &Dgr;Ad.AAV werden 293 Zellen mit Ad.AAV1 in einer MOI von 25 infiziert und 40 h nach Infektion geerntet. Zellen werden in PBS durch 4 Zyklen von Einfrieren/Auftauen lysiert. Lysate werden zentrifugiert um Zelldebris zu entfernen und für 30 min bei 37°C mit 500 Einheiten/ml DNAseI und 200 &mgr;g/ml RNAseA in Anwesenheit von 10 mM MgCl2 verdaut. 5 ml Lysat werden auf einen CsCl-Schrittgradienten (0,5 ml – 1,5 g/cm3, 2,5 m1-1,35g/cm3, 4ml – 1,25g/cm3) geschichtet und für 2 h bei 35000 rpm ultrazentrifugiert (Rotor SW21), CsCl-Fraktionen werden durch Punktion des Röhrchens geerntet und auf virale DNA analysiert (Lieber, A., et al. 1996. Journal of Virology 70: 8944-8960; Steinwaerder, D. S., et al. 1999. J Virol 73: 9303-13) oder einer Ultrazentrifugation bei 35000 rpm für 18 h in einem Äquilibriumgradienten mit 1,32 g/cm3 CsCl unterzogen. Die Bande, die die deletierten Viren &Dgr;Ad.AAV enthält, ist von anderen viralen Partikel, die vollständige Ad.AAV Genome enthalten, klar getrennt (Abstand 0,5 cm). &Dgr;Ad.AAV1 Fraktionen werden gegen 10 mM Tris-HCl, pH 7,5-1 mM MgCl2-10% Glycerin dialysiert und bei –80°C gelagert. Der Genomtiter der &Dgr;Ad.AAV1 Präparationen wird bestimmt basierend auf der quantitativen Southern Analyse viraler DNA, aufgereinigt aus viralen Partikeln im Vergleich zu unterschiedlichen Konzentrationen eines 4,4 kb großen AseI/ScaI Fragments aus pALSAPN gemäß einem früher beschriebenen Protokoll (Lieber, A., et al., 1996, J. of Virology, 70, 8782-8791). Insgesamt erfordert die Erzeugung von 1 × 103 Genompartikel von &Dgr;Ad.AAV1 weniger als 3 h tatsächliche Arbeit.

Routinemäßig erhaltene Titer liegen im Bereich von 3–8×1012 Genome pro ml. Unter der Annahme, dass pro Kapsid ein Genom verpackt ist, ist der Genomtiter zum Partikeltiter identisch. Das Ausmaß an kontaminierendem Ad.AAV1 beträgt weniger als 0,1 % wie durch Southern Analyse bestimmt, was mit Ergebnissen übereinstimmt, die man durch einen Plaque-Assay auf 293 Zellen durchgeführt hatte (weniger als 5 Plaques pro 106 vollständige Genome). Die für die Sequenzierung der linken und rechten ITR-Vektor-Verbindung verwendeten Primer sind

5'GGCGTTACTTAAGCTAGAGCTTATCTG, und

5'CTCTCTAGTTCTAGCCTCGATCTCAC.

Der in diesen Untersuchungen verwendete rekombinante AAV Virus-Stock, der die SEAP/neo Kassette enthält (AV2/ALSAPSN) [Alexander, I. E. et al, 1996, Human Gene Therapy, 7: 841-50] wurde von Dusty Miller (FHCRC, Seattle) erhalten. Der Stock war frei von kontaminierenden replikationskompetenten AAV (< 50 Partikel/ml) und Wildtyp-Adenovirus (< 100 Partikel/ml). Der Genomtiter des Virus-Stock wurde durch quantitativen Southern bestimmt, wie beschrieben durch Russell et al. (Russell, D. et al. 1994 Proc. Natl. Acad, Sci. USA 91: 8915-8919).

Elektronenmikroskopie:

Zur Untersuchung der viralen Partikel in Transmissions-Elektronenmikroskopie-Untersuchungen wurden CsCl-aufgereinigte Virionen mit Glutaraldehyd fixiert und mit Uranylacetat wie beschrieben gefärbt (Lieber, A., et al. 1996. Journal of Virology 70: 8944-8960).

ERGEBNISSE

Während der Replikation dieser hybriden Vektoren in 293 Zellen wird ein 5,5 kb großes Genom (&Dgr;Ad.AAV1) effizient erzeugt und in Adenovirus (Ad5) Capside verpackt. Das &Dgr;Ad.AAV1 Genom enthält die linke Adenovirus ITR und das Verpackungssignal, gefolgt von der AAV-Vektorkassette und einem Duplikat des adenoviralen Verpackungssignals und der ITR in reverser Orientierung (1 , unten). Der hybride Vektor enthält keine viralen Gene, wodurch mögliche toxische Effekte und die Auslösung zellulärer Immunantworten vermieden wird. Die spontane Bildung des kleinen hybriden Vektorgenoms &Dgr;Ad.AAV1 erfordert die Anwesenheit von zwei intakten AAV ITRs und tritt nicht mit teilweise deletierten ITRs oder Oligo-dC und Oligo-dG-Bereichen auf, die die Expressionskassette flankieren.

Hubridvektoren die unterschiedliche Transgene enthalten:

Zur Erzeugung eines Hybridvektors mit einem Transgen, das in situ nachgewiesen werden kann, wird die SEAP/neo Expressionseinheit in Ad.AAV1 durch das &bgr;-Galactosidase-Gen von E.coli ersetzt. Dieser hybride Vektor wird als &Dgr;Ad.AAV1 bezeichnet. Während der Herstellung der entsprechenden Plasmidkonstrukte tendieren die AAV ITR Sequenzen dazu, zu rearrangieren und ihre funktionalen Eigenschaften zu zerstören. Dieses Problem kann durch Verwendung von Plasmiden in niedriger Kopiezahl als Klonierungsvektoren umgangen werden, die in Bakterienstämmen wachsen, denen ale Rekombinationsproteine fehlen (z.B. JC811). Weiterhin kann die Intaktheit beider AAV ITRS nach jedem Klonierungsschritt durch charakteristischen Endonukleasenverdau untersucht werden. Kürzlich wurde ein anderer Hybridvektor, &Dgr;Ad.AAV1Nori erzeugt, der das neo Gen unter der Kontrolle sowohl des Affenvirus 40 (SV40) frühen Promoter als auch unter dem Transposon 5 (Tn5) Promoter für die Expression in menschlichen und bakteriellen Zellen trägt, als auch den p15A bakteriellen Replikationsursprung mit der Richtung der DNA Synthese des leading Strang entgegen der der neo Transkription. Somit kann SNori für die G418 Selektion von integriertem Vektor in eukaryotischen Zellen als auch für die Rettung von Vektor zusammen mit der flanierenden Wirts-DNA nach der Integration verwendet werden. Die geernteten Plasmide können in E. coli unter Selektion mit Kanamycin aufgrund des bakteriellen Ursprungs des Gens und des neo Gens vermehrt werden. SNori-enthaltende Vektoren ermöglichen eine schnelle Abschätzung der gesamten Integrationsereignisse basierend auf der Anzahl von G418-resistenten Kolonien. Weiterhin kann Vektor-DNA zusammen mit flankierender chromosomaler DNA als Plasmid aus einzelnen G418-resistenten Klonen geerntet und zur Sequenzierung zur Bestimmung von Integrationsstellen verwendet werden. Beide Hybrid-Vektoren werden in einem Titer von etwa 3 × 1012 Genomen pro ml erzeugt. Das Verhältnis von Genomtiter zu transduzierenden Partikeln für &Dgr;Ad.AAVBG beträgt 200:1 basierend auf der &bgr;-Gal Expression.

DISKUSSION

&Dgr;Ad.AAV1 konnte sich spontan während der Adenovirus-Replikation bilden. Ein weiterer möglicher Mechanismus der Bildung von &Dgr;ad.AAV1 basiert auf dem einzigartigen Mechanismus, nach dem Adenovirus sein Genom repliziert (van der Vliet, B., 1995, In W. Doerfler, et al. (Hrsg) Bd. 2 p.1-31, Springer-Verlag, Berlin) (siehe 1). Ad DNA Replikation wird durch das TP/pTP (terminales Protein) initiiert, das an spezifische Stellen innerhalb der ITRs auf beiden Enden des linearen Genom bindet und zusammen mit Ad pol, die Bindung von 5' CTP, dem ersten Nukleotid des Tochterstrangs katalysiert. Nur einer der DNA Stränge dient als Template. Eines der Replikationsprodukte ist eine einzelsträngige DNA, die durch Anlagerung ihrer selbst-komplementären ITRs zirkularisiert. Der entstehende „Pfannenstiel" hat die gleiche Struktur wie die Termini des Duplex-viralen Genoms, die die Bindung von pTP und den Beginn der Synthese eines komplementären Strangs unter Verwendung des Pfannenstiel-Molekül als Matrize ermöglichte (1C). Bei Ad.AAV1 synthetisiert Ad pol den einzelnen Strang des adenoviralen Genoms, beginnend von dem linken ITR bis es den rechten AAV ITR erreicht. Während der Synthese des zweiten AAV ITR bildet ein bestimmter Prozentsatz der einzelsträngigen Moleküle eine Schleife, die an einen komplementären Bereich innerhalb der ersten AAV ITR hybridisiert, der zuvor repliziert wurden, wodurch Ad pol den gleichen viralen DNA Strang verwenden kann, um zurück zum linken ITR zu lesen (1B). Die entstehende „Pfannenstiel"-Struktur kann auf gleich Weise wie das Gesamtlängen-Intermediat in 1A aufgelöst werden, unter Entstehung eines doppelsträngigen, linearen Moleküls mit oben beschriebener Struktur, das in Ad Virionen verpackt werden kann. Das Verhältnis von viraler DNA zu Proteinkonzentration in gereinigten &Dgr;Ad.AAV1 Partikeln ist vergleichbar zu dem, das man aus Ad.AAV1 Partikeln erhält. Dies zeigt, das trotz der kleineren Größe nur ein &Dgr;ad.AAV1 Genom verpackt wird, wodurch Partikel mit einer leichteren Dichte entstehen (1,32 g/cm3). Elektronenmikroskopie zeigt die ikosaedrische Form der &Dgr;ad.AAV1 Partikel (2). Färbung mit Uranylacetat führt dazu, dass die zentralen viralen Kerne elektronendicht erschienen. &Dgr;ad.AAV1 Virionen haben nur eine punktförmige leuchtende dunkle Färbung, wie man erwarten würden wenn nur ein 5.5 kb großes Genom pro Kapsid verpackt ist.

B. In vitro Erzeugung von &Dgr;Ad.AAV1: Eigenschaften von deletierten Adeno-AAV Vektoren (&Dgr;ad.AAV):

Eine Anzahl von Experimenten zur Klärung der Mechanismen der Bildung des &Dgr;ad.AAV Genoms werden durchgeführt. Die Anwesenheit zweier intakter AAV ITRS, die eine Reportergenkassette flankieren, ist insbesondere erforderlich für die effektive Bildung von &Dgr;ad.AAV Genomen. Dieser Prozess findet nicht statt, wenn die ITRs partiell deletiert sind und wenn oligo-dG Bereiche die Expressionskassette flankieren. Weiterhin werden in vitro Transduktionsuntersuchungen mit unterschiedlichen Genomtitern von &Dgr;Ad.AAV1, Ad.AAV1 und Ad.AAV1-&Dgr;2ITRS (ohne die beiden AAV ITRs) durchgeführt, die die Anzahl von G418 resistenten Kolonien bestimmen, die sich nach 4 Wochen Selektion gebildet haben (Tabelle 1) &Dgr;ad.AAV1 wird in einem hohen Titer (5 × 1012 Genome pro ml mit > 104 erzeugten Genomen pro 293 Zelle) und in hoher Reinheit mit weniger als 0,1 % kontaminierenden Gesamtlängengenomen von Ad.AAV1 erzeugt mit einem Verfahren, das normalerweise für die Amplifikation und die Aufreinigung eines rekombinanten Adenovirus verwendet wird.

In vitro Transduktionsuntersuchungen mit hybriden Vektoren auf CD34+ Zellen und Erythroleukämiezellen:

Um zu testen, ob die hybriden Vektoren den Gentransfer in ZellTypn ermöglichen, die für die Therapie von Sichelzellen angesprochen werden müssen, wurden Infektions-/Transduktionsuntersuchungen mit CD34+ angereicherten menschlichen Knochenmarkszellen durchgeführt, die aus mobilisiertem peripheren Blut abgeleitet sind und mit der menschlichen Erythroleukämie-Zelllinie K562, die epsilon und gamma-Globingene exprimiert.

VERFAHREN: Zellkultur:

SKHep 1 Zellen (HTB-52 ATCC, Rockville, MD) eine endotheliale Zelllinie, die von humaner Leber abgeleitet ist [Heffelfinger, S. C., et al., 1992, In vitro Cell Dev. Biol. 28A, 136-4-142], werden in stark glucosehaltigem Dulbeccos modified Eagle Medium mit 10% fötalem Kälberserum kultiviert. SKHep1 Zellen werden durch Southern Analyse genomischer DNA auf integrierte AAV Proviren untersucht und unter Verwendung des AAV1 Wildtyp-Genoms aus pAAV/Ad (Samulski, R. J., et al. 1989.Journal of Virology 63: 3822-3928) (Geschenk von David Russell, University of Washington) als Sonde analysiert. In unverdauter SKHep1 DNA oder nach Verdau mit HindIII werden keine spezifischen Banden nachgewiesen. Zur viralen Infektion werden konfluente Zellen mit verschieden Dosen an Virus für 2 Stunden inkubiert, gefolgt von intensivem Waschen. Für die G418 Selektion werden 24 h nach Infektion mit &Dgr;Ad.AAV1 die SKHep1 Zellen trypsiniert und in verschiedenen Verdünnungen unter G418 Selektion (900 &mgr;g/ml aktive Verbindung, Boehringer-Mannheim, Deutschland) plattiert, Medium, das G418 enthält, wird ale drei Tage gewechselt. Die Anzahl von Kolonien mit > 104 Zellen wird 4 Wochen nach der Selektion gezählt und durch die Anzahl der anfänglich ausgesäten Zellen geteilt., Dieses Verhältnis wird dazu benützt, die Integrationsfrequenz von &Dgr;Ad.AAV1 zu bestimmen. Einzelkolonien werden erhalten durch limitierende Verdünnung infizierter Zellen in 96 Lochplatten. Kolonien werden in Anwesenheit von G418 auf 1 × 106 Zellen expandiert. Immunfluoreszenzanalyse auf adenovirale Proteine, die in SKHep 1 Zellen 3 Tage nach Infektion exprimiert werden, wird wie früher beschrieben durchgeführt [Lieber, A., et al., 1996, J. of Virology, 70,8782-8791].

ERGEBNISSE

293 Zellen werden mit der ersten Generation von Vektor Ad.AAV1 infiziert. Während der Replikation von Ad.AAV1 bildet sich das kleine &Dgr;Ad.AAV1 Genom spontan und wird in das Adenovirus Capsid verpackt. 36 h nach der Infektion werden die Zellen geerntet und das Virus wird durch einige Zyklen Einfrieren/Auftauen freigesetzt. Das Gemisch von Ad.AAV1 und &Dgr;ad.AAV1 Partikeln in dem Zelllysat wurde dann durch Ultrazentrifugation in einem CsCl Gradienten aufgetrennt. Aufgrund der geringeren Dichte wird die Bande, die &Dgr;Ad.AAV1 Partikel enthält, deutlich (0.8 cm Distanz) von der Bande getrennt, die das Virus mit der gesamten Länge enthält (Lieber, A., et al. 1999. J Virol 73 : 9314-24). &Dgr;Ad.AAV1 wird weiter durch einen zusätzlich CsCl-Gleichgewichtsgradienten aufgereinigt und wird in 10 mM Tris pH 7.5, 10 % Glycerin, 1mM MGCl2 in –80°C gelagert. Die Erzeugung von 2 × 103 (Genom)Partikeln von &Dgr;Ad.AAV1 erfordert weniger als 3 h Arbeit. Alle Funktionen für die Replikation von &Dgr;AD.AAV1 und die Bildung von Partikeln werden von den Ad.AV1 Genomen bereitgestellt, die in der gleichen Zelle amplifiziert werden. Die Effizienz der Vektorbildung, gemessen auf einer Genom-Pro-Zelle-Basis ist vergleichbar oder höher als bei arbeitsintensiveren, neueren Techniken für die Erzeugung von rAAV, die sich noch nicht als zuverlässig erwiesen haben. Das abgeschätzte Verhältnis von Transduktion/Genomtiter für &Dgr;ad.AAV1 beträgt 1:200 (basierend auf SEAP Expression 3 Tage nach Infektion), wobei die durchschnittliche rAAV Zubereitung im Bereich von 1:103 bis 1:104 liegt. 1 × 105 konfluente SKHep1 Zellen werden mit unterschiedlichen MOI von rAAV (Stock: 1 × 1010 Genome pro Zelle), &Dgr;AD.AAV1 (Stock: 5 × 1012 Genome pro ml), Ad.AAV1 (Stock: 1 × 1013 Genome pro ml) und AdAAV1,2ITR (Stock 9 × 1012 Genome pro ml) in einem Volumen von 100 ml 24 h nach der Infektion infiziert, die Zellen werden gewaschen, trypsiniert und in verschiedenen Verdünnungen plattiert. G418 wurde 24 h nach der Plattierung zugegeben und die Selektion wird für 4 Wochen durchgeführt. G418-resistente Kolonien enthalten durchschnittlich >5 × 104 Zellen (wenigstens 16 Zellteilungen). Eine signifikante Zahl von kleinen Kolonien, die 2 Wochen nach Infektion sichtbar sind, überleben die fortgesetzte Selektion nicht, wahrscheinlich aufgrund Expression von episomalem Vektor. Zellen, die mit Adenoviren der ersten Generation mit MOIs höher als 1 × 104 infiziert wurden, entwickeln während der ersten Woche der Selektion CPE. Der rAAV Titer ist nicht hoch genug, um Infektionsuntersuchungen mit MOIs höher als 104 durchzuführen. Die Bildung von Kolonien wird als Prozentsatz der Anzahl an Kolonien nach Selektion ausgedrückt zu der Zellzahl, die anfänglich für die Selektion ausgesät wurden (Tabelle I).

TABELLE I Bildung von G418-resistenten Kolonien nach Infektion mit hybriden Viren im Vergleich mit rAAV.
  • N=3 (Standardweichung ist in Klammern angegeben)

K562 Zellen werden mit verschiedenen MOIs von &Dgr;Ad.AAVBG (1–108 Genome pro Zelle) infiziert:

Drei Tage nach der Infektion werden die Gesamtzahl an lebensfähigen Zellen (basierend auf Trypanblau-Färbung) und der Prozentsatz an infizierten Zellen (basierend auf X-Gal Färbung) für ale MOIs bestimmt. Die Ergebnisse sind in 4A dargestellt.

Erste Integrationsuntersuchungen:

K562 Zellen werden mit &Dgr;Ad.AAVSNori bei einer MOI von 2 × 105 Genomen pro Zelle inkubiert und die Kolonien, die sich nach 4 Wochen unter G418 Selektion gebildet haben, werden in 96-Lochplatten gezählt. G418-resistente Kolonien enthalten im Durchschnitt >5 × 104 Zellen, was bedeutet, das die Ausgangszellen wenigstens 16 Zellteilungen durchgemacht haben.

Infektionsuntersuchungen mit Ad.AAVBG (1-108 Genome pro Zelle ) auf CD34+ Zellen:

Zellinfektion von CD34+ verlief wie bei K562 Zellen. CD34+ Zellen werden in IMDM kultiviert, das mit 20% FCS, KitLigand (Stammzellfaktor-SCF) (100 ng/ml) und IL-3 (100 ng/ml) ergänzt war. Da eine Anzahl von Berichten nahe legt, das spezifische Cytokine wie GM-CSF oder M-CSF, die die Differenzierung von Stammzellen induzieren, die Expression von Integrinen stimulieren und damit die Internalisierung von Ad5 Vektoren beeinflussen könnten, werden die Infektionsraten mit auf Ad5 basierenden Hybridvektoren auf CD34+ Zellen verglichen, die mit und ohne Prä-Stimulierung von GM-CSF (50 ng/ml) oder M-CSF (50 U/ml) kultiviert wurden. Die Anzahl an infizierten Zellen wird gezählt, basierend auf der X-Gal-Färbung am Tag 3 nach der Infektion. Um auf dosisabhängige Toxizität zu testen, werden lebensfähige Zellen gezählt (basierend auf Trypanblau-Ausschluß) am Tage 3 nach der Infektion. Weiterhin wird analysiert, ob hohe virale Dosen die Fähigkeit von CD34+ Zellen beeinflussen, in Methylcellulose-Kolonieassays in Anwesenheit von I1-3 und SCF zu differenzieren. Die Ergebnisse werden als lebensfähige Zellen/X-Gal positive Zellen vs. MOI dargestellt (siehe 4B).

DISKUSSION

Die oben gezeigten Daten zeigen, das &Dgr;Ad.AAV eine immortalisierte humane Zelllinie mit einer niedrigen Frequenz transduziert, die zu rAAV vergleichbar ist. Die Transduktionsraten konnten jedoch bei Verwendung von größeren MOIs von &Dgr;AD.AAV1, der in höheren Titern als rAAV1 produziert wurde, bis zu 100% aufgestockt werden. Im Gegensatz zur Infektion mit dem Vektor der ersten Generation, Ad.AAV1, ist die Infektion mit &Dgr;ad.AAV1 nicht mit dosisabhängiger Cytotoxizität assoziiert, da von diesen Vektoren in transduzierten Zellen keine viralen Proteine exprimiert werden. Weiterhin sind virale Proteine, die in eintretenden &Dgr;ad.AAV1 Partikel anwesend sind, nicht problematisch in dem verwendeten Dosierungsbereich. Der Vergleich von Transduktionsraten von &Dgr;ad.AAV1/Ad.AV1 mit dem Vektor ohne AAV ITRs, Ad.AAV.&Dgr;2ITRs unterstützt die Hypothese, das die Anwesenheit von zwei intakten AAVITRs für die Integration des hybriden Vektors zwingend ist.

Die Daten zeigen, das die Leukämiezelllinie in einer zu ~90% Effizienz mit Ad5-basierten hybriden Vektoren bei MOIs von 2 × 105 Genomen pro Zelle infiziert werden kann, ohne signifikante toxische Nebeneffekte zu haben. Diese Dosis ist jedoch immer noch größer als die Dosis, die nötig ist, um 100% HeLa Zelle, Hepatomzellen, primäre Hepatozyten und andere Zelllinien zu infizieren, die im algemeinen als für die Ad5 Vektor Infektion permissiv angesehen werden.

Da virale DNA in Zellen, die mit 2 × 104 Genomen (oder 100 transduzierenden Partikeln pro Zelle) infiziert wurden, nach 7 Zellteilungen verloren gegangen sein sollte, legt die Anwesenheit von G418 resistenten Zellen in den beobachteten Kolonien nahe, dass &Dgr;Ad.AAVSNori Genome in das Wirtsgenom integriert werden oder stabil damit assoziiert sind. Basierend auf der Zahl an G418-resistenten Kolonien integriert eines aus 25,000 &Dgr;ad.AAVSnori Genomen stabil in K562 Zellen. Dies stimmt überein mit den Ergebnissen, die früher mit &Dgr;ad.AAV1 in SKHep1 Zellen erhalten wurden.

Die maximale Dosis, die für die Infektion von CD34+ Zellen (1 × 108) verwendet wurde, führt zu einer X-Gal Färbung von nur ~10% Zellen unabhängig von GM-CSF/M-CSF. Dies zeigt, das die offensichtliche Unfähigkeit von Ad5, CD34+ Zellen zu infizieren wahrscheinlich durch das Fehlen spezifischer Rezeptoren und/oder Integrinen auf der Zelloberfläche hervorgerufen wird. CD34+ Zellen tolerieren einen großen Bereich von viralen Dosierungen (1–107) ohne offensichtlichen Effekt auf die Zelllebensfähigkeit und die Gesamt-Zellzahl. Dies ist nicht überraschend, da zur Entwicklung von toxischen Effekten das Virus in die Zelle eintreten und virale Gene exprimieren muss. Hybride Vektoren können in einem Titer von 5 × 1012 Genomen pro ml erzeugt werden. Somit ist die maximale MOI, die für die Infektion (104 Zellen) verwendet werden kann, ~5 × 108 (in 100 &mgr;l Lagerungspuffer). Basierend auf den Infektionsuntersuchungen mit &Dgr;Ad.AAVBg kann diese Dosis nicht ausreichend sein, um CD34+ Zellen effizient zu transduzieren und um eine ausreichende Anzahl von G418-resistenten Kolonien zu erzielen.

C. In Vivo Eigenschaften von &Dgr;Ad.AAV1:

Virale DNA wird während der Virus-Amplifikation mit BrdU markiert, um die zelluläre/nukleäre Aufnahme des Vektors in situ zu untersuchen. Für Transduktionsuntersuchungen werden konfluente SKHep1 Zellen (humane endotheliale Zelllinie) mit 2000 Genomen &Dgr;ad.AAV1 oder Ad.AAV1 pro Zelle infiziert. Brdu markierte virale DNA wird in 100% Nuklei 3 h nach der Infektion für beide Viren nachgewiesen, was eine effiziente zelluläre/nukleäre Aufnahme der hybriden Virus-DNA zeigt.

ERGEBNISSE

Der &Dgr;ad.AAV1 Vektor transduziert eine Zelle in vitro unter Bildung von G418 resistenten Kolonien mit einer Effizienz von 17 oder 58%, nach Infektion mit einer MOI von 1 × 103 oder 1 × 104 Genomen pro Zelle. Etwa 2 × 104 &Dgr;ad.AAV1 Genome sind erforderlich, um einen stabilen Transfektanten zu erhalten. Da ale stabilen Kolonien integrierte &Dgr;ad.AAV1 Vektor-DNA enthalten, spiegelt diese Nummer die minimale Integrationsfrequenz von &Dgr;AD.AAV1 Vektor-DNA wider, die zu der von rAAV vergleichbar ist (Rutledge, E. A. et al., 1997, Journal of Virology, 71: 8429-36). Die Anzahl an G418 resistenten Kolonien spiegelt nicht notwendigerweise die Gesamtfrequenz an Integrationsereignissen wider, da nicht ale integrierten Kopien neomycin Phosphotransferase exprimieren, aufgrund chromosomalen Positionseffekten oder wegen unvollständiger Integration.

Das Fehlen adenoviraler Genprodukte in mit &Dgr;Ad.AAV transduzierten Zellen 3 Tage nach Infektion wird durch Immunfluoreszenz mit Antikörpern gegen die hauptsächlichen späten Proteine (Hexon, Fiber) und die frühen Proteine (DBP.E4-orf6) gezeigt. Exprimierte adenovirale Protein werden nur in Zellen nachgewiesen, die mit Ad.AAV1 infiziert sind. Die Tatsache, das Zellen, die mit &Dgr;Ad.AAV1 infiziert sind, keine potentiell cytotoxischen adenoviralen Proteine exprimieren, ist wichtig.

Während eine MOI von 1 × 104 Genomen pro Zelle der ersten Generation der Vektoren Ad.AAV1 cytopathische Effekte in SKHep1 Zellen am Tage 3p.i. induzieren, werden keine toxischen Nebeneffekte beobachtet, wenn SKHep1 Zellen mit &Dgr;Ad.AAV1 in einer Dosis von bis zu 1 × 108 Genomen pro Zelle infiziert werden. Da die Transduktionseffizienz deutlich dosisabhängig ist, ist &Dgr;Ad.AAV1 (der in Titer von >5 × 1012 Genomen pro ml erzeugt werden kann) in der Lage, Ad5 permissive Zelllinien oder Gewebe mit einer 100% Effizienz ohne assoziierte Toxizität stabil zu transduzieren.

Southern Analyse zeigt, dass &Dgr;Ad.AAV1 zufällig als Kopf-zu-Schwanz-Tandemwiederholung in das Wirtsgenom über den rechten AAV ITR integriert, wobei die andere Verbindung mit der chromosomalen DNA variabel ist und anderswo innerhalb der Transgenkassette auftritt. Zur Bestimmung des integrierten Zustands der &Dgr;Ad.AAV1 DNA wird chromosomale DNA mit hohem Molekulargewicht durch PFGE aufgetrennt, gefolgt von Southern Analyse mit einer SEAP-spezifischen Sonde (3). Unverdaute DNA aus Kontroll-SKHep1 Zellen ergeben ein endogenes SEAP-Signal, das mit chromosomaler DNA ko-migriert gerade unterhalb der Vertiefung (Spuren 1 und 5). Es werden keine episomalen Formen von &Dgr;Ad.AAV1 mit hohem Molekulargewicht nachgewiesen, wobei eine distinkte Bande von 35 kb sichtbar ist in DNA von SKHep1 Zellen, die 3 Tage nach Infektion mit dem Adenovirus der ersten Generation, Ad.AAV1 infiziert wurden (Spuren 4 und 13). Verdau mit EcoRI deckt das 4.4 kb Fragment auf, das für integrierte Tandemkopien der AAV Kassette spezifisch ist (Spuren 8 und 12). Zur Eliminierung der Möglichkeit, das chromosomale DNA in der Vertiefung gefangen ist, werden DNA Proben von Intron kodierten Endonucleasen PI-SceI oder I-CeuI (Gibco BRL, Grand Island, NY) mit einer Sequenzspezifität von mehr als 11 bp bzw. 9 bp inkubiert. Verdau mit PI-SceI erzeugt ein > 2mb großes endogenes SEAP-Signal in SKHep1 Zellen (Spur 2) und ein zusätzliches Signal im Bereich von ~1MB in G418-resistenten Kolonien, die mit &Dgr;Ad.AAV1 transduziert waren (Spur 7). Verdau mit I-CeuI führt zu einem Schmier zwischen 250–1000 kb in &Dgr;Ad.AAV1 transduzierten SKHep1 Zellen (Spuren 10, 11), was auf zufällige Integration hinweist, wobei eine Bande mit hohem Molekulargewicht, die spezifisch für das SEAP-Gen ist, in Kontroll Skhepl Zellen beobachtet wird (Spur 9).

Einen Tag nach der intraportalen Infusion von 1 × 1012 &Dgr;Ad.AAV1 Genomen in C57B1/6 Mäuse können mit BrdU markierte Vektorgenome in 85% der Hepatozyten nachgewiesen werden (Lieber, A., et al. 1999. J Virol 73: 9314-24). Analyse von hepatozellulärer DNA, durchgeführt 2 Monate nach der Infusion zeigt die Integration von &Dgr;Ad.AAV1 mit einem Durchschnitt von 0.5 Kopien pro Zelle in das Mausgenom (Lieber, A., et al. 1999. J Virol 73: 9314-24). Zur Bewertung möglicher Nebenwirkungen der portalen Infusion von &Dgr;Ad.AAV1 wird Serum-Glutamin-Pyruvat-Transaminase (SGPT), ein sensitiver Marker für Schäden an Hepatozyten für 7 aufeinander folgende Tage nach der Infusion in Kombination mit histologischer Analyse von Leber-Schnitten untersucht. Nach der intraportalen Infusion von 1 × 1012 oder 1 × 1013 &Dgr;Ad.AAV1 Genomen werden keine signifikante Erhöhung der SGPT-Spiegel, noch histologische Änderungen beobachtet, während die Infusion der gleichen Dosis an Gesamtlängen Ad.AAV1 Vektor mit starker Hepatotoxizität mit fatalem Ausgang assoziiert ist. Dies legt nahe, das die an Mäuse verabreichte Dosis von &Dgr;Ad.AAV1 erhöht werden kann, um in vivo höhere Transduktionseffekte ohne Nebenwirkungen zu erreichen, was für die Adenoviren der ersten Generation nicht möglich ist. Es ist wichtig zu wissen, dass &Dgr;Ad.AAV1 ruhende Hepatozyten in vivo transduziert, was nahe legt, dass die Integration die Zellproliferation nicht erfordert. Kürzlich wurden genauere Transduktionsuntersuchungen mit Ad.AAV1 und &Dgr;Ad.AAV1 in Balb/c Mäusen durchgeführt um zu untersuchen, ob die Abwesenheit von Expression von viralen Genen in &Dgr;Ad.AAV1 eine antivirale Immunantwort verhindern und die Vektorpersistenz verlängern kann. In diesem Mausstamm wird Vektor-DNA aus der Leber 4–6 Wochen nach der Infusion mit Adenoviren der ersten Generation gereinigt, hauptsächlich aufgrund einer CTL-Reaktion gegen virale Proteine, die in transduzierten Zellen erzeugt werden. Vektor-DNA wird durch genomischen Southern Blot von hepatischer DNA 12 Wochen nach Infusion von 1 × 1012 Genomen Ad.AAV1 oder &Dgr;Ad.AAV1 analysiert. Zu diesem Zeitpunkt kann in hepatischer DNA von Mäusen, die eine Infusion von Ad.AAAvl erhalten haben, kein vektorspezifisches Signal nachgewiesen werden, während ~0,3 Kopien von &Dgr;Ad.AAV1 Genomen pro Zellen in Leber von Mäusen nachgewiesen werden, die den hybriden Vektor erhielten, was wiederum die überlegenen Eigenschaften des hybriden Vektors zeigt.

D. Auswirkungen der Rep Koexpression auf die Integration von &Dgr;Ad.AAV1 Rep Expression nach Plasmidtransfektion:

Um zu testen, ob Expression von Rep die ortsspezifische Integration von &Dgr;Ad.AAV1 in humanen Zellen verstärken kann, wird eine Reihe von Rep Expressionsplasmiden erzeugt.

VERFAHREN

Der Rep ORF 68/78 (nt 285-2313), der die internen p19 und p40 Promoter enthält, wird aus pAAV/Ad (Samulski, R. J. et al., 1991, In B. N. Fields, et al. (Hrsg.), Fields Virology, Bd. 2 Lippincott-Raven Publisher, Philadelphia) durch Verdau mit BsaI/BsrI erhalten. Dieses Fragment, aus dem der AAV5 Promoter deletiert wurde, wird durch Adapterlinker unter den RSV oder den PGK Promoter vor das Bovines Wachstumshormon-Polyadenylierungssignal (bPA) in pAD.RSV oder pAD.pGK (Lieber, A., and Kay, M. A., 1996, J. of Virology, 70, 3153-3158; Lieber, A., et al., 1995, Human Gene Therapy, 6,5-11) kloniert.

ERGEBNISSE

Die entstehenden Plasmide (pRSvrep, pPGKrep) werden in 293 oder SKHep1 Zellen transfiziert, die meisten von den heterologen Promotoren (RSV oder PGK) exprimierten Rep Proteine sind Rep68 und Rep78, während die Transfektion des rep Gens unter dem Ad5 Promoter (pAAV/Ad) hauptsächlich zur Expression von Rep52/40 führt. Somit ist die Transfektion von pRSVrep und pPGKrep deutlicher, was eine starke Transaktivierung von AAV Promotoren durch E1A nahe legt, die in 293 Zellen erzeugt wird. Dieses Ergebnis zeigt, dass eine minimale Expression von Rep Proteinen notwendig ist, um Interferenzen mit der Replikation von Adenoviren zu verhindern.

Rep-vermittelte ortsspezifische Integration von dAd.AAV1.

Das Potential für eine ortsspezifische Intregration ist ein wichtiges Charakteristikum der neuen Ad Vektoren der Erfindung. In einer Ausführungsform wird die Integration von &Dgr;Ad.AAV durch Koinfektion mit Ad AAV gesteuert, der das rep 78 protein in 293 Zellen exprimiert, um die ortsspezifische Integration in die AAVS1 Stelle auf dem humanen Chromosom 19 zu erreichen. Damit diese Art der ortsspezifischen Integration in anderen Zellen als 293 Zellen auftritt, ist die Expression des E4 ORF6 nötig. Die Koinfektion mit &Dgr;Ad.AAV, &Dgr;Ad. Rep78 und &Dgr;Ad. E4-ORF6 ermöglicht die ortsspezifische Integration der &Dgr;Ad.AAV Transgencassette. Die Genome von &Dgr;Ad.rep78 und &Dgr;Ad.E4-ORF6 werden kurz nach der Transduktion abgebaut, wodurch mögliche Nebenwirkungen vermieden werden. Ortsspezifische Integration ist gegenüber der zufälligen Integration bevorzugt, die man bei rAAV und &Dgr;Ad.AAV sieht, um das Risiko von Insertionsmutagenese zu vermeiden.

Zur Bestätigung der funktionellen Aktivität von Rep68/78, die von pRSVrep exprimiert werden, um die ortsspezifische Integration von &Dgr;Ad.AAV1 zu vermitteln (5 und 6) kann ein vorläufiger Test durchgeführt werden. Humane pSKHep1 Zellen werden mit pRSv oder mit einem Kontrollplasmid (pRSVbGal) (Lieber, A., et al., 1995, Human Gene Therapy, 6,5-11) (Transfektionseffizienz von ~20%) transfiziert. Drei Tage nach der Infektion werden die Zellen trypsnisiert, in Agarose eingebettet, in situ lysiert, mit I-CeuI (eine von einem Intron kodierte Endonuclease mit einer Erkennungssequenz von mehr als 10 nt) verdaut, einer PFGE in einem 1 % Agarosegel unterzogen, und durch Southern Blot analysiert. Hybridisierung mit einer Sonde, die die AAVS1 Integrationsstelle bedeckt (1.7 kb EcoRI/BamHI Fragment aus dem Locus auf Chromosom 19) (Samulski, R. J. et al., 1991, In B. N. Fields, et al. (Hrsg.), FieldsVirology, Bd. 2 Lippincott-Raven Publisher, Philadelphia) zeigt eine AAVS1 spezifische Bande (240 kb) in I-CeuI verdauter DNA aus Zellen nach der Transfektion mit Kontrollplasmid (pCo) + &Dgr;Ad.AAV1 Infektion. Ein zusätzliches Signal im Bereich von 280 kb tritt auf in rep exprimierenden Zellen, die mit &Dgr;Ad.AAV1 (pRSVrep + &Dgr;Ad.AAV1) infiziert wurden, was auf eine ortsspezifische Insertion in die AAVS1 Stelle in einem bestimmten Prozentsatz von Zellen hinweist. Die Anwesenheit von Vektor DNA in dieser 280 kb Bande wird durch Rehybridisierung des gleichen Filters mit einer Transgen (SEAP)-spezifischen Sonde bestätigt. Zufällig integrierter &Dgr;Ad.AAV1 Vektor erscheint als diffuses SEAP Signal im Bereich von 280–680 kb (pCo+&Dgr;Ad.AAV1, pRSV+&Dgr;Ad.AAV1). Die spezifische ~1.9mb Bande auf Blots, die mit der SEAP-Sonde hybridisiert wurden, stellt ein I-CeuI Fragment dar, das das humane SEAP-Gen enthält.

Einbau von Rep68/78 Funktion in hybride Vektoren zur Stimulierung der ortspezifischen Integration

Überexpression von Rep hemmt die Replikation von Adenovirus DNA, wordurch die Ezeugung von rep exprimierenden Ad Vektoren durch herkömmliche Strategien verhindert wird. Zur Lösung dieses Problems muss signifikante Expression von Rep68/78 aus den hybriden Vektoren in Virus-produzierenden (293) Zellen verhindert werden, während transiente Rep Expression in Zielzellen (HSC) aufrechterhalten werden muss, um die ortsspezifische Integration zu gewährleisten. Unsere Hypothese besteht darin, das die spezifische Struktur des &Dgr;Ad.AAV1 hybriden Virus dazu verwendet werden kann, das rep Gen 68/78 in eine transkriptionell aktive Position unter die Kontrolle eines HSC spezifischen Promoters nur während den späten Phasen der Virusreplikation in 293 Zellen zu bringen. Dies wird die Amplifikation des hybriden Vektors in 293 Zellen ermöglichen, wodurch ein Virus mit höherem Titer generiert wird, das die eingebauten Funktionen von Rep68/78 nur in HSC aktiviert. Der algemeine Ansatz unserer Strategie zur Erzeugung von Rep exprimierenden hybriden Vektoren ist in 7 veranschaulicht. Die rep/Transgencassette wird zusammengebaut basierend auf dem linker Hand liegenden Shuttleplasmid, das zur Herstellung des rekombinanten Adenovirus verwendet wird. Das Gen, das für Rep68/78 kodiert, wird in 3'–5' Orientierung für die Transgen-Expressionskassette kloniert, die durch AAV ITRs flankiert wird. Zwischen der Transgencassette und dem rechten AAV ITR wird ein HSC-spezifischer Promoter inseriert mit der Richtung zu den adenoviralen E2, E3 und E4 Genen. Das rekombinante Genom wird durch Rekombination in E.coli erzuegt und Transfektion in 293 Zellen erzeugt Virus (Ad.AAV-rep). Die spezifische Struktur von &Dgr;Ad.AAV1 mit duplizierten Sequenzen, die die AAV ITRs flankieren, wird dazu verwendet, das rep Gen nur während der späten Phasen der viralen DNA-Replikation in 293 Zellen in eine transkriptionell aktive Position unter die Kontrolle eines für HSC spezifischen Promoters zu bringen. Während der Amplifikation von Ad.AAV-rep wird das kleinere Genom &Dgr;Ad.AAV-rep gebildet und in Partikel verpackt, die durch Ultrazentrifugation in CsCl-Gradienten aufgetrennt werden können. Die spezifische Struktur von &Dgr;Ad.AAV-rep bringt das rep Gen in 5'–13'-Richtung im Verhältnis zum HSC spezifischen Promoter, wodurch die rep Transkription in Zielzellen ermöglicht wird. Nach Transduktion von HSC mit aufgereinigten &Dgr;Ad.AAV1-rep Partikeln wird die Expression von rep aktiviert und vermittelt die Rettung der AAV-ITR/Transgencassette aus dem Gerüst des adenoviralen Vektors und die ortsspezifische Integration. Die Hypothese ist die, das die Rep-vermittelte Integration in AAVS1 über die rechten oder die linken AAV/ITRs erfolgt, die dazu führen, dass das rep Gen von dem Hepatozyten-spezifischen Promoter getrennt wird, sobald der Vektor integriert ist (7). Somit sollte die Expression von Rep nur transient sein, ohne kritische cytotoxische Effekte auf die Wirtszelle.

Promotoren, die die Expression von rep regulieren können:

Mögliche Kandidatenpromotoren zur Steuerung der Expression von rep mit hoher Spezifität für HSC und minimaler Aktivität in 293 Zellen sind der 454 nt CD34 Promoter (Krause, D. S., et al., 1997,Experimental Hemotology 25, 1051-1961, Yamaguchia, Y. et al., 1997, Biochimica et Biophysica Acta., 1350: 141-6), der 300 nt HS 40 Enhancer (Chen, H. L., et al., 1997, Nucleic Acids Res. 25, 2917-2922) oder ein 3 kb CD34 Enhancer (May, G. et al., 1995, EMBO J., 14: 564-74) in Kombination mit einem Initiator, oder mit der HIV LTR. Ein optimaler Promoter wird ausgewählt, basierend auf Untersuchungen der transienten Reportergenexpression nach Plasmidtransfektion in 293 Zellen und Hepatozyten. Alle zu testenden Promotoren werden vor das menschliche &agr;1-antitrypsin (hAAT) Bovines Wachstumshormon-Polyadenylierungssignal (bPA) in das adenovirale Shuttle-Plasmid pCD2 (pAD-hAAT) kloniert. Promoteraktivität kann in transienten Plasmidtransfektionsassays in CD34+ und 293 Zellen getestet werden. Der Promoter mit den höchsten hAAT-Spiegeln in CD34+ und K562 Zellen und der niedrigsten hAAT-Exprssion in 293 Zellen wird für weitere Untersuchungen ausgewählt. Wenn hohe Hintergrundexpression in 293 Zellen von diesen Promotern gesehen wird, dann können Insulatoren zur Abschirmung der HSC-spezifischen Promotoren vor dem E1A Enhancer, der in den Ad Shuttleplasmiden immer noch vorhanden ist, verwendet werden.

Rep Gene:

Die großen Rep68/78 Proteine sind nicht in der Lage, Rescue und ortsspezifische Integration zu vermitteln. Unregulierte Expression von Rep52 und Rep40 vom AAV p 19 Promoter, der innerhalb des ORF von Rep 68 und Rep 78 liegt, muss verhindert werden, da die Erzeugung dieser kleineren Proteine in 293 Zellen die Lebensfähigkeit der Zellen und die Synthese adenoviraler DNA beeinflussen wird. Um dies zu tun, können Konstrukte, die von Surosky et al. erhalten wurden, die ein mutiertes Rep 52/40 Startcodon enthalten, verwendet werden, um Rep 68 und 78 einzeln unter dem CMV Promoter zu exprimieren. Die 293 Zellen, die Rep68 oder 78 transient aus diesen Konstrukten exprimieren, können mit &Dgr;Ad.AAV1 koinfiziert werden (Infektion 24 Stunden nach pCMVRep Transfektion, MOI 2 × 105 Genome pro ml). Drei Tage nach der Infektion mit &Dgr;Ad.AAV1 wird zelluläre DNA wie vorstehend beschrieben durch PFGE und PCR auf AAVS 1-spezifische Integrationsereignisse untersucht. Effizientes Rep-vermitteltes Ausschneiden der AAV-Kassette und ortsspezifische Integration ohne flankierende adenovirale Sequenzen werden erwartet und die Plasmide pCMVRep68 oder pCMVRep78 können als Quelle für die entsprechenden rep Gene und zu deren Klonierung in hybride Vektoren verwendet werden.

Vektoren:

Die rep/Transgen-Cassette kann basierend auf pXCJL (Microbix, Toronto) zusammengebaut werden. Ein Satz von Kontroll-Hybridvektoren kann mit der AAV-ITR-Transgen-Cassette ohne das rep Gen erstellt werden. Das rekombinante Ad.AAV-rep-Genom kann durch Rekombination der linken Shuttle-Plasmide mit pCD1, einem pBHG10 (Microbix, Toronto) Derivat erzeugt werden, das das Ad5 Genom enthält, aus dem die E1/E3 Bereiche deletiert wurden, in recA+ E. coli (Chartier, C., et al., 1996, J. of Virology, 70, 4805-4810). Verglichen mit dem Standardverfahren basierend auf Plasmidrekombination in 293 Zellen hat dieser Ansatz den Vorteil, das Plaques mit rekombinantem Virus 3 mal schneller erscheinen und die Produktion von illegitimen Rekombinanten minimiert wird. Dies ermöglicht, dass die wirksame virale DNA Amplifikation und das Verpacken auftreten, bevor die Expression von Rep Höhen erreicht, die für die adenovirale Replikation potentiell inhibitorisch sind. Die kritischen Variablen bei die Maximierung des Outputs des Vektors, aus dem ale adenoviralen Gene deletiert wurden, sind die anfängliche MOI und die Zeit der Ernte. Diese Parameter können optimiert werden für die Produktion von &Dgr;Ad.AAV-rep hybriden Vektoren. Eine Anzahl von &Dgr;Ad.AAV Vektoren kann konstruiert werden, die ein rep Gen enthalten. Kryptische Promoter und Enhancer-Elemente, die in den 5' gelegenen 342 nt des adenoviralen Genoms enthalten sind, können mit der Expression des Transgens unter heterologen Promotoren interferieren. Dies ist ausschlaggebend für die Strategie, rep Expression ais &Dgr;Ad.AAV-rep Genomes in 293 Zellen zu verhindern. Zur Gewährleistung einer wirksamen Transgenexpression können Insulatorfragmente wie der beta-Globin-Insulator aus Huhn mit einem ausgewählten konstitutiven oder induzierbaren Promoter verwendet werden.

Ko-Verpackung des Rep Proteins:

Als Alternative zur Erzeugung von hybriden Vektoren, die das rep68/78 Gen enthalten, werden Studien aufgebaut, um zu sehen, ob das Rep Protein in &Dgr;Ad.AAV Kapside ko-verpackt werden kann und ob diese ko-verpackten Rep Moleküle ausreichen, um Rescue und ortsspezifische Integration der AAV-ITR Transgencassette zu ermöglichen. Unsere Hypothese ist, das Rep68/78 an die Rep Bindestelle (RBS) bindet, die im doppelsträngigen &Dgr;Ad.AAV Genom anwesend ist und das dieser Komplex in adenovirale Kapside ko-verpackt wird, die groß genug sind, um extra Peptide aufzunehmen. Basierend auf einer Protein/DNA-Verhältnis-Analyse, die man zuvor in aufgereinigten Partikeln durchgeführt hat, weiß man, das pro Kapsid nur ein 5.5 kb goßes &Dgr;Ad.AAV1 Genom verpackt wird. Dies wird bestätigt durch Elektronenmikroskopie von &Dgr;Ad.AAV1 Partikeln, die nur punktförmige elektronendichte Färbung zeigte, die mit viralen Kernen assoziiert ist und erweiterten freiem luminalen Raum (siehe 2).

293 Zellen werden mit Plasmiden transfiziert, die Rep68/78 unter dem CMV Promoter exprimieren und die Kinetik der Rep Expression wird durch Western Blot mit Zelllysaten bestimmt, die zu verschiedenen Zeitpunkten nach der Transfektion entnommen werden. Als nächstes werden diese 293 Zellen mit Ad.AAV (MOI 1, 10, 100 pfu/Zelle) zu bestimmten Zeitpunkten nach der Transfektion von Rep Plasmiden infiziert, abhängig von den Expressionskinetiken von Rep (zb 3, 6, 12, 24 ... Stunden nach Transfektion). Es ist wichtig, die Ad.AAV Infektion zeitlich genau abzustimmen da die Replikation der viralen DNA stattfinden oder beendet sein muss, bevor die Rep Produktion Spitzenwerte erreicht. Allgemein ist die Replikation adenoviraler DNA in 293 Zellen (infiziert mit MOI 10) maximal 18 Stunden nach Infektion, gefolgt von Produktion von Strukturproteinen, Verpackung von viralen Genomen, und Zusammenbruch der zellulären Membranstrukturen (die ~ 36–48 h p.i. abgeschlossen ist) (Shenk, T.,1996, In B. N. Fields, et al. (Hrsg.), Fields Virology, Bd. 2 Lippincott Raven Publisher, Philadelphia; van der Vliet, B., 1995, In w. Doerfler, et al. (Hrsg.) Bd. 2 Seite. 1-31, Springer-Verlag, Berlin) abgeschlossen. Viren werden 48 h nach der Infektion geerntet und durch CsCl Ultrazentrifugation in ein Bandenmuster aufgetrennt. Virales Material aus aufgereinigten Banden, die &Dgr;Ad:AAV entsprechen, wird lysiert, mit DNAse behandelt (um DNA freizusetzen, die mit Rep assoziiert ist), einer Immunpräzipitation und einem Western Blot mit Repspezifischen Antikörpern unterzogen, um ko-verpacktes Rep nachzuweisen. Basierend auf theoretischen Berechnungen, bei denen angenommen wird, das pro Ad Genom zwei Rep Moleküle binden, erwartet man aus Lysaten von 101 Partikel 1–10 ng Rep Protein, das innerhalb der Nachweisbarkeit durch Western Blot liegt. Alternativ dazu kann ko-verpacktes Rep basierend auf der funktionalen Aktivität, Rescue und ortsspezifische Integration der AAVITR Transgencassette zu vermitteln, nachgewiesen werden. Um zu testen, ob funktionelles Rep Protein in hybride Vektorpartikel ko-verpackt wird, können über CsCl aufgereinigte &Dgr;Ad.AAV1 Partikel, die in 293 Zellen generiert wurden, die nach Ad/AAV1 (&Dgr;Ad.AAV1+rep) Infektion Rep koexprimieren, für Transduktionsuntersuchungen verwendet werden. Drei Tage nach der Infektion mit &Dgr;Ad.AAV1+rep der humanen Zelllinie K562 wird zelluläre DNA durch PCR und PFGE auf AAVS1-spezifische Integrationsereignisse untersucht. Wenn die effiziente Rep-vermittelte ortsspezifische Integration ausgeschnittener AAV Cassetten erfolgreich ist, dann können andere &Dgr;Ad.AAV+Rep hybride Vektoren mit &bgr;-Gal und SNori als Transgene hergestellt werden.

Integrationsstudien mit Rep-Vektoren in erythroiden Zellen:

Die Hypothesen hinter der Überlegung für einen rep-exprimierenden hybriden Vektor (&Dgr;Ad.AAV-rep) sind: (1) transiente Rep Ko-Expression aus &Dgr;Ad.AAV-rep Vektoren kann die ortsspezifische Vektorintegration in menschliche Zellen verstärken und (2) Integration erfolgt via AAV ITR(s) ohne das rep Gen, das außerhalb der AAV-Cassette liegt, wodurch die rep Expression nach Integration des Vektors eliminiert wird. Um Hypothese I zu testen, können die Transduktionsfrequenzen von &Dgr;Ad.AAV/rep vs. &Dgr;Ad.AAV Vektoren verglichen werden, basierend auf der Bildung von G418-resistenten Kolonien und durch Quantifizierung ortsspezifischer Integrationsereignisse an verschiedenen Zeitpunkten nach Infektion von humanen und Mauszellen durch PFGE und PCR. Um Hypothese 2 zu überprüfen, kann die Struktur von integriertem Vektor in transduzierten Zellpopulationen und in Einzelklonen durch Southern Analyse und durch Sequenzierung der Vektor/chromosomale DNA-Übergänge analysiert werden. Diese Untersuchungen können mit &Dgr;Ad.AAV-rep, &Dgr;Ad.AAV und &Dgr;Ad.AAV+rep (koverpacktes Protein) in menschlichen K562 oder HEL (für die Integration von AAVS1) und Maus MEL Zelllinien durchgeführt werden.

Zellen, die mit &Dgr;Ad.AAV-Snori, &Dgr;Ad.AAV-Snori+Rep oder &Dgr;Ad.AAV-Snori-rep infiziert wurden, können mit G418 selektiert werden. Die Anzahl an G418-resistenten Kolonien kann nach 4 Wochen Selektion im Verhältnis zur Anzahl anfänglich infizierter Zellen bestimmt werden. Der Selektionsprozess für Kolonien, die fortgesetzte Selektion nicht überlebt haben, aufgrund potentieller rep-vermittelter Cytotoxizität oder Expression von episomalem Vektor kann überwacht werden. Wenn die rep Expression ausgehend von &Dgr;Ad.AAV-SNori die Lebensfähigkeit und die Proliferation der Zellen nicht beeinträchtigt, dann sollten bei &Dgr;Ad.AAV-Snori-rep und &Dgr;Ad.AAV-Snori+Rep mehr G418-resistente Kolonien auftauchen. Die Struktur des integrierten Vektors kann durch Southern Blot und durch Sequenzierung der Integrationsstellen bestimmt werden.

Um eine mögliche Selektionsneigung gegen rep-erzeugende Zellen nach Transduktion mit &Dgr;Ad.AAV/rep aufzudecken, können ortsspezifische und zufällige Vektorintegrationsereignisse in zellulärer DNA quantifiziert werden, die zu bestimmten Zeitpunkten nach der Infektion (z.B. 0.5, 1, 3, 7, 14 Tage) aus Zellpopulation isoliert wurde. Um dies zu tun, können Techniken verwendet werden, die auf PFGE-Southern beruhen. Es wird erwartet, dass das Signal für die AAVS 1-spezifische Integration in &Dgr;Ad.AAV/rep-iniizierten humanen Zellen während der ersten Tage nach Infektion ansteigt und dann über die Zeit konstant bleibt.

In einer getrennten Studie kann der Integrationsstatus der Vektor-DNA (analysiert durch PFGE oder PCR) und die Anzahl integrierter Kopien (analysiert durch Southern Blot) mit dem Expressionslevel von &bgr;-Galactosidase in Einzelklonen korreliert werden, die mit &bgr;-Gal hybriden Vektoren transduziert wurden (&Dgr;Ad.AAV-BG, &Dgr;Ad.AAV-BG+Rep, oder &Dgr;Ad. AAV-BG-rep). Zusammen mit den Daten, die mit den hier beschriebenen Untersuchungen erhalten wurden, ermöglicht dies eine Bewertung, ob transkriptionelles Silencing mit ortsspezifischer Vektorintegration in die AAVS1-Stelle assoziiert ist.

Es ist a priori nicht klar, ob die spezifische Rep Funktion für den Vektor-Rescue, die Concatemer-Bildung und für die wirksame Integration in nicht-S-Phase oder sich nicht teilende Zellen auftreten kann. Um zu testen, ob &Dgr;Ad.AAVfx, &Dgr;Ad.AAV oder &Dgr;Ad.AAV-rep/+rep Vektoren in nicht teilende Zellen eintreten können, können Transduktionsuntersuchungen in Zellzyklus-arretierten Zellkulturen wie zuvor beschrieben durchgeführt werden.

DISKUSSION

Die Etablierung stabiler Zelllinien, die Rep68/78 in nachweisbaren Konzentration exprimieren, ist nicht möglich, was wahrscheinlich auf die durch rep vermittelte Cytotoxizität zurückzuführen ist. Somit ist es nicht möglich, Langzeit-Transduktionsstudien (z.B. G418 Selektion oder Untersuchungen mit einzelnen Klonen) in Kombination mit ektopischer Expression von rep durchzuführen. Weiterhin ist es gegenwärtig aufgrund des inhibitorischen Effekts von rep auf die Replikation von Adenoviren nicht möglich, adenovirale Vektoren zu generieren, die rep unter der Kontrolle des RSV oder des PGK Promotors exprimieren.

Zusammengefasst zeigt dies, dass ko-exprimiertes Rep die ortsspezifische Integration des Transgens stimulieren kann.

E. Eine detaillierte Untersuchung der Transduktion/Integration von hybriden Vektoren in erythroide Zelllinien:

Zur Verbesserung der Transduktions- und Integrationsfrequenzen der hybriden Vektoren in erythroide Zellinien muss eine Untersuchung, umfassend verschiedene hybride Vektoren, wie nachstehend beschrieben durchgeführt werden. Die Transduktionsuntersuchungen werden in K562 Zellen durchgeführt, die als adäquates Modell angesehen werden, Gentransfervehikel in erythroiden Zellen zu untersuchen (Floch, V., et al., 1997, Blood Cells, Mol. And Diseases. 23, 69-87). Die optimalen Vektoren sollen in der Lage sein, in das zelluläre Genom mit hoher Frequenz zu integrieren, bestimmt durch PFGE und Southern Blot wie beschrieben in Beispiel 4. Zusätzlich werden die Ergebnisse aus den folgenden Untersuchungen dazu dienen, auszuwerten, ob ein gegebener hybrider Vektor für die ortspezifische Integration in das Wirtsgenom modifiziert werden muss.

Sequenzierung der Integrationsstellen:

Der endgültige Beweis für die Vektorintegration ist die Sequenzierung von Verbindungsstellen zwischen Snori Vektor DNA und chromosomaler DNA. Weiterhin klärt dies auch die Frage, ob die AAV ITRs das Substrat für die Integration darstellen. DNA von Klonen mit bekannter &Dgr;Ad.AAVSNori-Integrationsstruktur (wie durch Southern Blot analysiert) wird mit EcoRI verdaut, das nicht innerhalb der Snori Kassette schneidet. Die entstehenden Fragmente werden zirkularisiert und in einen spezifischen E. coli Stamm transformiert (gemäß einem von Rutledge und Russell beschriebenen Protokoll (Rutledge, E. A. et al., 1997, Journal of Virology, 71: 8429-36). Kanamycin resistente bakterielle Klone sollten die integrierte Snori Kassette enthalten. Flankierende chromosomale DNA in geretteten Plasmide kann mit Primern sequenziert werden, die für das Transgen spezifisch sind.

Zur Bestätigung der Vektorintegration in einer kleinen Zahl von transduzierten Zellen wird genomische DNA extrahiert und mit EcoRI verdaut. EcoRI-Fragmente werden an Linker ligiert, die eine spezifische Primer-Bindungsstelle enthalten und dann mit NotI verdaut, religiert und in E.coli vermehrt. Plasmid DNA aus einer repräsentativen Anzahl von Bakterienklonen wird sequenziert, um die Verbindungen von Vektor/chromosomaler DNA zu sequenzieren.

Dosisabhängige Toxizität:

Um zu testen, ob die Transduktionsfrequenz dosisabhängig ist und ob &Dgr;Ad.AAV-Vektoren, denen ale adenoviralen Gene fehlen, dazu verwendet werden können, Zellen in höheren Dosierungen mit geringerer Cytotoxizität als Adenoviren der ersten Generation zu infizieren, werden K562 Zellen mit verschiedenen MOIs (1–108) von &Dgr;Ad.AAVBG und mit dem Vektor der ersten Generation Ad.AAVBG (der die gleiche &bgr;-Gal Expressionskassette enthält) infiziert. Vier Tage nach Infektion wird die Gesamtzahl an Zellen, der Prozentsatz an lebensfähigen Zellen (basierend auf dem Trypanblau-Ausschluß) und der Prozentsatz an X-Gal positiven Zellen gezählt. Eine Fraktion von iniizierten Zellen wird auf &bgr;-Gal Expression mit dem Galacto-Light -Kit quantifiziert. Man erwartet, dass der Spiegel an Transgenexpression zwischen den beiden Vektoren vergleichbar ist. Es wird vorausgesagt, dass K562-Zellen höhere Dosen von &Dgr;Ad.AAVBG besser als Ad.AAVBG tolerieren, der virale Gene exprimiert.

Integrationsfrequenz mit und ohne G418 Selektion:

Um die Integrationsfrequenz der unterschiedlichen Vektoren zu untersuchen und um zu bestätigen, das die in adenoviralen DNA-Genomen vorhandenen AAV ITRs die Integration des Vektors mit einer Frequenz vermitteln können, die vergleichbar zu rAAV Vektoren ist, werden basierend auf der Bildung von G418-resistenten Kolonien Integrationsuntersuchungen mit &Dgr;Ad.AAVSNori, ADSNori, Ad.SNoriITR und rAAVSNOri nach Infektion mit 2 × 105 und 2 × 106 Genomen pro Zelle (8) durchgeführt. Nach der Infektion werden die Zellen in 96-Lochplatten unter begrenzender Verdünnung verdünnt und mit G418 selektiert um die Frequenz der Bildung von G418 resistenten Kolonien abzuschätzen. Ein weiterer Satz von Zellen wird ohne G418 plattiert. Eine repräsentative Anzahl von Klonen (mit und ohne G418 Selektion) werden auf > 106 Zellen expandiert (nach 3–4 Wochen in Kultur) und durch Southern Blot als auch mit PFGE auf die Anwesenheit von viraler DNA analysiert, um zwischen episomaler Vektor-DNA und Vektorgenomen zu unterscheiden, die stabil mit chromosomaler DNA assoziiert sind. Dies erlaubt es uns, die Integrationsfrequenz der verschiedenen Vektoren abzuschätzen, die Auswirkungen von G418-Selektion auf die Integration zu bewerten und um positionelle Effekte auf die Expression von neo bei der Berechnung der gesamten Integrationsfrequenz zu berücksichtigen. Integrierte Vektorkopien mit einer Frequenz von wenigstens 1 × 10–4 werden nur für &Dgr;Ad.AAVSNori und rAAVSnori vorhergesagt. Die Gesamtanzahl an Kolonien kann in den Vektoren der ersten Generation, Ad.AAVSNoriITR und Ad.SNori niedriger sein, aufgrund von toxischen Effekten der exprimierten adenoviralen Proteine; eine höhere Integrationsfrequenz wird jedoch für den Vektor vorhergesagt, der AAV ITRs (Ad.AAVSNoriITR) enthält.

Kinetiken der Integration:

Veglichen mit rAAV stellt die Doppelsträngigkeit der eintretenden &Dgr;Ad.AAV Genome einen besseren Schutz vor Abbau dar. Weiterhin ist die Synthese von transkriptionell aktiven doppelsträngigen Intermediaten aus einzelsträngigen Genomen, die bei der Transduktion mit rAAV als limitierender Schritt angesehen wird, für die Transduktion von rAAV nicht erforderlich. Somit kann die Lag-Phase zwischen der Infektion und der Expression, die man mit rAAV Vektoren sieht, die auf die Doppelstrangsynthese/Integration zurückzuführen ist, bei Infektionen mit &Dgr;Ad.AAV Vektoren kürzer sein oder fehlen. Weiterhin wurde früher gezeigt, das ein Mini-adenovirales Genom von nur 9 kb Größe, das in adenovirale Partikel verpackt wird, nur kurzlebig ist und am Tage 3 nach der Infusion abgebaut wird. Im Gegensatz dazu ermöglicht die Transduktion mit dem 5.5 kb &Dgr;Ad.AAV Genom (1) die Langzeitexpression, was nahe legt, dass AAV ITRs entweder das virale Genom als ein Episom stabilisieren, bis es integriert ist oder das die Integration kurz nach der Infektion erfolgt.

Der Status der Vektor-DNA kann in K562 Zellen zu verschiedenen Zeitpunkten nach der Infektion mit &Dgr;Ad.AAVSNori, AdSNori, Ad.AAVSnoriITR order rAAVSNori (MOI 2 × 105) untersucht werden. Infizierte Zellen werden nach 1h, 5h, 1 Tag, 3, 7 und 14 Tage nach der Infektion geerntet und chromosomale DNA wird durch PFGE analysiert, gefolgt von Hybridisierung mit einer Transgen-spezifischen Sonde. Diese Technik ermöglicht es, zwischen episomaler Vektor-DNA, die als eine deutliche Bande von 5.0 kb erscheint und integrierter DNA zu unterscheiden. Weiterhin können Vektor-Concatemere mit hohem Molekulargewicht nachgewiesen werden. Weiterhin können extrachromosomale Vektor-Concatemere mit hohem Molekulargewicht nachgewiesen werden. Im Fale von zufälliger Integration könnten nach Verdau chromosomaler DNA mit I-CeuI oder PI-SceI Vektor-spezifische Signale im Bereich von 1–2 MB nachgewiesen werden. Die Intensität des episomalen und des Signals von integriertem Vektor wird für jeden Zeitpunkt durch Phosphoimager-Analyse quantifiziert. Dies gibt Information über die Kinetik der Integration des hybriden Vektors in einer Population von infizierten K562 Zellen und über die intrazelluläre Stabilität von hybriden Vektorgenomen.

Struktur von integrierter Vektor-DNA und von Integrationsverbindunpen mit chromosomaler DNA:

&Dgr;Ad.AAV1 integriert, wie vorher gezeigt, zufällig als Koncatemer(e) in Wirts-DNA. Wieviele Vektorkopien in einem Concatemer anwesend sind und ob das Ausmaß und die Kinetiken der Tandembildung dosisabhängig sind, ist noch unklar. Eine weitere unbeantwortete Frage besteht darin, wie &Dgr;Ad.AAV integriert: ob ein oder beide ITRs beteiligt sind, ob die integrierten ITRs noch intakt sind, und ob auch adenovirale Sequenzen integrieren. Diese Fragen sind wichtig für die Strategie, rep Gene in das Vektorgenom mit aufzunehmen. Weiterhin, wenn intakte AAV ITRs innerhalb integrierter Vektor-Kopien anwesend sind, dann kann die Infektion mit Helfervirus (Adenovirus oder HSV) in vivo die integrierte AAV-ITR Vektorkassette mobilisieren und die Stabilität der Transgenexpression beinflussen.

Um diese Fragen zu beantworten, können K562 Zellen mit &Dgr;Ad.AAVSNori, AdSNori, Ad.AAVSNori ITR und rAAV SNOri bei MOIs von 2 × 105, 2 × 106 oder 2 × 107 Genomen pro Zelle infiziert werden. Infizierte Zellen werden in An- oder Abwesenheit von G418 in 96-Lochplatten plattiert. G418 wird mit aufgenommen, da G418 die Amplifikation integrierter Vektor-DNA hervorrufen könnte. Genomische DNA aus isolierten Klonen kann wie in dem Abschnitt Beispiele beschrieben durch normalen Southern Blot analysiert werden, um die Anwesenheit von Vektorkonkatemeren zu bestätigen und um die Anzahl integrierter Vektorkopien zu berechnen. Die Sequenzierung der integrierten Vektorkopien und deren Veknüpfungen mit chromosomaler DNA sind informativer. Die Struktur der Integrationsstellen kann beschrieben werden unter Verwendung der Rolle der AAV ITRs bei der Vektorintegration und dem Ausmaß der Insertionsmutagenese nach Transduktion. Diese Daten stellen Information bereit hinsichtlich den möglichen Risiken der Verwendung der hybriden Vektoren in klinischen Studien.

Transduktion von Zellzyklus-arretierten Zellen:

Das wichtigste Ziel für die in der Beschreibung beschriebenen hybriden Vektoren sind ruhende hämatopoietische Stammzellen. Wir nehmen an, dass die Doppelsträngigkeit von &Dgr;Ad.AAV Genomen und spezifische Kernimport-Mechanismen die Transduktion nicht-teilender Zellen ermöglichen. Dies wird zum Teil durch Transduktionsuntersuchungen mit &Dgr;Ad.AAV1 in ruhenden Hepatozyten in vivo gestützt. Um diese Daten zu bestätigen, können primäre Fibroblasten durch Entzug von Serum/Wachstumsfaktor dazu gebracht werden, vor Infektion mit den hybriden Vektoren in die G0-Phase einzutreten gemäß einem von Russel beschriebenen Protokoll (Russell, D. et al., 1995, PNAS 92:5719-23). Zellen werden nach Entzug von Serum/Wachstumsfaktor drei Tage weiter kultiviert. Zu diesem Zeitpunkt wird genomische DNA isoliert und durch PFGE und Vergleich mit wachsenden Zellen auf Integrationsereignisse untersucht. Eine andere Reihe von Integrationsuntersuchungen kann in K562 Zellen durchgeführt werden, die mit Aphidicolin in der G1/S-Phase des Zellzyklus arretiert wurden (zugegeben 1 Tag vor und Beibehalten über einige Tage nach der Infektion mit hybriden Vektoren – in Abhängigkeit von den zuvor beschriebenen Integrations-Kinetikuntersuchungen). Um zu untersuchen, ob DNA-schädigende Agenzien die Transduktionsfrequenz von hybriden Vektoren erhöhen, können Zellzyklus-arretierte K562 Zellen oder primäre Fibroblasten mit Cisplatin oder 3H-Thymidin vor der Virusinfektion gemäß einem von Alexander und Russel beschriebenen Protokoll behandelt werden (Alexander, I. E. et al., 1994, J. Virol., 68: 8282-87; Russell, D. et al., 1995, PNAS, 92: 5719-23). Weiterhin kann der Effekt der Dekondensation chromosomaler DNA auf die Transduktionseffizienz hybrider Vektoren in arretierten Zellen nach Behandlung mit Puromycin, Staurosporin, Hoechst 3328, Distramycin oder Vandat untersucht werden.

F. Verbesserung der Produktion und Aufreinigung von &Dgr;Ad.AAV

Zur Hemmung der Verpackung von Gesamtgenomen wird eine modifizierte Form von I-SceI, eine mitochondriale Intron-Endonuklease aus der Hefe mit einer nichtpalindromischen 18 bp-Erkqennungssequenz in 293 Zellen exprimiert. Konstitutive Expression dieses Enzyms in Säugerzellen ist nicht toxisch, wahrscheinlich aufgrund des Fehlens von I-SceI-Stellen im Genom oder aufgrund deren ausreichender Reparatur (Rouet P. et al, 1994, PNAS, 91: 6064-8). I-SceI aus der Hefe wird mit einem T-Antigen Kernlokalisationssignal aus SV40 und einer optimalen Kozak-Sequenz modifiziert um seine Funktionaliät in Säugerzellen zu erhöhen (Rouet P. et al, 1994, PNAS, 91: 6064-8). Für eine andere Hefe-Endonuklease wurde gezeigt, dass eine Erkennungsstelle innerhalb eines transduzierten Ad-Genoms die durch die Endonuklease vemittelte Reparatur eines Doppelstrangbruches hemmt (Nicolas, A. L. et al, 2000, Virology, 266: 211-24). Dies stimmt mit Beobachtungen Dritter überein, die besagen, dass diese E4-Proteine die Konkatemerbildung des viralen Genoms verhindern (Boyer, J. et al, 1999, Virology, 263:307-12). Basierend darauf ist die Verpackung eines Gesamt-Virus, der eine I-SceI-Erkennungsstelle enthält, in 293 Zellen, die I-SecI konstitutiv exprimieren, vermindert. Die 18mer I-SceI Stelle wird in den E3 Bereich der Ad.IR Vektoren eingesetzt. Diese Vektoren werden erzeugt und in 293 Zellen amplifiziert, gefolgt von Infektion von 293 Zellen in großem Maßstab, die I-SceI exprimieren. Alternativ dazu wird eine Expressionscassette für die Endonuklease XhoI in den E3 Bereich von Ad.IR oder von Ad.AAV Vektoren eingesetzt. Das XhoI Gen wird für optimale Funktionsweise in Säugerzellen modifiziert werden. Vektoren, die XhoI exprimieren, werden erzeugt und in 293 Zellen amplifiziert, die die XhoI Isoschizomer PaeR7 Methyltransferase (PMT) (Nelson, J. E. et al, 1997, J. Virol., 71: 8902-7) exprimieren, die die Addition einer Methylgruppe auf die N6-Position der Adeninbase von XhoI-Stellen, CTCGAG, vermittelt. Dies schützt das virale und zelluläre Genom vor Spaltung durch XhoI. Methylierte Ad Vektoren werden in hohen Titern produziert. &Dgr;Ad.AAV Vektoren werden dann duch Infektion von 293 Zellen in großem Maßstab mit den Ad.AAV Vektoren erhalten. In diesem Stadium ist das virale Genom nicht methyliert und wird an den XhoI-Stellen verdaut. XhoI-Stellen, die innerhalb der Transgenkassette anwesend sind, werden durch ortsgerichtete Mutagenese ohne Veränderung de Aminosäuresequenz deletiert (XhoI wird nur in den späten Phasen der Virusreplikation akkumuliert und sollte nur auf einen großen Teil der Ad DNA wirken, wenn die Replikation abgeschlossen ist. Zusätzlich optimiert Ultrazentrifugation die Trennung zwischen &Dgr;Ad.IR und &Dgr;Ad.IR Partikeln (Blague, C. et al., 2000, Blood, 95: 820-8).

BEISPIEL II MODIFIZIERTES FASERPROTEIN A. Testen der Infektiosität unterschiedlicher menschlicher oder tierischer Serotypen auf menschlichen Knochenmarkszellen

Da sich die Aminosäurequenz der Fiber-Knob-Region zwischen den ~ 50 bekannten Serotyppen beträchtlich unterscheidet, nimmt man an, dass unterschiedliche Serotypen von Adenovirus an verschiedene zelluläre Rezeptorproteine binden oder unterschiedliche Eintrittsmechanismen verwendet (Shenk, T.,1996, In B. N. Fields, et al. (Hrsg), Fields Virology, Bd. 2 Lippincott-Raven Publisher, Philadelphia; Mathias, P. et al., 1994, Journal of Virology, 68: 6811-14; Defer, M., et al., 1993,J of Virology, 64,3661-3673). Obwohl die meisten Adenoviren in den Pentonbase-Proteinen RGD Motive enthalten, gibt es eine Reihe von Serotypen (zB Ad40, 41) ohne diese konservierte Sequenz. Diese Typn können Integrin &agr;v-unabhängige Wege für die Virus-Internalisierung verwenden (Davison, A. J., et al., 1993, J. Mol. Biol., Mathias, P. et al., 1994, Journal of Virology, 68: 6811-14). Um zu testen, ob Ad-Serotypen Subpopulation von Stammzellen infizieren können, die in menschlichem Knochenmark anwesend sind, werden Untersuchungen mit einer Reihe von unterschiedlichen menschlichen Ad Serotypen und tierischen Viren durchgeführt (siehe Tabelle II). Als Mittel zur Verifizierung der effizienten Transduktion mit Ad Serotypen wird die virale DNA vor der Infektion getaggt und die Anwesenheit von viralen Genomen in den Nuklei von transduzierten Zellen wird untersucht. Weiterhin, ob virale DNA in transduzierten Zellen transduziert wird, kann als indirektes Anzeichen für die frühe virale Genexpression untersucht werden. Ein direkter Nachweis von exprimierten viralen Proteinen ist unmöglich, da es gegen die hier verwendeten Serotypen keine Antikörper gibt. Gleichzeitig mit dem Infektionsassay können transduzierte menschliche Knochenmarkszellen auf morphologische und immunhistochemische Eigenschaften untersucht werden, die für HSC oder Vorläufer-Subpopulationen charakteristisch sind. Für das Retargeting werden Serotypen, die in der Lage sind, CD34+ Subsets oder Kriochenmarkszellen in der niedrigsten MOI zu infizieren, ausgewählt. Als nächster Schritt wird das Fibergen aus Serotypen mit möglichem HCS/CD34+ Tropfismus PCR-kloniert und in standardmäßige Shuttle-Plasmide eingesetzt zur Ad5 Vektorgeneration mit Austausch des Ad5 Fibergens unter Verwendung eines E.coli Rekombinationssystems (9).

VERFAHREN Zellen und Viren:

HeLa (menschliches Zervixkarzinom ATCC CCL-2.2), CHO (chinese hamster ovary, ATCC CCL-61), K562 (menschlich hämatopoietisch, ATCC 45506), Hep-2 (menschliches Larynxkarzinom, ATCC-CCL-23), 293 (menschliche embryonale Niere, Microbix, Toronto, Canada) wurden in DMEM, 10 % FCS, 2 mM Glutamin und Pen/Strep gehalten. Kulturmedium für CHO Zellen wurde durch 200 &mgr;M Asparagin und 200 &mgr;m Prolin ergänzt. Menschliche CD34+-angereicherte Knochenmarkszellen wurden aus peripherem Blut nach Mobilisierung mit MiniMACS VS+ Trennungssäulen (Milenyi Biotec, Auburn, CA) gemäß den Anweisungen des Herstellers aufgereinigt. Aliquots wurden in flüssigem Stickstoff gelagert. Sechzehn Stunden vor dem Experiment wurden die Zellen aus dem gefrorenen Vorrat gewonnen und über Nacht in IMDM-Medium inkubiert, ergänzt mit 20% FCS, 10–4 M &bgr;-Mercaptoethanol, 100 &mgr;g/ml DNAse I, 2 mM Glutamin, 10 U/ml IL-3 und 50 ng/ml Stammzellfaktor (SCF) oder 2 ng Thrombopoeitin (Tpo). Die Reinheit von CD34+ Präparationen wurde durch Flußzytometrie bestätigt und war durchwegs höher als 90%.

Flußzutometrie:

Adhärente Zellen (CHO, HeLa Zellen), die in nicht für Gewebekultur behandelten Schälchen kultiviert wurden (Falcon, Franklin Lakes, NJ) wurden durch Behandlung mit 1 mM EDTA abgelöst und drei Mal mit Waschpuffer (WB) gewaschen, bestehend aus PBS, ergänzt mit 1% FCS. Zellen, die in Suspension wuchsen (K562, CD34+) wurden dreimal mit WB gewaschen. Nach dem Waschen wurden die Zellen bei 2 × 106 Zellen/ml in WB resuspendiert. 2 × 105 Zellen wurden in WB für 1h bei 37°C mit monoklonalen Antikörpern, die spezifisch für &agr;v-Integrine sind, [L230, ATCC:HB-8448, ((Rodriguez, E., Everitt, E. 1999. Arch. Virol. 144: 787-795) (1/30 Verdünnung), CAR [Rcmb (Bergelson, J. M., et al. 1997. Science. 275: 1320-1323; Hsu, K.-H., L., et al. 1988.7. Virology. 62: 1647-1652) (1/400 Verdünnung) oder BrdU [Amersham, Arlington heights, IL) (1/100 Verdünnung)] inkubiert. Danach wurden die Zellen mit WB gewaschen und mit Fluorescein Isothiocyanat (FITC)-markierten Pferd-Anti-Maus IgG Antikörpern [(Vector Labs, Burlingame, CA)] (1/100 Verdünnung) oder Phycoerythrin (PE)-markierten Ziegeanti-Maus IgG Antikörpern [(Calbiochem, La Jolla, CA) 1:100 Verdünnung] für 30 Minuten bei 4°C inkubiert. Nach Inkubation mit den sekundären Antikörpern wurden die Zellen zwei Mal mit WB gewaschen und 104 Zellen pro Probe wurden zweifach durch Flußzytometrie analysiert.

Für die Analyse von CD34 und c-kit Expression auf transduzierten CD34+ Zellen und für FACS wurden aufgereinigte menschliche CD34+ Zellen mit PE-konjugierten anti-CD34 monoklonalen Antikörpern (Becton-Dickinson Immunocytochemistry Systems, San Jose, CA) oder mit PE-markierten anti-CD117 (c-kit) monoklonalen Antikörpern (Mab 95C3, immunotech, Beckman Coulter, Marseille, Frankreich) gemäß den Anweisungen des Herstellers inkubiert, gefolgt von Flußzytometrieanalyse. Alle Analysen und Sorter-Schritte wurden auf einem FACStar Plus Flußzytometer (Beckton Dickinson, Franklin Lakes, NJ) durchgeführt, ausgestattet mit 488 nm Argon- und 633 nm HeNe-Laser. Zur Analyse der c-Kit Expression und der FACS Aufreinigung von CD34+/c-kit+-Zellen wurde SCF während der Kultur von CD34+ Zellen nicht zu den Medien zugegeben.

ERGEBNISSE CAR/&agr;v-Integrin-Expression auf Testzellen:

Es ist algemein bekannt, dass CD34+ Zellen eine repopulierende Aktivität für Knochenmark haben. Somit haben wir CD34+Zellen als Ziel unserer Studien verwendet, Ad Serotypen mit HCS Tropismus und um neue Vektoren zu erzeugen. Untersuchungen wurden mit mobilisierten, CD34+ peripheren Blutzellen aus einem Donor unter Bedingungen durchgeführt, die dafür bekannt sind, dass sie CD34+ Zellen in einem Ruhezustand halten (Leitner, A., et al. 1996. Br J Haematol. 92: 255-262; Roberts, A. W., Metcalf, D. 1995. Blood. 86: 1600-1605). Mehr als 90% gereinigte Zellen waren nach Flußzytometrie positiv. Weiterhin nahmen wir in unsere Untersuchungen zum Tropismus von Ad die Zelllinie K562 auf, die als ein geeignetes Modell zur Untersuchung von Gentransfer in menschliche hämatopoietische Zellen angesehen wird (McGuckin, et al. 1996. British Journal of Haemalology, 95: 457-460). HeLa Zellen, die durch Ad5 leicht infiziert werden können und CHO Zellen, die durch Ad5 nicht infiziert werden können (Antoniou, M. et al., 1998, Nucleic Acid Res., 26: 721-9) wurden als positive bzw. negative Kontrollen verwendet.

Für Ad5 sind sowohl die Bindung an den Primärrezeptor als auch zu &agr;3&bgr;5 Integrinen und

Integrine wichtig für eine hohe Efffizienz der Infektion von Zielzellen. Die Expression von CAR und von &agr;v Integrinen auf Testzellen wurde durch Flußzytometrie mit monoklonalen Antikörpern gegen CAR (Rcmb (Bergelson, J. M., et al. 1997. Science. 275: 1320-1323; Hsu, K.-H. L et al., 1988, J. Virol. 62:1647-1652)) und &agr;v Integrine (L230, Roelvink, P.W. et al., 1996, J. Virol. 70:7614-7621) (10) analysiert. Wie erwartet exprimieren nahezu ale HeLa Zellen hohe Spiegel von CAR und &agr;v Integrinen, während in CHO-Zellen eine signifikante Expression von CAR und &agr;v Integrinen fehlt. 15 und 77% K562 Zellen exprimierten CAR bzw. &agr;v Integrine. Nur ~6% der CD34+ Zellen, die in unseren Untersuchungen verwendet wurden, exprimierten CAR und 17% waren positiv für &agr;v Integrine. Die Präparation von CD34+ Zellen stellt ein Gemisch aus verschiedenen ZellTypn dar. Das Fehlen oder die geringe Expression von primären und sekundären Ad5 Rezeptoren auf nicht-zyklierenden menschlichen CD34+ Zellen stimmt mit früheren Berichten überein (Huang, S. et al., 1996 J. Virol. 70:4502-4508; Neering, S.J. et al., 1996, Blood 88: 1147-1155; Tomko, R.P. et al., 1997, PNAS USA, 94:3352-3356).

Infektionsassay mit Wildtyp Ad5 und K562 Zellen

Die Anwesenheit von viraler DNA im Nukleus infizierter Zellen ist ein indirektes Mittel zur Demonstration von effizienter Virusbindung, Internalisierung und von Kerntransport. Die Lokalisation im Kern des viralen Genoms ist eine Voraussetzung für die Transkription und Integration des Transgens. Zwei Techniken werden verwendet, um virale DNA für die in situ Analyse zu taggen. Zur Optimierung des Infektionsassays können Wildtyp Ad5 Virus und K562 Zellen verwendet werden, die für die Ad5 Infektion permissiv sind. Das erste Protokoll (Challberg, S. S. and Ketner, S. 1981, Virology 114,196-209), basiert auf der Markierung von viraler DNA mit 32P. Während der Amplifikation von Wildtyp Ad5 und K562 Zellen wird 32P-Phosphat (40 &mgr;gCi/ml) zu phosphatfreiem-Medium zugegeben. Nach Entwicklung von CPE wird 32P-markiertes Virus geerntet, in CsCl-Banden aufgetrennt und auf HeLa -Zellen gemäß Standardprotikollen titriert. Zur Simulation der Bedingungen für die Infektion von Knochenmarkszellen werden K562 Zellen in einer MOI von 1, 10, oder 100 32P-Ad5 für 2, 4, 6 oder 8 Stunden unter Rühren bei 37°C inkubiert. Dies deckt den Zeitraum ab, der für Adsorption, Internalisierung und Kernimport nötig ist. Nach dem Waschen werden die Zellen entweder für Cytospin auf Mikroskopgläser transferiert oder in Paraffin eingebettet und geschnitten (gemäß den Protokollen von VECTOR Labs, Burlingame, CA). Letzteres hat den möglichen Vorteil, das multiple aufeinanderfolgende Schnitte (5 &mgr;m) der gleichen Zelle durch unterschiedliche Verfahren analysiert werden können (z.B. für 32P-markierte virale DNA, für spezifische histologische Färbung, für Immunfluoreszenz), was die Korrelation der Infektion mit einem spezifischen Zelltyp erlaubt, der im Knochenmark anwesend ist. Zellen werden für die Autoradiograpphie in einer Kodak NTB-2 Photoemulsion inkubiert. Die Expositionszeit kann optimiert werden, um Hintergrund oder nicht im Kern lokalisierte Signale zu minimieren. Unter optimierten Bedingungen erwartet man ein Dosis- und Zeit-abhängiges Auftreten von Silberkörnchen im Kern. Da 32P Phosphat auch virale Proteine markieren kann, kann ein cytoplasmatisches Hintergrundsignal auftreten. Zur Erleichterung des Nachweises kann eine Immunfluoreszenz mit HSC-spezifischen Antikörpern auf Schnitten durchgeführt werden. Als alternatives Verfahren kann ein BrdU-Markierungsverfahren für virale DNA verwendet werden (Lieber, A., et al. 1999. J Virol 73:9314-24; Lieber, A. et al., 1996, Journal of Virology, 70: 8944-60). In diesem Fal werden verschiedene Mengen an BrdU während der Virusvermehrung von wtAd5 dem A549-Kulturmedium zugegeben. Mit BrdU markierte DNA kann durch monoklonale Antikörper, die spezifisch für BrdU sind, nachgewiesen werden. Das Signal kann durch Verwendung von Schichten von Spezies-spezifischen polyklonalen Antikörpern in Kombination mit Biotin/Avidin und einem fluoreszenten Marker verstärkt werden. BrdU-markierte virale DNA kann auf Cytospins von Knochenmarkszellen zusammen mit Zelloberflächenmarkern durch doppelte oder dreifache Immunfluoreszenz nachgewiesen werden.

DISKUSSION

Die Interaktion von ausgewählten Ad5 Serotypen mit CD34+ Zellen wurde getestet. Als Ergebnis dieses Screenings konstruierten wir einen auf Ad5 basierenden Vektor der ersten Generation, dessen Fiber mit der von Ad35 abgeleiteten Fiber ersetzt wurde. Wir zeigten, dass diese Capsidmodifikation eine effiziente virale Transduktion möglicher HCS durch die entsprechenden chimären Ad Vektoren ermöglichte.

Alle Untersuchungen zum Tropismus und zur Transduktion wurden mit nichtzyklierenden CD34+ Zellen durchgeführt, von denen man annimmt, dass sie HCS umfassen. Der Ruhezustand von CD34+ Zellen, die aus mobilisiertem Blut aufgereinigt wurden, ist wichtig, da die Zellproliferation mit einem Verlust der Fähigkeit verbunden ist, Hämatopoiese zu rekonstituieren und mit Veränderungen im Spektrum der zellulären Rezeptoren (Becker, P. S., et al. 1999. Exp. Hematol. 27: 533-541). Es ist bekannt, dass die Behandlung von hämatopoeitischen Zellen mit Cytokinen oder mit Wachstumsfaktoren die Expression von spezifischen Integrinen wie &agr;v Integrinen ändert, was schließlich die Empfänglichkeit der Zellen gegenüber Ad Infektion oder die Lebensfähigkeit von infizierten Zellen ändert (Gonzalez, R., et al. 1999. Gene Therapy. 6:314-320; Huang, S., et al. 1995.J. Virology. 69: 22572263). Eine weitere Tatsache, die die Interpretation von Transduktionsuntersuchungen erschwert, ist die außerordentliche Heterogenität von CD34+ Zellen hinsichtlich Morphologie und Funktion.

B. Screening unterschiedlicher Adenoviren, um Tropismus von HSC zu etablieren

Die ATCC stellt mehr als 70 unterschiedliche menschliche oder tierische Adenoviren bereit (siehe Appendix I). Eine Sammlung von 15 menschlichen Serotypen und 6 tierischen Adenoviren (siehe Tabelle II) werden basierend auf folgenden Kriterien ausgewählt. (i) Erhältlichkeit der vollständigen Genomsequenz oder Fibersequenz von der NIH Genbank (ii) Verwendung des CAR Rezeotors nicht vorhanden oder unbekannt, (iii) unterschiedliche Subgruppen, und (iv) mäßige oder niedrige Tumorigenität (Shenk, T., 1996, In B.N. Fields, et al. (Hrsg.), Fields Virology, Bd. 2 Lippincott-Raven Publisher, Philadelphia). Für die beschriebene Erfindung kann jedoch jeder im Appendix beschriebene Serotyp verwendet werden. Tierische Viren werden in den Infektiositätsassays aufgenommen, da dies ein Mittel bereitstellen kann, die präexistierende humorale Immunität gegen die menschliche Ad5 Fiber, die ein kritisches Hindernis für klinische Studien mit Ad Vektoren darstellt, zu umgehen.

VERFAHREN Viren:

Die folgenden humanen Adenovirus Serotypen wurden von der ATCC gekauft: 3 (VR-3), 4 (VR1081), 5 (VR-5), 9 (VR1086), 35 (VR-716) und 41 (VR-930). Adenovirus No. 3 VR-716 wurde von der ATCC als Serotyp 34 markiert gekauft, nach Sequenzierung der Fiberregion stellte sich jedoch heraus, dass es sich um Serotyp 34 handelte. Für die Amplifikation wurden die entsprechenden Ads auf HeLa, 293 oder Hep-2 Zellen unter Bedingungen infiziert, die Kreuzkontamimation vermieden. Virus wurde in CsCl-Gradienten in Banden aufgetrennt, dialysiert und wie anderswo beschrieben in Aliquots gelagert (Lieber, A., C.-Y. et al. 1996. Journal of Virology. 70: 8944-8960). Plaquetitration wurde wie folgt durchgeführt: Konfluente 293 Zellen, die in 6-Lochplatten plattiert wurden, wurden 24 h mit Virus in einem Gesamtvolumen von 1 ml inkubiert. Zwei Wochen nach der Infektion wurden Plaques gezählt auf Kulturen, die mit 1% Agarose/MEM/10% FCS inkubiert wurden.

EM Untersuchungen:

In CsCl-Banden aufgetrennte Ad-Vorräte wurden aufgetaut und mit 0,5 % Glutaraldehyd verdünnt. Muster wurden wie anderswo beschrieben hergestellt (Mittereder, N., et al. 1996. J Virology. 70: 7498-7509). Nach Färbung mit 2% Methylamin Tungstat (Nanoprobes, Stony Brook, NY) wurden die Kohlenstoffbeschichteten Muster ausgewertet und mit einem Philipps 410 Elektronenmikroskop fotographiert, das bei 80kv arbeitete (letzte Vergrößerung 85000x). Für jeden bestimmten Ad Serotyp wurde die Anzahl morphologisch defizienter viraler Partikel pro 100 in fünf zufälligen Feldern gezählt.

ERGEBNISSE Elektronenmikroskopie:

Man weiß wenig über die Stabilität von anderen Partikeln von Serotypen außer Ad5. Da die Intaktheit von viralen Partikeln entscheidend für vergleichende Wechselwirkungsuntersuchungen ist, wurden Virionen von oben spezifizierten Serotypen durch Elektronenmikrospkopie (EM) analysiert. EM-Untersuchungen von Negativkontrast-gefärbten Ad Suspensionen zeigten, das der Prozentsatz an defekten Partikeln (Verlust der ikosaedrischen Form oder der Färbung des Lumen) 5% nicht überschritt, was anzeigt, das Serotyp-Präparationen vergleichbare Qualitäten hatten. Repräsentative Photographien sind für Ad5, 9 und 35 gezeigt (11).

Serotyp Screening:

Man nimmt an, dass unterschiedliche Serotypen von Adenovirus an unterschiedliche zelluläre Rezeptorproteine binden und unterschiedliche Eintrittsmechanismen in die Zelle verwenden (Defer, C., et al., P. 1990.J. Virology. 64: 3661-3673; Mathias, P., et al.1994. Journal of Virology. 68: 6811-6814). Ein Satz von humanen Adenoviren wurde von der ATCC erhalten, um auf Tropfismus für CD34+ Zellen getestet zu werden. Diese umfassten Serotypen 3, 4, 5, 9, 35 und 41, die unterschiedliche SubTypn darstellen (Tabelle I). Wir glaubten, dass diese Serotypen aufgrund unterschiedlicher Länge des Schafts (Chroboczek, J., et al. 1995. Adenovirus fiber, Seite 163-200. In a. P. B. W. Doerfler (Hrsg), The molecular repertoire of adenoviruses, Bd. 1. Springer Verlag, Berlin ; Roelvink, P. W., et al. 1998. J. Virology. 72: 7909-7915), aufgrund der An- oder Abwensenheit von RGD Motiven innerhalb der Pentonbase und aufgrund unterschiedlichen Gewebetropismus unterschiedliche Zellanheftungs- und Internalisierungsstrategien verwenden würden. Der relativ wenig charakterisierte Ad35 wurde ausgwählt, da man ihn in immunsupprimierten Wirten, besonders in Empfängern von Knochenmark gefunden hatte (Flomenberg, P., et al. 1994. Journal of Infectious Diseases. 169: 775-781; Flomenberg, P. R., et al. 1987. Journal of Infectious Diseases. 155:1127-1134 ; Shields, A. F., et al. 1985 New England Journal of Medicine. 312: 529-533). Die letzte Beobachtung veranlasste uns dazu, zu glauben, dass Knochenmarkszellen ein natürliches Reservoir für Ad35 darstellen.

Tabelle II Humane und tierische Adenoviren von möglichem Interesse für die Erfindung

Die unterstrichenen Serotypen verwenden für das Eindringen in eine Zelle CAR-unabhängige Pathways.

Zur Amplifikation können entsprechende Stocks von Adenoviren auf HeLa oder A549 Zellen infiziert werden, so dass zu einem gegebenen Zeitpunkt nur ein Virustyp in einer getrennten laminaren Bank gehandlet werden muss und kann in Hepa-filtrierten Flaschen kultiviert werden, vorzugsweise in CO2 Inkubatoren zur Vermeidung der Kreuz-Kontamination. Während der Vermehrung wird die virale DNA durch eine der zuvor beschriebenen Techniken getaggt. Das XhoI-Restriktionsmuster wird durch Southern Blot auf unmethylierte und methylierte virale DNA analysiert unter Verwendung des Gesamtgenoms des entsprechenden Virustyps als radioaktive Sonde.

DISKUSSION

Obwohl früher aufgrund von Slot-Blot Assays berichtet wurde, dass Fiberknobs abgeleitet von 2, 9, 4 und 21L an CAR binden können (Roelvink, P. W., et al.. 1998. J. Virology. 72: 7909-7915), ist es nicht klar, ob diese Bindung mit einer physiologisch relevanten Affinität auftritt und ob dies zu Eintritt in die Zelle führen würde. Weiterhin wird ein zweiter Rezeptor für die Induktion von Virus-Internalisierung benötigt, wie für die Ad5 Wechselwirkung zwischen Penton und Integrinen gezeigt wurde. Wir haben gezeigt, dass unterschiedliche Serotypen mit den K562 oder CD34+ Zielzellen unterschiedlich interagierten. Ad5, Ad4 und Ad41 waren nicht in der Lage, an K562 und CD34+ Zellen effizient anzuheften und zu internalisieren. Obwohl Ad4 zu einer getrennten Untergruppe gehört (E), nimmt man an, das Ad4 ein natürliches Hybrid zwischen Subgruppe B und C Viren darstellt, mit einer Fiber, die mit Ad5 verwandt ist (Gruber, W. C., et al. 1993. Virology. 196: 603-611). Daher war es nicht überraschend, das Ad4 Bindeeigenschaften hat, die ähnlich zu Ad5 sind. Es wurde gezeigt, dass der Untergruppe F Serotyp Ad41 unterschiedliche Fibern enthält, eine Fiber mit langem Schaft und eine mit kurzen, die unterschiedliche Zelleintritts-Pathways ermöglicht (Tiemessen, C. T., Kidd, A. H. 1995. J. Gen. Virol. 76: 481-497). Die Ad41 Pentonbase enthält kein RGD Motiv, was nahelegt, das dieses Virus für den Eintritt in Zellen &agr;v-Integrin-unabhängige Pathways verwendet. Diese Eigenschaften verbesserten jedoch nicht die Wechselwirkung mit CD34+ Zellen. Ad9, Ad3, und Ad35 interagierten mit CD43+ Zellen effizienter als Ad5. Von alen getesteten Serotyoen zeigte Ad35 die effizienteste Anheftung und Internalisierung mit K562 und CD34+ Zellen, obwohl das kurzschaftige Ad9 an CAR binden kann, verwendet es bevorzugt &agr;v-Integrine für den Eintriit in Zellen (Roelvink, P. W., et al. 1996. J Virology. 70: 7614-7621). Somit kann der geringe Spiegel an Expression von &agr;v-Integrin auf bestimmten Untergruppen von CD34+ Zellen für die beobachtete Empfänglichkeit von Ad9 verantwortlich sein.

C. Anheftung und Internalisierung von Ad-Serotypen an/in K562 und CD34+ Zellen VERFAHREN Markierung von Ads mit [3H]-Methylthumidin:

Serotypen wurden wie anderswo beschrieben mit [3H-Methylthymidin markiert (Roelvink, P.W., et al. 1996. J Virology. 70: 7614-7621). 5 × 107 HeLa oder 293 Zellen wurden in 175 cm2 Flaschen mit 15 ml DMEM/10% FCS kultiviert und mit Wildtyp Adenovirus bei einer MOI von 50 oder höher infiziert. Zwölf Stunden nach Infektion wurde 1mCi [3H]-Methylthymidin (Amersham, Arlington Heights, IL) zum Medium zugegeben und Zellen wurden weiter bei 37°C inkubiert, bis eine vollständige CPE beobachtet wurde. Dann wurden die Zellen geerntet, pelletiert, einmal mit eiskaltem PBS gewaschen und in 5 ml PBS resuspendiert. Virus wurde aus den Zellen durch vier Zyklen Auftauen/Einfrieren gewonnen. Zelldebris wurde durch Zentrifugation entfernt und virales Material wurde einer Uiltrazentrifugation in einem CsCl-Gradienten unterworden und nachfolgend wurde wie zuvor beschrieben dialysiert (Lieber, A., C.-Y. et al. 1996. Journal of Virology. 70: 8944-8960). Virusaufreinigung und Dialyse entfernte nicht eingebaute Radioaktivität. Konzentrationen von Wildtyp-Ad Partikeln wurden spektrophotometrisch durch Messung der OD260 bestimmt, unter Verwendung de Extinktionskoeffizienten für Wildtyp Ad5 epsilon 260 = 9.09 × 1013 OD ml cm Virion (Maizel, J. V., et al. 1968. Virology. 36: 115-125). Virion-spezifische Radioaktivität wurde durch einen Flüssig-Szintilationszähler gemessen und war immer im Bereich von 1 × 10–5 bis 1 × 10–4 cpm pro Virion. Für ausgewählte Varianten wurde das Fibergen amplifiziert und sequenziert, um die Identität und die Abwesenheit von Kreuzkontamination zu bestätigen.

Virale DNA, markiert mit Methulase und Test auf Replikation durch genomische Southern Blots:

Um dieTransduktion endgültig zu bestätigen, kann ein Protokoll zum Nachweis von adenoviraler Replikation in infizierten Zellen etabliert werden. Virale DNA Synthese kann nur auftreten nach de novo Expression von adenoviralen frühen Genen. Eine ortsspezifische Methylierungsstrategie wird verwendet, um virale DNA Replikation in infizierten Zellen zu überwachen (Nelson, J. et al.,1997, Journal of Virology, 71: 8902-07). Methylierungsmarkiertes Adenovirus kann durch Addition einer Methylgruppe an die N6 Position der Adeninbase von XhoI Stellen, CTCGAG erzeugt werden, durch Vermehrung des Virus in HeLa Zellen oder A549 Zellen, die das XhoI Isoschizomer PaeR7 Methyltransferase (PMT) exprimieren (Kwoh, T. J., et al., 1986, Proc. Natl.Acad. Sci. USA 83,7713- 7717). Es ist bekannt, dass Methylierung die Vektorproduktion nicht beeinträchtigt, aber die Spaltung durch XhoI verhindert. Verlust der Methylierung durch virale Replikation stellt die XhoI Spaltung wieder her und kann durch Southern Blots genomischer DNA aus infizierten Zellen im Vergleich mit nativen, nicht-methylierten viralen genomen nachgewiesen werden.

Anheftungs und Internalisierungsassays:

Diese Untersuchungen wurden nach einem anderswo beschriebenen Verfahren durchgeführt (Wickham, T. J., et al. 1993. Cell. 73: 309-319). In präliminären Experimenten haben wir gefunden, dass markierte Ad5 Virionen ein Äquilibrium in der Anheftung an HeLa Zellen nach 45 Min bei 4°C mit einer MOI von 400 pfu pro Zelle erreichten. Für Anheftungsuntersuchungen wurden 3 × 105 Zellen für eine Stunde auf Eis mit gleichen Mengen [3H]-markierten Adenovirus OD Partikeln inkubiert, äquivalent zu einer MOI von 400 pfu/Zelle für Ad5 in 100 &mgr;l eiskaltem Adhäsionspuffer (Dulbeccos modified Eagle's Medium ergänzt mit 2 mM MgCl2, 1% BSA und 20 mM HEPES). Als nächstes wurden die Zellen durch Zentrifugation für 4 Minuten bei 1000g pelletiert und zwei Mal mit eiskaltem PBS gewaschen. Nach der letzten Waschung wurden die Zellen bei 1500 g peletiert, der Überstand wurde entfernt und die Zell-assoziierte Radioaktivität wurde durch Szintillationszählung bestimmt. Die Anzahl von pro Zelle gebundenen viralen Partikel wurde durch Verwendung der Virion-spezifischen Radioaktivität und der Anzahl vn Zellen berechnet. Zur Bestimmung der Fraktion der internalisierten [3H]-markierten adenoviralen Partikeln wurden die Zellen wie vorstehend beschrieben mit PBS gewaschen, in 100 &mgr;l Adhäsionspuffer resuspendiert, und dann bei 37°C für 30 Minuten inkubiert. Nach dieser Inkubation wurden die Zellen dreifach mit kalter 0.05% Trypsin-0.5 mM EDTA Lösung verdünnt und bei 37°C für weitere 5–10 min inkubiert. Diese Behandlung entfernt 99% der angehefteten Radioaktivität. Schließlich wurden die Zellen bei 1500 xg für 5 min pelletiert, der Überstand entfernt und die Protease-resistenten Zähler pro Minute wurden gemessen. Dieses Protokoll minimiert die Möglichkeit, das die Internalisierungsdaten durch Rezeptor-Recycling beeinträchtigt werden (Rodriguez, E., Everitt, E. 1999. Arch. Virol. 144: 787-795). Unspezifische Bindung von Ad Partikeln an Zellen auf Eis wurde in Anwesenheit eines 100fachen Überschuß an unmarkiertem Virus bestimmt. Dieser Wert stellte routinemäßig weniger als 0.1 % der Viruslast dar.

ERGEBNISSE Anheftung von Ad Partikeln an Zielzellen und Internalisierung:

Die ausgewählten Serotypen wurden metabolisch mit [3H] Thymidin markiert, das während der Replikation in die virale DNA eingebaut wird. Adsorption und Internalisierung können experimentell aufgetrennt werden, indem man sich die Beobachtung zunutze macht, das bei niedriger Temperatur (0–4°C) nur Virus-Zell-Anheftung auftritt, wobei die Internalisierung eine Inkubation bei höherer Temperatur benötigt. Die Anzahl von pro Zelle adsorbierten oder internalisierten Partikeln wurde unter Verwendung der Virion-spezifischen Radioaktivität berechnet und dazu verwendet, die Interaktion von Ads 3, 4, 5, 9, 35 und 41 mit CD34+, K562, HeLa und CHO-Zellen (12) zu quantifizieren. Die Serotypen unterschieden sich signifikant in ihrer Fähigkeit, an die unterschiedlichen Zelllinien anzuheften und von diesen internalisiert zu werden. Für Ad5 korrelierte der Grad an Anheftung an die getesteten Zelllinien mit dem Spiegel der CAR Expression. In CHO-Zellen, von denen früher gezeigt wurde, das sie durch Ad5 nicht infiziert werden können, betrug der Spiegel an Anheftung und Internalisierung etwa 50–70 virale Partikel pro Zelle. Diese Zahl wurde danach als negativ für die Empfänglichkeit eines gegebenen Zelltyps für Ad5 angesehen. Wechselwirkung der anderen Serotypen mit CHO Zellen war nicht signifikant höher, was zeigt, das die entsprechenden Rezeptoren auf CD34+ Zellen fehlen. Alle getesteten Serotypen interagierten mit HeLa Zellen, wobei Ad3 und Ad35 die effizientesten Varianten waren. Die Anwesenheit von unterschiedlichen Ad3 und Ad5 Rezeptoren wurde früher gezeigt (Stevenson, S.C., et al. 1995. J.Virology. 69: 2850-2857). Ad4, 5, und 41 banden nicht an K562 Zellen. Im Gegensatz dazu interagierten Ad9 als auch die Mitglieder der Untergruppe B, Ad3 und Ad35 effizient mit K562 Zellen, wobei Ad35 die höchste Zahl von adsorbierten und internalisierten Partikeln aufwies. Verglichen mit Ad5 wurden 25 Mal mehr Ad35 Partikel adsorbiert und ¾ davon wurden durch K562 Zellen internalisiert. Virale Interaktionen mit CD34+ Zellen waren im algemeinen schwächer. Unter den getesteten Serotypen wurden nur Ad9 und Ad35 signifikant durch nicht-zyklierende CD34+ Zellen internalisiert. Die Internalisierung von Ad9 und Ad35 war 4 und 8 Mal effizienter als für Ad35 Partikel. Die Anzahl von Ad35 Virionen, die durch CD35 Zellen internalisiert wurden, war nur halb so hoch wie die für Ad5 in HeLa Zellen, die leicht mit auf Ad5 basierenden Vektoren infiziert werden können.

Anheftung und Internalisierung von Adenovirus Serotypen 3, 5, 9, 35 und 41 in HeLa, 293 und CHO Zellen:

HeLa und 293 Zellen, die hohe Konzentrationen von primären und sekundären Rezeptoren für menschliche Adenoviren exprimieren, werden als positive Kontrolle für die Virusanheftung und die Internalisierung verwendet. Als negative Kontrolle wurden CHO Zellen verwendet. CHO Zellen exprimieren den primären adenoviralen Rezeptor nicht in einem nachweisbaren Level und sind daher einer Infektion mit Adenovirus nicht zugänglich. Für Untersuchungen zur Anheftung wurden diese adhärenten Zelllinien von 10 cm Schälchen durch PBS-EDTA-Lösung (ohne Ca2+ und Mg2+) abgelöst, drei Mal in eiskaltem PBS gewaschen, in Adhäsionspuffer resuspendiert, und wie vorstehend beschrieben im Beispielsteil mit Viren inkubiert. Wie erwartet werden ale adenoviralen Serotypen effizient angeheftet und in HeLa Zellen internalisiert (Tabelle III) (13). Adenovirus Serotypen 3, 5, 35, 41, aber nicht 9 werden effizient an 293 Zellen angeheftet und internalisiert. Im Gegensatz dazu beobachtet man mit CHO Zellen nur schwache Anheftung und Internalisierung der meisten Adenovirus Serotypen. Der Spiegel an Anheftung an CHO beträgt 50–79 Viruspartikel pro Zelle für die Adenovirus Serotypen 5 und 41, 115 Viruspartikel pro Zelle für den Adenovirus 3 und etwa 180 Partikel pro Zelle für die Adenovirus Serotypen 9 und 35. Fur die weitere Analyse werden >300 Partikel pro Zelle als positiv und <70 virale Partikel pro Zelle als negativ im Hinblick auf die Empfänglichkeit einer bestimmten Zelllinie für die effizienten virale Transduktion angesehen.

Tabelle III Vergleichende Analyse der Anheftung und der Internalisierung von Ad5 und Ad9 an Zelllinien, die unterschiedliche Mengen an CAR und &agr;v&bgr; Integrinen exprimieren

Anheftung und Internalisierung von Adenovirus Serotupen 3, 5, 9, 35 und 41 an humane CD34+ Knochenmarkszellen und K562 Erythroleukämie-Zelllinie: Frühere Untersuchungen zeigten, das die menschliche Erythroleukämie-Zelllinie K562 mit Ad5-basierten adenoviralen Vektoren mit sehr hohen MOIs transduziert werden kann. Wie in 14 gezeigt, werden bei einer MOI von 400 nur etwa 600 virale Partikel pro Zelle von Adenovirus Serotyp 5 angeheftet und noch weniger Partikel werden internalisiert. Im Gegensatz zu Ad5, werden 320 virale Partikel pro Zelle von Ad9 und etwa 1500 virale Partikel von Ad35 an K562 Zellen angeheftet und 2/3 davon werden auch internalisiert (14B). Humane unstimulierte CD34+ angereicherte Knochenmarkszellen, die aus gefrorenen Vorräten gewonnen werden, werden über Nacht in Wachstumsmedium ohne Cytokin-Stimulierung inkubiert, am nächsten Tag wird die Anzahl von lebensfähigen Zellen berechnet. Für Studien zur Anheftung werden die Zellen drei Mal mit eiskaltem PBS gewaschen, in Adhäsionspuffer resuspendiert und mit Adenoviren inkubiert. Unter den getesteten adenoviralen Serotypen waren nur ein adenovirales Partikel von Ad9 (etwa 150 virale Partikel pro Zelle) und Ad35 (etwa 320 virale Partikel pro Zelle) in der Lage, an unstimulierte CD34+ Zellen anzuheften, verglichen mit Ad5 (nur 60 virale Partikel pro Zelle). 4/5 dieser Viruspartikel sind in der Lage, von den Zellen internalisiert zu werden. Interessanterweise wird nach Stimulation der CD34+ Zellen mit GM-CSF und EPO/TPO für zwei Wochen die Anheftung und Internalisierung von Ad9 viralen Partikeln signifikant erhöht (bis zu 300 Partikel pro Zelle). Zur gleichen Zeit konnte die transiente Stimulierung der Zellen mit GM-CSF für zwei Tage den Spiegel der Anheftung von Virus an die Zellen nicht erhöhen.

Basierend auf der Erkenntnis, dass der Ad35 Serotyp an CD34+Zellen am effizientesten unter den getesteten Serotypen anheften und internalisieren kann, wurde der Serotyp 35 für weitere Untersuchungen ausgewählt. Wie in Appendix II beschrieben, war ein chimärer Vektor (Ad5 GFP/F35), der die Ad35 Fibersequenz mit dem kurzen Schaft enthält, in einem Ad5 Kapsid in der Lage, ein breites Spektrum von CD34+ Zellen in einer CAR/Integrin-unabhängigen Weise zu infizieren.

DISKUSSION

Zusammengefasst zeigten von alen getesteten Serotypen Ad9, Ad3 und Ad35 die effizienteste Anheftung an und Internalisierung in K562 und CD34+ Zellen. Basierend auf Daten zur Adsorption/Internalisierung wurden Ad9 und Ad35 als Repräsentanten der Untergruppen D und B für weitere Untersuchungen des Tropfismus ausgewählt.

D. Charakterisierung von Ad Vektorreplikation in K562 und CD34+ Zellen

Vergleichende Analyse von Ad5 und Ad9 und Ad34 zur Infektion und Replikation in 293, K562 und CC34+ Zellen. Die Fähigkeit der Ad9 Fiber-Knob-Domäne, den gleichen primären Rezeptor auf der Zelloberfläche wie Ad5 mit vergleichbarer Affinität zu erkennen wurde früher beschrieben. Somit ist die Erkenntnis, dass Ad9 virale Partikel nur schlecht an 293 Zellen anheften können, ziemlich unerwartet. Um herauszufinden, wie die Anheftungs- und Internalisierungsdaten die biologische Aktivität von Adenoviren unterschiedlicher Serotypen widerspiegeln, werden die Stocks von Ad5, Ad9 und Ad35 mehr im Detail durch Elektronenmikroskopie, Plaque-Assay auf 293 Zellen und durch quantitativen Replikationsassay in K562 und CD34+ Zellen untersucht.

VERFAHREN Quantitativer Replikationsassay:

1 × 105 CD34+ oder K562 Zellen wurden in 100 &mgr;l Wachstumsmedium mit unterschiedlichen MOIs von Ad5, 9 oder 35 infiziert, die in 293 Zellen amplifiziert wurden, und die das XhoI DNA Methyltransferase Isoschizomer PaeR7 (Nelson, J., Kay, M. A. 1997.Journal ol Virology !. 71: 8902-8907) exprimieren. Nach 2 Stunden Inkubation bei 37°C wurden die Zellen bei 1000xg zentrifugiert für 5 min, das Virus-enthaltende Medium wurde entfernt, die Zellen wurden in 100 &mgr;l frischem Medium resuspendiert und sie wurden dann bis zur Ernte bei 37°C inkubiert. 16 Stunden nach der Infektion für K562 Zellen oder 36 Stunden nach Infektion für CD34+ Zellen wurden 5&mgr;g pBS (Stratagene, La Jolla, CA) Plasmid-DNA als Träger hinzugegeben, die auch als Kontrolle verwendet werden könnte. Genomische DNA wurde wie beschrieben extrahiert (Lieber, A.,C.-Y. et al. 1996. Journal of Virology. 70: 8944-8960). Ein Viertel der aufgereinigten zellulären DNA (entsprechend 2.5 × 104 Zellen) wurde mit HindIII, XhoI oder mit HIndIII und XhoI zusammen bei 37°C über Nacht verdaut und danach in einem 1% Agarosegel aufgetrennt, gefolgt von Southern Blot mit chimären Ad5/9 oder Ad5/35 Sonden. Die chimären Sonden, die Sequenzen von Ad5 und Ad9 (Ad5/9) oder Ad5 und Ad35 (Ad5/35) enthalten, wurden durch eine Two-Step PCR Amplifikation mit Pfu-Turbo DNA Polymerase (Stratagene, La Jolla, CA) und viraler DNA aus aufgereinigten Partikeln als Matrize generiert. Die folgenden Primer wurden für die PCR verwendet (Ad5 sequenzen und Nukleotidnummern sind unterstrichen): Ad5F1- (nt: 32775-32805) 5'-GCC CAA GAA TAA AGA ATC GTT TGT GTTATG-3'; Ad5R1- (nt: 33651-33621) 5'-AGC TGG TCT AGA ATG GTG GTG GAT GGC GCC A-3'; chimärer Ad5/9F- (nt: 31150-31177, nt: 181-208)5'-AAT GGG TTT CAA GAG AGT CCC CCT GGA GTC CTG TCA CTC AAA CTA GCT GACCCA-3' ; chimärer Ad5/9R- (nt: 32805-32775, nt:1149-1113) 5'-CAT AAC ACA AAC GAT TCT TTA TTC TTG GGC TTC ATT CTT GGG CGA TAT AGG AAA AGG-3; chimärer Ad5/35F- (nt: 31150-31177, nt:132-159) 5'-AAT GGG TTT CAA GAG AGT CCC CCT GGA GTT CTT ACT TTA AAA TGT TTA ACC CCA-3', chimärer Ad5/35R (nt: 32805-32775, nt: 991-958) 5'-CAT AAC ACA AAC GAT TCT TTA TTC TTG GGC ATT TTA GTT GTC GTC TTC TGT AAT GTAAG-3'.

Nukleotidnummern werden vergeben gemäß den aus der NCBI erhaltenen Sequenzen (Zugangsnummer M73260/M29978 für Ad5, X74659 für Ad9 und U10272 für Ad35). Nach der ersten Amplifikation wurden ein 968 bp langes Fragment für Ad9, ein 859 bp langes Fragment für AD35, die den Fibergenen enstprechen und ein 876 bp langes Ad5 Fragment, das der Ad5 E4 Region entspricht (liegt unmittelbar stromabwärts vom Ad5 Fibergen) durch Agarosegelelektrophorese aufgereinigt. Zur Erzeugung chimärer DNA-Sonden wurde amplifizierte Ad5 DNA mit Ad9 oder mit Ad35 Fragmenten vermischt, die während dem ersten Schritt der PCR erhalten wurden, und einer zweiten Amplifikation mit Ad5/9F oder Ad5/35F Primern und dem Ad5R1 Primer unterzogen. Die entstehenden Ad5/9 oder Ad5/35F chimären DNA Fragmente (siehe 15) wurden aufgereinigt und deren Konzentration spektrophotometrisch gemessen. Entsprechende chimäre DNA-Fragmente wurden als Konzentrationsstandards auf Agarosegele aufgetragen oder mit [32P]-dCTP markiert und als Sonden für die Southern Analyse verwendet. Die Anzahl viraler Genome pro DNA Probe wurde nach quantitativer Phosphoimager-Analyse berechnet. In präliminären Experimenten wurde keine präferentielle Hybridisierung chimärer DNA-Sonden an DNA eines bestimmten viralen Serotyps nachgewiesen.

ERGEBNISSE Replikation ausgewählter Serotypen in K562 und CD34+ Zellen:

Adsorptions/Internalisierungsuntersuchungen beweisen die virale Transduktion nicht endgültig, ein Vorgang, der häufig als Gentransfer bezeichnet wird, der die virale oder heterologe Genexpression in Wirtszellen ermöglicht. Intrazelluläres Trafficking, einschließlich endosomaler Lyse, Transport zum Nukleus und nukleärer Import des viralen Genoms hängt von den strukturellen Capsidproteinen ab und variiert somit zwischen den verschiedenen Serotypen (Defer, C., etal., P. 1990. J. Virology. 64: 3661-3673; Miyazawa, et al. 1999. J Virology. 73: 6056-6065). Wir glaubten, dass die Analyse der viralen Genexpression ein Mittel wäre, um erfolgreichen Kernimport von viralen Genomen zu bestätigen und das dies ein gutes Kriterium wäre, Serotypen zu selektieren, die in der Lage sind, unsere Zielzellen zu infizieren. Um dies zu machen, verwendeten wir ein Protokoll, das den Nachweis von Ad Replikation in infizierten Zellen ermöglicht. Virale DNA-Synthese kann nur erfolgen nach der de novo Expression von frühen adenoviralen Genen. Wir verwendeten eine ortsspezifische Methylierungsstrategie zur Überwachung der viralen DNA Replikation in infizierten Zellen (Nelson, J., Kay, M. A. 1997. Journal of Virology.71: 8902-8907). Methylierte Ad Serotypen wurden durch die Zugabe einer Methylgruppe an die N6 Position der Adeninbase von XhoI-Stellen, CTCGAG erzeugt, während der Vermehrung der Viren in 293 Zellen, die die XhoI Isoschizomer PaeR7 Methyltransferase (PMT) exprimieren (Kwoh, T. J., et al. 1986.Proc Natl Acad Sci. USA. 83: 7713-7717)( (Roelvink, P. W., et al. 1996. J. Virology. 70: 7614-7621) (293 PMT Zellen). Verlust der Methylierung durch virale Replikation stellt die XhoI Spaltung wieder her und kann in Southern Blots XhoI-verdauter genomischer DNA aus infizierten Zellen nachgewiesen werden.

Ad Replikationsuntersuchungen wurden in K562 und Cd34+ Zellen durchgeführt, die mit Ad9 und Ad35 infiziert wurden, im Vergleich mit Ad5. Für Replikationsuntersuchungen wurden der infektiöse Titer/(in pfu/ml) und der genomische Titer (in Genomen pro ml) bestimmt (durch Plaque-Assay auf 293 Zellen oder durch quantitativen Southern Blot) für unmethylierte und methylierte Ad5, Ad9 und Ad35 (Tabelle 2). Das Verhältnis von pfu zu Genomtiter war vergleichbar mit methylierter und unmethylierter DNA, was zeigt, das die DNA-Methylierung die Transduktionseigenschaften nicht verändert hat. Etwa 85% von Ad5, 9 und 35 Virus, das für die Infektion verwendet wurde, war methyliert, berechnet nach der Intensität von Fragmenten, die spezifisch für methylierte und unmethylierte virale DNA ist, die in der Viruslast vorhanden ist (15). Die Anzahl von Genomen, die nach der Adsorption nachgewiesen wurde (1 h, 0°C) oder nach der Internalisierung (2 h 37°C) korrelierte gut mit den in 12 gezeigten Untersuchungen. Ad9 und Ad35 interagierten effizienter als Ad5 mit K562 und mit CD34+ Zellen. Dosisabhängige Replikationsuntersuchungen in K562 und CD34+ Zellen wurden mit der gleichen Genomanzahl von Ad5, 9 und 35 durchgeführt (15). Die Replikationsrate wurde basierend auf dem Verhältnis von methylierter und demethylierter viraler DNA nach der Infektion mit verschiedenen MOIs (2100, 420 und 105 Genome pro Zelle) gemessen. In K562 Zellen wurde effiziente Replikation (100% Konversion von unmethylierter zu methylierter DNA) für Ad5 bei einer MOI >/= 2100, für Ad9 bei einer MOI >/= 420 und für Ad35 bei einer MOI von >/= 105. Dies zeigte, das Ad35 K562 Zellen mit der höchsten Effizienz transduzierte. In CD34+ Zellen betrug die Replikationsrate 100% für Ad5 und 31% für Ad9 nach der Infektion mit MOI420. Obwohl methylierte Ad35 virale DNA in CD34+ Zellen anwesend war, war virale Replikation für Ad35 nicht nachweisbar. Zusammengefasst, während die viralen Replikationsuntersuchungen in K562 Zellen die Daten bestätigten, die für die Ad5, 9 und 35 Adsorption und Internalisierung erhalten wurden, gab es eine Diskrepanz zwischen den früheren Ergebnissen und der schwachen Replikation von Ad9 und insbesondere von Ad35 in CD34+ Zellen. Wie nachfolgend ausgeführt kann eine Replikationsanalyse in heterogenen Zellpopulationen wie CD34+ Zellen keine eindeutigen Schlussfolgerungen auf den Tropismus eines bestimmten Serotyps zulassen.

Fasst man ale Screeningdaten zusammen, dann gingen Ad9 und Ad35 als die Varianten mit dem stärksten Tropismus für K562 und Cd34+ Zellen hervor. Man nimmt an, das Ad9 an CAR binden kann, er verwendet jedoch präferentiell &agr;v-Integrine für den Eintritt in Zellen (Roelvink, P.W. et al., 1996, J. Virol. 70:7614-7621). Diese Eintrittsstrategie mag für die Infektion von CD34+ Zellen nicht optimal sein, da weniger als 17% davon &agr;v-Integrine exprimieren (10). Daher haben wir uns dafür entschieden, uns auf Ad35 als einen Ursprung für die heterologe Fiber für die Verwendung der Konstruktion eines chimären Vektors basierend auf einem Ad5-Gerüst zu konzentrieren.

Tabelle IV Ergebnisse des Infektiositätsassays, der das optische Verhältnis von Partikel zu PFU (OPU/PFU) bestimmt unter Verwendung von 293 Zellen
DISKUSSION

Untersuchungen zur viralen Replikation in K562 Zellen bestätigten die Daten, die für Ad5, 9 und 35 Adsorption und Internalisierung erhalten wurden. Es gibt jedoch eine Diskrepanz zwischen den Interaktionsdaten und den Replikationsdaten in CD34+ Zellen, in denen Ad9 nur schlecht repliziert und keine Replikation für Ad35 gesehen wurde. Ad Replikation wird nur nach dem Erreichen der Produktion einer kritischen Schwelle von frühen viralen Proteinen initiiert, die umgekehrt direkt von der Anzahl von viralen Genomen abhängt, die in den Nuklei infizierter Zellen vorhanden sind. Daher kann der Ausgang der Replikationsuntersuchungen durch die Rate des nukleären Import der viralen Genome, durch die Aktivität der viralen Promotoren und/oder durch die intrazelluläre Stabilität der viralen DNA/RNA beeinflusst sein. Diese Parameter können einerseits zwischen verschiedenen Subpopulationen von CD34+ Zellen und andererseits zwischen verschiedenen Ad Serotypen variieren. Als Schlussfolgerung können die Analysen zur viralen Replikation mit unterschiedlichen Ad Serotypen in Cd34+ Zellen die tatsächlichen Transduktionseigenschaften der chimären Vektoren basierend auf dem Ad5-Gerüst nicht vorhersagen. Dies impliziert, dass Versuche, Gentransfervektoren basierend auf anderen adenoviralen Genomen als Ad5 zu produzieren mit Vorsicht durchgeführt werden sollten.

Kürzlich wurde eine Ad Serotyp-Screeningstrategie dazu verwendet, Varianten mit einem Tropfismus für primäre fötale CNS-Cortexzellen der Ratte oder für menschliche Nabelvenen-Endothelzellen zu entwickeln. Der optimale Serotyp (Ad 17) wurde selektiert basierend auf Immunhistochemie für die Produktion von Hexon 48 h nach der Infektion (Chillon, M., et al. 1999. J. Virology. 73:2537-2540). Dieser Ansatz ist jedoch problematisch, da zumindest in unseren Händen Antikörper gegen das Ad5 Hexon mit anderen Serotypen nicht kreuzreagieren. Hexon wird auch nur nach dem Einsetzen der Replikation exprimiert. Wie oben erläutert variieren die Kinetiken des intrazellulären Trafficking, der viralen Genexpression und der Replikation signifikant zwischen verschiedenen Serotypen (Defer, C., et al., P. 1990.J. Virology. 64: 3661-3673; Miyazawa, et al. 1999. J. Virology. 73: 6056-6065).

Zusätzlich zu der Tatsache, das Ad35 der am meisten effiziente Serotyp im Hinblick auf die Interaktion mit CD34+ Zellen ist, ist Ad35 auch interessant, da er mit Rezeptoren interagiert, die sich von denen für Ad5 und Ad3 unterscheiden. Ad35 und Ad5GFP/F35 Anheftung wurde durch Ad5 oder anti-CAR Antikörper nicht inhibiert, was nahe legt, das die Bindung von Ad35 CAR-unabhängig ist. Zunächst kompetitierte Ad5 nicht mit Ad35 und Ad5GFP/F35 während der Internalisierung und Infektion, was zeigt, dass &agr;&ohgr;&bgr;3/5- Integrine nicht am Viruseintritt beteiligt sind. Dann kompetitieren Funktions-blockierende Antikörper gegen &agr;v-Integrine nicht mit Ad35 und Ad5GFP/F35 um die Internalisierung in K562 Zellen, wobei diese Antikörper die Internalisierung von Ad5 hemmten. Und drittens war die GFP Expression nach Infektion mit Ad5GFP/F35 im Gegensatz zu Ad5 Vektoren nicht auf &agr;v-Integrin exprimierende CD34+ Zellen beschränkt. Aus diesen Tatsachen schließen wir, dass an der Infektion mit Ad35 und dem chimären Ad5GFP/F35 Vektor keine &agr;v-Integrine beteiligt sind. In diesem Zusammenhang bleibt es zu bestimmen, ob in der Pentonbase RGD Motive anwesend sind oder nicht durch Sequenzierung der entsprechenden Genomregion. Kreuzkompetitionsassays zeigten, das Ad35 und Ad5GFP/F35 an einen anderen Rezeptor als an den Ad3 Rezeptor binden. Obwohl Ad3 und Ad35 zu der gleichen Subgruppe gehören, wurden sie in zwei DNA-Homologie-Cluster eingeteilt, B1 und B2; die Aminosäuren, aus denen ihre Fibern bestehen, sind nur zu 60% homolog. Weiterhin sind die Zielgewebe für beide Viren unterschiedlich; Ad3 kann akute respiratorische Infektionen auslösen, während Ad35 mit Niereninfektion assoziiert ist (Horwitz, M. S. 1996. Adenoviruses, Seiten 2149-2171. In B. N. Fields,Knipe. D. M., Howley, P. M. (Hrsg.), Virology, Bd. 2. Lippincott-Raven Publishers Inc., Philadelphia). Daher war es nicht überrraschend, festzustellen, das Ad3 und Ad35 verschiedene Rezeptoren erkennen.

Als Schlussfolgerung treten Ad35 und der chimäre Vektor in die Zellen durch einen CAR- und einen &agr;v-Integrin-unabhängigen Pathway ein. Wir glauben, dass Ad35 und der chimäre Vektor primär an ihre Fiberrezeptoren binden und das diese Wechselwirkung ausreicht, um Internalisierung auszulösen. Andererseits können an der Internalisierung von Ad35 andere zelluläre Proteine als &agr;v-Integrine beteiligt sein. Diese Membranproteine können mit jenen für die Internalisierung von Ad3 überlappen und stellen &bgr;2-Integrine dar, die mehr aus der Zelloberfläche herausragen als die &agr;v-Integrine (Huang, S., et al. 1996. J. Virology. 70: 4502-4508).

Gemäß EM-Untersuchungen von negativ-Kontrast gefärbten adenoviralen Suspensionen überschreitet der Prozentsatz an defizienten Partikeln für ale adenoviralen Serotypen 5% nicht. Plaque-Assays zeigen jedoch, dass die Fähigkeit, Plaques in 293 Zellen zu bilden, für die getesteten Serotypen signifikant unterschiedlich ist. Das optische Partikel-zu-PFU (OPU/PFU) Verhältnis für Ad5 beträgt 13, was gut mit dem zuvor abgeschätzten Verhältnis für diesen adenoviralen Serotyp übereinstimmt. Diese Verhältnis ist etwa drei Mal höher für den Adenovirus Serotyp 35 und mehr als 150 fach höher für den Adenovirus Serotyp 9. Weiterhin wird eine quantitative Southern Blot Analyse mit chimären Ad5/9 und Ad5/35 DNA-Sonden dazu verwendet, das Verhältnis zwischem dem Genomtiter und dem transduzierenden Titer zu bestimmen. Diese Untersuchung bestätigt die im Plaque-Assay erhaltenen Daten. Die Replikation viraler Genome wird für Ad9 und Ad34 bei niedrigeren MOIs beobachtet, verglichen mit Ad5. Zusammengefasst stimmem die Daten, die man für verschiedene Serotypen für die Anheftung und für die Internalisierung erhalten hat, gut mit den Infektiositätsdaten in Zielzellen überein.

E. Anheftung und Internalisierung von verschiedenen adenoviralen Serotypen in primäre dendritische Zellen, JAWSII, MCF-7 und REVC Zellen

Als Proof of Principle kann die Serotyp-Screeningstrategie für andere wichtige Zielzellen verwendet werden, die unzugänglich sind für Infektion mit Ad5.

ERGEBNISSE

RECV Zellen sind endotheliale Zellen, die für Ansätze, die auf Gentherapie von Restenose, Arteriosklerose, Entzündung etc. gerichtet sind, umgeleitet werden müssen. MCF-7 Zellen sind Brustkrebszellen, die aus Lebermetastasen isoliert wurden, die wichtige Ziele für die Gentherapie von Tumoren sind. Die menschlichen Adenovirus Serotypen 3, 5, 9, 35 und 41 werden getestet, um zu sehen, ob sie an primäre dendritische Zellen von der Maus, an JAWSII Zellen, an MCF-7 Brustkrebszellen und an REVC endotheliale Zellen anheften und internalisieren können. Keiner der getesteten adenovirale Serotypen kann effizient an primäre dendritische Zellen anheften. Adenovirus Serotyp 3 ist in der Lage, effizient an REVC endotheliale Zellen (etwa 400 Viruspartikel pro Zelle sind angeheftet und etwa 300 werden internalisiert) anzuheften. Im Vergleich dazu können nur etwa 50 Ad5 Partikel an diese REVC anheften und noch weniger in diese internalisieren. Für die humanen Brustkrebszellen (MCF-7) wurde zuvor gezeigt, dass diese für Ad5 Infektion bei niedrigen MOIs unzugänglich sind. Ad3 und noch besser Ad5 heften sich jedoch an MCF-7 Zellen an und werden internalisiert.

DISKUSSION

Die hier gezeigten Daten zeigen, dass verschiedene Serotypen von humanen Adenoviren unterschiedliche zelluläre Rezeptoren erkennen und somit ZellTypn infizieren können, die für eine Infektion mit Ad5 nicht zugänglich sind. Es gibt adenovirale Serotypen, die besser und effizienter als Ad5 an humane CD34+ Zellen, REVC, K562 und MCF-7 Zellen anheften und internalisieren können. Diese Erkenntnis stellt eine Basis für die Konstruktion von chimären adenoviralen Vektoren bereit, die Ad5 Vektoren sind, die Rezeptorliganden enthalten, die von anderen Serotypen abgeleitet sind.

F. Infektionsuntersuchungen auf primären humanen Knochenmarkszellen

Da etablierte erythroleukämische Zelllinien kein geeignetes Modell für die ultimative hämatopoietische Stammzelle darstellen, die in Patienten angesprochen werden muss, um eine Langzeit-Rekonstitution mit genetisch modifizierten Zellen zu erreichen, werden normale primäre humane Knochenmarkszellen für die anfänglichen Infektions/Retargeting-Untersuchungen verwendet.

ERGEBNISSE

In einer ersten Reihe von Tropismusuntersuchungen mit unterschiedlichen Ad Serotypen können vollständige Knochenmarkszellsuspensionen ohne Präselektion verwendet werden. Dies ist vorteilhaft, da der Tropfismus von verschiedenen adenoviralen Serotypen oder genetisch auf ein anderes Ziel ausgerichteten Vektoren auf einem breiten Spektrum von Vorläufer-Subpopulation analysiert werden kann, die myeloide, erythroide, megakaryocytische, lymphoide, dendritische und monocytische Linien repräsentieren. Für kurzzeitige Infektionsstudien (<5 h) können Knochenmarkssuspensionen in IMDM kultiviert werden, ergänzt mit 10% FCS, &bgr;-Mercaptoethanol und 10 U/ml IL-3 zur Gewährleistung der Lebensfähigkeit der Zellen.

Mononukleärer Zellassay:

Einkernige Knochenmarkszellen können mit einer MOI von 1, 10, 100 oder 1000 pfu/Zelle der verschiedenen adenoviralen Serotypen für eine kurze Zeit inkubiert werden. Paraffinschnitte oder Cytospins von infizierten Knochenmarkszellen können auf im Kern lokalisierte, markierte virale DNA analysiert werden. BrdU-Markierung kann durch Immunfluoreszenz mit anti-BrdU-Antikörpern sichtbar gemacht werden; 32P-getaggte virale DNA kann durch Inkubation mit Photoemulsion nachgewiesen werden. Zusätzlich kann das gleiche Zellmaterial auf Morphologie nach spezifischer Histofärbung (z.B. Wright-, Hemo3 Färbung) analysiert werden. Wenn erforderlich, dann können käuflich erhältliche Antikörper dazu verwendet werden, spezifische Zelloberflächenmarker, die direkt am unterschiedliche Fluorochrome (FITC, grün), TRIT, RPE (rot), RPE-Cy5, AMCA (blau) konjugiert sind, infizierte Subpopulationen von Knochenmarkszellen vollständig zu charakterisieren. Kolokalisiation von BrdU-markierter viraler DNA (z.B. als FITC Signal) mit Membranmarkern, die die Infektion spezifischer ZellTypn zeigt, kann gezeigt werden; z.B. mögliche Stammzell/frühe Vorläufer (CD34+, CD38–), Megakaryocyten (CD41a+), erythroide Zellen (Glycophorin A+), dendritische Zellen (CD1a+), Monozyten (CD14+) oder myeloide Zellen (CD15+), etc. Die morphologische Analyse infizierter Untergruppen von Knochenmark gibt eine erste Information darüber, ob spezifische Serotypen von Adenovirus primitive ZellTypn infizieren können.

DISKUSSION

Da die unterschiedlichen Wildtyp-Adenoviren kein einheitliches Markergen exprimieren und nicht integrieren und da der Nachweis von getaggter viraler DNA an lebenden Zellen nicht durchgeführt werden kann, ist es an diesem Punkt nicht möglich, infizierte Zellen auf die Fähigkeit zur Klonbildung oder der Repopulation zu testen. Daher werden für Untersuchungen zum retargeting Serotypen von Adenovirus ausgewählt, basierend auf ihrer Fähigkeit, aufgereinigte CD34+ Zellen in vitro bei niedrigen MOIs zu infizieren. Diese Untergruppe von Knochenmarkszellen ist dafür bekannt, Langzeit-rekonstituierende Zellen zu enthalten. Infektionsuntersuchungen mit unterschiedlichen Serotypen von Adenovirus können auf gereinigten CD34+ Zellen (kultiviert in IMDM + 10%FCS, &bgr;-Mercaptoethanol und 10 Einheiten/ml IL-3) wie vorstehend beschrieben durchgeführt werden. Aufreinigung von CD34+ Zellen kann durch direkte Immunadhärenz auf mit anti-CD34 monoklonalem Antikörper beschichteten Platten oder auf MiniMacs Säulen wie beschrieben von Papyannopoulou (Papayannopoulou, T. et al., 1996, Experimental Hematology, 24: 66069; Papayannopoulou, T. etal., 1993, Blood, 81:229) durchgeführt werden. Die Reinheit von isolierten CD34+ Zellen liegt im Bereich von 80–95%. Analoge Infektionsuntersuchungen können mit selektierten AdenovirusTypn auf CD34+/CD38– Untergruppen durchgeführt werden.

Zur Bestätigung der produktiven Infektion können aufgereinigte CD34+ Zellen mit selektierten (Methylase-getaggt) Serotypen infiziert und auf virale DNA Replikation analysiert werden. Kulturen von aufgereinigten menschlichen Knochenmarkszellen CD34+ können als ein Modell für BCs für die Transduktions- und Integrationsuntersuchungen verwendet werden.

Es wurde kürzlich gezeigt, dass HCS-Aktivität in CD34-negativen humanen Knochenmarkszelen existiert (Bathia, M. et al., 1998, Nature Medicine, 4: 1038-45; Osawa, M., et al., 1996. Science. 273: 242-5. Goodell. M. etal., 1997, Nature Medicine, 3: 1337-45: Zanjani, E. D. et al., 1998, Exp.Hematology, 26: 353-60). LinCD34-38- Zellen können in Studien zum Retargeting und zur Transduktion in Kombination mit Repopulationsassays in SCID-NOD Mäusen getestet werden.

G. Klonierung und Insertion des Fibergens VERFAHREN PCR-Klonierung des entsprechenden Fibergens und Insertion in auf Ad5 basierende shuttle-Plasmide anstelle der endogenen Ad5 Fiber:

Einer oder mehrere Adenoviren mit Tropismus für CD34+ oder für eine andere HCS-haltige Population wird für die weiteren hier beschriebenen Studien ausgewählt. Die vollständige kodierende Region für die Fiber variiert zwischen 1-2kb, abhängig vom Virustyp. Die Fiber-kodierenden Sequenzen können durch PCR mit Pfu Polymerase aus viraler DNA erhalten werden aus aufgereinigten Partikeln aus den ausgewählten VirusTypn. Die entsprechenden Primer können basierend auf den Fibersequenzen entworfen werden, die aus der EMBL Genbank erhältlich sind. Die PCR-Produkte werden als PacI-BalI Fragment in pCD4 (10) kloniert, ein shuttle Vektor für die Rekombination von RecA+ E. coli. In pCD4 ist das heterologe Fibergen auf beiden Seiten von Ad5 Sequenzen flankiert, die homolog zu Bereichen sind, die in Ad5 direkt benachbart sind zum Leserahmen der Fiber. Als ein von Ad5 (shuttle Vektor) abgeleitetes Template für die Rekombination kann pCD1, ein pBHG 10 (Microbix, Toronto, Canada) Derivat verwendet werden. Die Rekombination wird nach einem Protokoll durchgeführt, das routinemäßig für die Erzeugung rekombinanter Adenoviren verwendet wird (Chartier. C.. et al., 1996, J. of Virology, 70,4805-4810). Meist werden 90% der entstehenden Plasmide richtig rekombiniert. Die Verbindungen zwischen den heterologen Fiber (X) und den Ad5 Sequenzen können zur Bestätigung der Richtigkeit der Rekombination sequenziert werden. Das entstehende Plasmid wird als pAdfiberX (pAD5fx) bezeichnet. Das entstehende Produkt wird dazu verwendet, auf pAd5fx-basierende AAV zu erzeugen, die das heterologe Fibergen enthalten.

Konstruktion von chimären Ad Vektoren:

Für Transduktionsuntersuchungen wurden zwei Ad Vektoren hergestellt: AA5GFP und Ad5GFP/F35, der ein chimäres Ad5/35 Fibergen enthält. Beide adenoviralen Vektoiren enthielten ein 2.3 kb großes, vom CMV Promotor getriebenes EGFP Gen (abgeleitet von pEGFP-1, Clontech, Palo Alto, CA), das in die E3 Region von Ad5 eingesetzt war. Die EGFP Expressionskassette wurde zwischen die Ad5 Sequenzen 25, 191-28, 191 und 30, 818-32, 507 in ein shuttle-Plasmid kloniert, das die für pBHG10 beschriebene E3 Deletion enthielt (Microbix, Toronto, Canada). Das entstehende Plasmid wurde pADGFP genannt. Für den chimären Vektor wurde das Ad5 Fibergen in pAdGFP durch eine Ad5/35 chimäres Fibergen ersetzt, das durch die oben beschriebenen Two-Step PCR erzeugt wurde. In dem ersten PCR-Schritt wurden drei DNA-Fragmente, entsprechend i) der Ad5 Fiber 5'-untranslatierten Region und den ersten 132 bp der Fiberschwanzdomäne (nt 30, 818-31, 174), (ii) die Ad 35 Schaft und Knobdomänen (nt 132-991), und iii) die Ad5 E4 Region einschließlich des Ad5 Fiber-Polyadenylierungssignals (nt 32, 775-33, 651) durch Pfu-Turbo DNA Polymerase amplifiziert. Die folgenden Primer wurden verwendet: für den Ad5 Schwanz, Ad5F-2 (nt 30,798-30,825) 5'-CGC GAT ATC GAT TGG ATC CAT TAA CTA-3' und Ad5R-2 (nt 31,174-31,153) 5'-CAG GGG GAC TCT CTT GAA ACC CATT-3'; für den Ad35 Schaft und Knob, Primer Ad5/35F und Ad5/35R (siehe oben); für den Ad5E4 und den Poly A, Primer Ad5-F1 und Ad5-R1 (siehe oben). Nach 10 PCR-Zyklen wurden die Produkte durch Agarosegelektrophirese aufgereinigt, vereinigt und einer zweiten PCR mit den Primern Ad5F-2 und Ad5R1 unterzogen. Das entstehende 2115 bp lange chimäre Fibergen enthielt den Ad5 Schwanz und den Ad35 Schaft und Knob. Das Produkt wurde als Ersatz für das SalI/XbaI Ad5 Fibergen-haltige Fragment in pAfGFP verwendet. Das entstehende Plasmid wurde als pAdGFP/F35 bezeichnet. Zur Erzeugung von vollständigen E1/E3 Vektorgenomen wurden pAdGFP und pADGFP/F35 in pAdHM4 (Mizuguchi, H., Kay, M.A., 1998, Human Gen Therapy 9:2577-2583) durch Rekombination in E.coli (Chartier, C., E. et al. 1996. Journal of Virology. 70: 4805-4810) inseriert. Um dies zu tun wurde der RecA+ E. coli Stamm BJ5183 mit pAdHM4 ko-transformiert, der mit SrfI linearisiert wurde, vermischt mit den XbaI Fragmenten, die die GFP Gene, die Ad5 oder Ad5/35 Fibergene und die Ad5 Homologiebereiche enthalten. Die entstehenden Rekombinanten wurden durch Restriktionsanalyse analyisert. Korrekte Rekombinanten wurden in E. coli HB101 amplifiziert und durch doppelte CsCl-Gradienten-Bandenbildung aufgereinigt. Die Plasmide wurden als pAd5GFP und pAd5GFP/F35 bezeichnet. Die richtige Struktur des Ad5/35 chimären Fibergens wurde durch Endonukleaseverdau und durch Sequenzierung eines Teils von pAd5GFP/F35 bestätigt. Zur Erzeugung der entsprechenden Viren wurden pAd5GFP und pAd5GFP/F35 mit PacI verdaut, um die viralen Genome freizusetzen und wurden wie beschrieben in 293 Zellen transfiziert (Lieber, A., C.-Y. et al. 1996. Journal of Virology. 70: 8944-8960). In überlagerten Kulturen bildeten sich 7 bis 10 Tage nach Transfektion Plaques. Rekombinante Viren wurden in 293 Zellen vermehrt und durch anderswo beschriebene Standardverfahren aufgereinigt (Lieber, A., C.-Y. et al. 1996.Journal of Virology. 70: 8944-8960).

Hämagplutinationsassay:

25 &mgr;l aus seriellen Verdünnungen von Ad5, Ad35 oder chimären Ad5GFP/F35 Virionen in McIlvaine Puffer (0.1 M Zitronensäure, 0.2 M Na2HPO4, pH 7.2, verdünnt 1:50 mit 0.87% NaCl) wurden auf 96-Lochplatten geladen. Zu jeder Verdünnung wurden 25 &mgr;l einer 1% Suspension Affenerythrozyten (in McIlvaine Puffer) zugegeben. Das Sedimentationsmuster wurde nach 1 h Inkubation bei 37°C bestimmt. Alle Tests wurden in wenigstens zwei unabhängigen Experimenten vierfach durchgeführt.

Southern Blot:

Extraktion genomischer DNA, Markierung von DNA-Fragmenten und Hybridisierung wurden wie früher beschrieben durchgeführt (Lieber, A., C.-Y. et al.1996. Journal of Virology. 70: 8944-8960).

ERGEBNISSE Konstruktion/Charakterisierung der chimären Fiber:

Es wurde zuvor gezeigt, das der Austausch des Fiberknob zur Veränderung des Tropfismus chimärer Ad Vektoren ausreicht (Chillon, M., et al. 1999. J Virology. 73: 2537-2540 Krasnykh, V., et al. 1998.J. Virology. 72:1844-1852 ; Stevenson. S. C., et al. 1997. J.Virology. 71: 4782-4790). Wie oben dargestellt, kann die Länge des Fiberschafts kritisch für die Eintrittstrategie eines bestimmten Serotyps sein. Daher entschieden wir uns, nicht nur den Ad5 Fiberknob, sondern auch den Schaft zu ersetzen. Die chimäre Ad5/35 Fiber enthielt den Ad5 Schwanz (Aminosäure 1–44), der für die Interaktion mit der Ad5 Pentonbase wichtig ist, gekoppelt an 279 Aminosöuren von Ad35, einschließlich den Schaft mit 7 &bgr;-Faltblättern und den Knob (16A). Das endogene Ad5 Fiber PolyA-Signal wurde dazu verwendet, die Transkription der chimären Fiber-RNA zu beenden. Die Kombination des Ad5 Kapsids einschließlich des RGD Motivs enthaltend die Pentonbase mit einer kurzschaftigen Fiber könnte riskant sein, da die natürliche Distanz zwischen dem Fiber-Knob und den RGD Motiven zerstört wurde. Die Ad5 Fiber wurde durch chimäre Fibersequenzen ersetzt, basierend auf einem E1/E3 deletierten Ad5 Vektor. Dieser Vektor trug eine CMV-Promoter-GFP-Reportergenkassette inseriert in den E3 Bereich. Das entsprechende chimäre Virus (Ad5GFP/F35) wurde in 293 Zellen in einem Titer von >2 × 1012 Genomen pro ml erzeugt. Zum Vergleich wurden ein E1/E3 deletierter Ad Vektor, der das ursprüngliche Ad5 Fibergen und die GFP-Expressionskassette enthält (Ad5GFP), erzeugt. Der Titer und die Ratio von physikalischen zu infektiösen Partikeln war zwischen Ad5GFP und Ad5GFP/F35 ähnlich, was zeigt, das die Fibermodifikation die Stabilität und/oder die Wachstumseigenschaften des chimären Vektors nicht signifikant ändert. Die Korrektheit der Fibermodifikation wurde durch Restriktionsanalyse des Ad5GFP/F35 viralen Genoms, gefolgt von Southern Blot Hybridisierung bestätigt (16B), direkte Sequenzierung der für die Fiber kodierenden Region und mit einem funktionellen Test für Hämagglutination (HA) von Affen-Erythrozyten. Die Agglutination von Erythrozyten wird durch Fiber-Knob vermittelt; es ist bekannt, das Ad5 Affen-Erythrozyten nicht agglutiniert, während Ad35 dies effizient tut (Pring-Akerblom, P., et al. 1998. J. Virology. 72: 2297-2304). In HA Tests agglutinierte Ad5GFP/F35 Affen-Erythrozyten mit der gleichem Effizienz wie Ad35 bei Verdünnungen von bis zu 1:515. Im Gegensatz dazu wurden mit gleichen Verdünnungen von Ad5 keine Hämagglutination beobachtet. Dies bestätigte die funktionale Aktivität der chimären Ad5/35 Fiber, eingebaut in das Ad5 Kapsid.

Erzeugung von chimären adenoviralen Verktoren (Ad.AAVfx) mit heterolopen

Fibermolekülen: Adenoviren mit chimären Ad5-Ad3 Fibern sind lebensfähig und können in höhen Titern erzeugt werden (Krasnykh, V., et al. 1996, J of Virolog, 70, 6839-6846; Stevenson, S. C. et al., 1997,J Virology, 71: 4782-90). Um zu testen, ob der Fiberaustausch die Prioduktion oder die Stabilität von Adenoviren beeinflußt, werden zwei E1 deletierte adenovirale Vektoren der ersten Generation mit der AAV-&bgr;-Gal Kassette in 293 Zellen nach Standardprotokollen erzeugt. Der Vektor wird generiert durch Rekombination von pAd.AAV-BG (17) mit pCD1 (enthält die endogene Ad5 Fiber); der andere Verktor (mit der heterologen Fiber) ist das Rekombinationsprodukt von pAd.AAV &bgr;Gal und pADSFiberX (pAd5fx). Virus aus einzelnen Plaques wird auf 293 Zellen amplifiziert, die Produktion pro 293 Zellen kann durch Plaque-Titration von 293 Zelllysaten bestimmt werden. Es wird angenommen, das die Modifikation der Fiber die Stabilität der chimären Vektoren nicht kritisch beeinflusst. Schließlich können Knochenmarkszellen mit den neu ausgerichteten Vektoren infiziert werden. Zwei Tage nach der Infektion wird Zytometrie an lebenden Zellen für &bgr;-Gal Expression mit dem Substrat Fluoresceindi-&bgr;-D-Galactopyranosid (FDG) (Cantwell, M.J. et al., 1996, Blood 88:4676-4683; Neering, S. et al., 1996, Blood, 88:1147-55; Fiering, S.N. et al., 1991, Cytometry 12:291; Mohler, W. et al., 1996, PNAS 93:57) durchgeführt und die infizierten Zellen werden nach Morphologie und Oberflächenmarkern charakterisiert. Vor und nach der Infektion können Knochenmarkszellen in IMDM/FCS kultiviert werden, das mit Thrombopoeitin (Tpo) ergänzt ist, das das Überleben von HCS unterstützt (Matsunaga, T. et al., 1998, Blood, 92:452-61; Papayannopoulou, T. et al., 1996, Experimental Hematology 24:660-69). Alternativ dazu können neu ausgerichtete Vektoren mit der AAV-GFP Kassette erzeugt werden und FACS Analyse kann mit transduzierten Zellen basierend auf Expression von GFP und Overflächenmarker durchgeführt werden.

H. Kompetitionsuntersuchungen des chimären Fiberproteins Ad5/35 Kompetitionsuntersuchungen:

Kreuzkompetitionsuntersuchungen zwischen Ad5, 35 und Ad5GFP/F35 (18) um die Bindung und um die Internalisierung wurden durchgeführt, um die Pathways, die von den chimären Verktoren dazu verwendet werden, Zielzellen zu infizieren, genauer im Detail zu untersuchen. Wildtyp Ad35 und der chimäre Vektor Ad5GFP/F35 könnten den gleichen primären Rezeptor erkennen, da sie miteinander um die Anheftung an K562 Zellen konkurrierten (19A, oben). Diesr primäre Rezeptor unterscheidet sich von dem, der von Ad5 verwendet wird, da weder Ad5 virale Partikel noch anti-CAR monoiklonale Antikörper (19B, oben) in der Lage waren, die Bindung von Ad35 oder Ad5GFP/F35 zu stören. In Kompetitionsuntersuchungen um die Internalisierung konkurrierten Ad35 und Ad5GFP/F35 mit gleicher Effizienz miteinander. Ad5 und anti-&agr;v-Integrin monoklonale Antikörper (L230) (19C, unten) hemmten die Internalisierung von Ad35 oder von chimärem Virus nicht. Um diese Daten zu konsolidieren, wurden K562 Zellen mit Ad5GFP und Ad5GFP/F35 nach vorheriger Inkubation der Zellen mit Anti-CAR oder anti-&agr;v-Integrin monoklonalen Antikörpern infiziert, gefolgt von Analyse GFP exprimierender Zellen. Die Transduktionsdaten spiegeln die Ergebnisse wider, die man in Adsorptions/Internalisierungsstudien erhält: Zusammengefasst zeigt dies, dass Ad35 und Ad5 GFP/F35 einen von CAR und &agr;v-Integrin unabhängigen Pathway für die Infektion von K562 Zellen verwenden; die strukturellen Elemente, die für diese spezifischen Eigenschaften verantwortlich sind, sind innerhalb der Ad35 Fiber lokalisiert und können durch Fiberaustausch in Ad5 transplantiert werden.

Ad3 kann mit K562 Zellen effizient interagieren (12), obwohl Ad3 und Ad5 zur gleichen Subgruppe (B) gehören, beträgt die Homologie zwischen den Aminosäuresequenzen ihrer Fibern nur etwa 60%. Daher entschieden wir uns dafür, zu testen, ob Ad3 mit Ad35 und Ad5GFP/F35 um Anheftung und Internalisierung (20) konkurrieren könnte. Diese Studien zeigten, dass die Bindung von Ad35 durch Ad3 nicht gehemmt wurde, was die Verwendung unterschiedlicher Rezeptoren zeigt. Interessanterweise hemmt Ad3 die Anheftung von Ad5GFP/F35 (20A, links) leicht. Zusätzlich zur Bindung an den für die Ad35 und Ad5GFP/F35-gewöhnlichen Fiber kann auch das chimäre Capsid (z.B. die Ad5 Penton RGD Motive) mit einem zweiten zellulären Rezeptor interagieren, der mit den Elementen überlappt, die an der Ad3 Bindung beteiligt sind. Bei der Kreuzkompetition um die Internalisierung verringerte eine Präinkubation der Zellen bei 37°C mit Ad35 und mit chimärem Virus die Internalisierung von [3H]-markiertem Ad3 signifikant (20D, rechts). In dem umgekehrten Experiment verringerte Ad3 als Kompetitor die Internalisierung von beiden, von Ad35 und von dem chimären Virus, um 30% (20B, rechts). Wie erwartet konkurrierten Ad5 und Ad3 nicht um die Adsorption oder um die Internalisierung. Wie zuvor gezeigt (19B) blockierten Anti-CAR und anti-&agr;v-Integrin Antikörper die Interaktion von Ad3 mit K562 Zellen nicht. Zusammengefasst zogen wir die Schlussfolgerung, dass Ad35 und Ad5GFP/F35 an andere Rezeptoren als Ad3 binden, obwohl sie für die Internalisierung gleiche Strukturelemente verwenden können, die sich von &agr;v-Integrinen unterscheiden.

Infektionsuntersuchunpen mit chimärem Virus:

Es ist etabliert, dass Ad5GFP/F35 K562 Zellen in einem von CAR und &agr;v-Integrinen unabhängigen Pathway infizierte. Es ist möglich, dass diese Eigenschaft die effiziente Transduktion von nicht-zyklierenden CD34+ Zellen ermöglicht, die CAR und &agr;v-Integrine nur wenig exprimieren. Um dies zu testen wurden die Transduktionseigenschaften von Ad5GFP und von Ad5GFP/F35 auf CD34+ Zellen, K562 und HeLa Zellen analysiert. 21 zeigt den Prozentsatz von transduzierten, GFP-exprimierenden Zellen abhängig von der für die Infektion verwendeten MOI.

Fast 100% der HeLa Zellen waren mit Ad5GFP und Ad5GFP/F35 bei MOIs von >/= 25 transduziert. Mehr als 95& der K562 Zellen wurden mit Ad5GFP/F35 bei MOIs>/=100 transduziert, wobei die Transduktionsrate bei Ad5 signifikant niedriger war, wo sie mit ansteigenden MOI zunahm, bis sie ein Plateau von ~7&bgr;% GFP-positiven Zellen nach Infektion mit einer MOI von 400 erreichte. Transduktion von CD34+ Zellen war mit Ad5GFP/F35 etwa drei Mal effizienter als mit Ad5GFP bei alen analysierten MOIs. Interessanterweise stieg bei höheren MOIs die Transduktionsrate nicht proportional mit der viralen Dosis an und erreichte bald ein zweites Plateau, was zeigt, dass in beiden Fällen nur spezifische Untergruppen von CD34+ Zellen für die Infektion permissiv waren. Um diese spezifischen, permissiven Untergruppen genauer zu charakterisieren, wurden zusätzliche Transduktionsuntersuchungen durchgeführt. Zunächst wurde der Prozentsatz an GFP-exprimierenden Zellen in CD34+ Fraktionen bestimmt, die für &agr;v-Integrine oder Car gefärbt wurden (22). Die niedrige Zahl von CAR-positiven CD34+ Zellen erschwerte Ko-Markierungs-Untersuchungen, und es gab keine Korrelation zwischen CAR Expression und der Proportion der transduzierten Zellen unter CD34+ Zellen, die mit Ad5GFP und Ad5GFP7F35 infiziert wurden. Interessanterweise waren bei Ad5GFP 65% der GFP-exprimierenden Zellen positive für &agr;v-Integrine, während weniger als 22% der GFP-exprimierenden Zellen, die mit dem chimären Virus infiziert wurden, eine positive Färbung für die Expression von &agr;v-Integrin aufwiesen. Während nur 17% der gesamten CD34+ Population nach der Infektion mit Ad5GFP GFP exprimierten, betrug der Prozentsatz an GFP-exprimierenden Zellen in der CD34+/&agr;v-Integrin-positiven Fraktion 50%. Dies zeigt, das die durch den Vektor Ad5GFP vermittelte Expression von GFP präferentiell auf &agr;v-Integrin-positive Untergruppen lokalisiert war, während nach der Infektion mit dem Ad5GFP7F35 Vektor GFP in einem breiteren Sektrum von CD34+ Zellen lokalisiert war, von denen die meisten &agr;v-Integrin negativ waren.

Als nächstes wurden transduzierte Zellen gleichzeitig sowohl auf GFP als auch auch CD34 und CD117 Marker untersucht. Wie zuvor bemerkt waren etwa 90% aler Zellen, die in unserer Analyse verwendet wurden, zum Zeitpunkt der Infektion positive für CD34. daher die Multiparameter-Analyse für CD34 und GFP. Eine Population von CD34+ Zellen ist in der Morphologie und in der Stammzell-Kapazität sehr heterogen. Die Subpopulation von CD34+ und CD117+ Zellen ähnelt sehr primitiven hämatopoietische Zellen (Ikuta, K, Weissman, I L 1992 Proc. Natl Acad. Sci. USA. 89 :1502-1506; Simmons, P. J, et al.1994. Expl. Hematology.22 157-165). 23 fasst die Analysen der GFP Expression in Korrelation mit diesen spezifischen Stammzellmarkern zusammen. Während 54% der Zellen, die mit chimärem Vektor infiziert wurden, für GFP und CD34 positive waren, exprimierten nur 25% der mit Ad5GFP infizierten Zellen das Transgen und den CD34+ Marker (23A, unten). Basierend auf der Expression von GFP transduzierte das chimäre Virus 80% der c-kit positiven Zellen, während der Ad5-basierte Vektor nur 35% transduzierte (23A, unten). In einem zusätzlichen Experiment wurden CD34+ Zellen nach CD117 Expression vor der Infektion mit Ad5GFP oder mit Ad5GFP/F35 sortiert und 24 Stunden nach der Infektion wurden die Expression von GFP in dieser spezifischen Fraktion analysiert (23B). Diese Analyse zeigt, dass die chimären Vektoren 4 Mal mehr CD34+/CD117+ transduzierten als der Ad5GFP Vektor.

Diese Ergebnisse zeigen deutlich, dass der chimäre Vektor Ad5GFP/F35 beim Targeting und bei der Transduktion von CD34+ Zellen dem Ad5GFP Vektor überlegen war. Weiterhin legen die Daten nahe, dass das Spektrum von für Ad-Infektion permissiven CD34+ Zellen sich signifikant für den chimären Vektor von dem Ad5 Vektor unterschied.

Analyse viraler Genome innerhalb von CD34+ Zellen die mit Ad5 und mit dem chimären Vektor infiziert wurden:

Bisher wurde die Transduktionsrate von Cd34+ Zellen basierend auf der Expression von GFP nach Infektion mit Ad5GFP und Ad5GFP/F35 gemessen. Zieht man die außergewöhnliche Heterogenität von Cd34+ Zellen in morphologischen und funktionellen Parametern in Betracht, dann wird GFP nicht in alen Zelltypen exprimiert werden, die effizient markiert wurden. Gründe dafür sind, dass der CMV Promoter nicht in alen Zelltypen aktiv ist oder das die Regulation der Expression des Transgens sich zwischen bestimmten Untergruppen auf einem post-translationalen oder einem post-transkriptionellen Level unterscheiden könnte. Um dies zu testen, quantifizierten wird die Zahl von transduzierten (intrazellulären) Genomen innerhalb von GFP positiven und GFP-negativen Fraktionen von CD34+ Zellen, die mit Ad5GFP und Ad5GFP/F35 infiziert wurden. Dazu wurden 24 h nach Infektion Cd34+ Zellen auf GFP-positive und GFP-negative Fraktionen sortiert, die danach dazu verwendet wurden, genomische DNA zusammen mit transduzierter viraler DNA zu isolieren. Die Anzahl an viralen Genomen wurde durch quantitativen Southern Blot wie in 15 beschrieben bestimmt. Pro GFP-positiver CD34+ Zelle wurden etwa 270 Kopien des Ad5GFP/F35 viralen Genoms entdeckt. Interessanterweise fand man pro GFP-negativer CD34+ Zelle eine beträchtliche Zahl von 200 Kopien des Ad5GFP/F35 viralen Genoms (24A und 25). Dies zeigt, dass nicht ale infizierten Zellen GFP exprimierten und impliziert, dass die tatsächliche Transduktionsrate höher als 54% war (GFP-positive Zellen). Wir schlussfolgerten, das der CMV-Promoter nicht in alen transduzierten CD34+-Untergruppen aktiv war. Innerhalb von infizierten CD34+ (GFP-positiv oder- negativ) wurde durch Southern Blot mit einer Nachweisgrenze von 14 viralen Genomen pro Zelle wurde kein für Ad5GFP spezifisches Signal nachgewiesen. Daraus schließen wir, dass die Vektorkonzentration pro transduzierte Zelle wenigstens 20 fach höher war für Ad5GFP/F35 als für Ad5GFP.

Ad5GFP DNA konnte nur in DNA Proben aus infizierten CD34+Zellen durch Southern Blot nach vorheriger PCR-Amplifikation mit Vektor-spezifischen Primer (24B und 25) nachgewiesen werden. Dies zeigt, dass der replikationsdefiziente Vektor Ad5 anwesend ist, aber nur in einer sehr geringen Kopiezahl, die durch die Stabilität des intrazellulären Genoms beschränkt sein könnte. Mit dem PCR-Southern Nachweisverfahren wurde Ad5 Vektor-DNA in GFP-negativen Zellen nachgewiesen, was nahe legt, dass der CMV Promoter nicht die optimale Wahl für Transduktionsuntersuchungen war. Es ist bemerkenswert, dass Untersuchungen von Dritten auf virale Genome nach der Infektion von CD34+ Zellen mit Ad5 Vektoren nur vor der PCR-Amplifikation durchgeführt wurden (Mitani, K., et al.1994. Human Gene Therapy. 5:941-948 ; Neering, S. J., et al. 1996.. Blood. 88:1147-1155).

DISKUSSION

Der chimäre Ad5GFP/F35 Vektor hat zu Ad35 ähnliche Bindungs- und Internalisierungseigenschaften. Daher reichte der Austausch der Fiber aus, den Zelltropismus von Ad5 auf Ad35 umzuschalten. Die Ad5GFP/F35 Kapsidchimäre enthielt die kurzschaftige Ad35 Fiber eingebaut in ein Ad5 Kapsid, anstelle des natürlicherweise auftretenden Ad5 Fiber mit langem Schaft. Während der Infektion mit Ad5 ist Interaktion zwischen dem Pentonbase und den Integrinen nötig, um virale Internalisierung zu induzieren. Für diese Interaktion ist die Länge des Fiberschafts und die genaue räumliche Anordnung des Knob und der RGD Motive kritisch für die Strategie des Virus-Eintritts. Das natürliche räumliche Arrangement wird gestört, wenn heterologe Fibern mit kurzem Schaft in das Ad5 Kapsid inseriert sind. Interessanterweis erlaubt die Ad5/35 Kapsidchimäre die effiziente Infektion, was nahe legt, dass herausragende RGD Motive in der Ad5 Pentonbase die Interaktion mit dem primären Ad35 Rezeptor nicht beeinträchtigen. Bisher wurden die meisten chimären Vektoren durch Austausch von lediglich des Ad5 Knob generiert, während der lange Ad5 Fiberschaft beibehalten wurde (Chillon, M., et al. 1999. J Virology. 73: 2537-2540; Krasnykh, V. N., et al. 1996.J. Virology. 70: 6839-6846; Stevenson, S. C., et al. 1995. J. Virology. 69: 2850-2857; Stevenson, S. C., et al. 1997.J. Virology. 71: 4782-4790). Die Ausnahme war ein Ad5/7 chimäres Virus (Gall, J., et al. 1996. J. Virology. 70: 2116-2123), in dem die gesamte Ad5 Fiber gegen die Ad7 Fiber mit kurzem Schaft ausgetauscht war. Ähnlich zu dem parentalen Ad5 erforderte die Ad5/7 Chimäre immer noch die &agr;v-Integrine für die Infektion.

Diese Ad5GFP/F35 Chimäre ist die erste Demonstration, dass trotz der Anwesenheit von RGD Motiven innerhalb des Ad5 Pentons das chimäre Virus Zelleintrittspathways benützt, die in erster Linie durch die Rezeptorspezifität der heterologen Fiber mit kurzem Schaft bestimmt werden. Dies schließt nicht aus, dass die Interaktion mit einem zweiten Rezeptor die Bindungsaffinität erhöhen kann. Letzteres wird gestützt durch die Beobachtung, dass Ad35 und Ad5GFP/F35 sich leicht in ihrer Fähigkeit unterschieden, mit Ad3 oder Ad5 um die Bindung zu konkurrieren. Es ist möglich, dass die Ad5/35 Anheftung zusätzlich zur hohen Affinität für die Bindung an die Fiber eine Interaktion zwischen den Ad5 Kapsidproteinen (z.B. RGD Motive) und sekundären Rezeptoren erfordert, die mit denen überlappt, die von Ad3 und Ad5 benutzt werden.

Diese Daten zeigen, das die Infektion mit auf Ad5 basierenden Vektoren auf eine bestimmte Untergruppe von CD34+ Zellen beschränkt ist. Der Prozentsatz an GFP exprimierenden Zellen nach Ad5GFP Infektion von CD34+ Zellen erreichte bei MOIs höher als 100 ein Plateau; ein Hinweis darauf, dass nur eine limitierte Fraktion von CD34+ Zellen permissiv für Ad5 war. Die starke Replikation von Wildtyp Ad5 in infizierten Cd34+ Zellen kann auch das Ergebnis einer präferentiellen Transduktion einer spezifischen Subpopulation von CD34+ Zellen sein, die zu einer Expression der frühen viralen Gene in einem ausreichenden Maß führt, um die virale Replikation zu initiieren. Die Anwesenheit einer spezifischen Subpopulation von CD34+ Zellen, die permissiv für die Infektion mit Ad5 Vektor ist, wurde von anderen vorgeschlagen (Byk, T., et al. 1998. Human Gene Therapy. 9:2493-2502; Neering, S.J., et al. 1996. Blood. 88:1147-1155). In dem vorliegenden Bericht charakterisierten wir diese Subpopulation weiter und zeigten, das Ad5-basierende Vektoren vorzugsweise &agr;v-Integrin positive CD34+ Zellen infizierten. Man nimmt an, dass Integrine (einschließlich &agr;v) für das „Homing" und „Trafficking" von transplantierten hämatopoietischen wichtig sind, man weiß jedoch nur wenig über die Korrelation zwischen Expression von &agr;v-Integrin und dem Differenzierungszustand von hämatopoietischen Zellen (Papayannopoulou, T., Craddock, C. 1997. Acta Haematol. 97:97-104; Roy, V., Verfaillie, C. M. 1999. Exp. Hematol. 27: 302-312). Es gab keine klare Korrelation zwischen der Expression von CAR und GFP, was nahe legt, dass Ad5GFP auch in der Lage sein kann, andere Membranproteine als primären Rezeptor zu verwenden. Alternativ könnte die bei einer MOI von 200-400 beobachtete Transduktion mit Ad5GFP auch das Ergebnis einer direkten Interaktion zwischen dem Virus und &agr;v-Integrinen sein, die die Internalisierung auslösen, was in Abwesenheit von CAR der bevorzugte Pathway sein könnte (Legrand, V., et al. 1999. J. Virology. 73: 907-919). Wichtigerweise war die Infektion mit dem chimären Ad5GFP/F35 Vektor nicht auf die CD34+ Subpopulation beschränkt.

Unter den CD34+ Zellen ähnelt die Subpopulation von CD34+ und CD117* Zellen sehr primitiven hämatopoietischen Zellen (Ikuta, K., Weissman, I. L. 1992 Proc. Natl. Acad. Sci. USA. 89:1502-1506; Simmons. P. J., et al. 1994. Expl. Hematology. 22: 157-165). Der Rezeptor für den Stammzellfaktor, CD117 (c-kit) gehört zur Familie der Tyrosinkinasen. Es wurde zuvor gezeigt, dass c-kit+, CD34+ Nabelschnurblutzellen einen hohen Anteil (16%) von hämatopoietischen Vorläufern enthalten (Neu, S., et al. 1996. Leukemia Research. 20: 960-971). Früh in der Ontogenie haben 34+/117+ Zellen eine Langzeit-Repopulationsaktivität (Sanchez, M. J., et al. 1996. Immunity. 5:513-525). Von durchschnittlich 50–60 % CD34+ Zellen wird berichtet, dass sie CD117 positiv sind (Ikuta, K.. Weissman, I. L. 1992 Proc.Natl. Acad. Sci. USA. 89: 1502 1506; Neu, S., et al. 1996. Leukemia Research. 20: 960-971; Simmons, P.J., et al. 1994. Expl. Hematology. 22: 157-165). In unseren Studien exprimierte der Vektor GFP in 54 % CD34+ Zellen und in 80% der CD34+/c-Kit+ Zellen. Die tatsächliche Transduktionsrate mit Virus könnte höher sein, da man transduzierte Ad5GFP/F35 Vektor DNA auch in GFP-negativen Fraktionen von infizierten Zellen gefunden hat. Dies zeigt, das der zur GFP Expression in unseren Vektoren verwendete CMV-Promoter nicht in alen transduzierten Zellen aktiv war. Wir wählten den CMV Promoter für die Expression des Transgens basierend auf veröffentlichten Daten, die zeigten, dass PGK und CMV Promotoren eine effiziente Expression von Transgenen in CD34+ Zellen ermöglichen, während der HTLV-1 und der RSV Promoter fast inaktiv waren (Byk, T., et al. 1998. Human Gene Therapy. 9: 2493-2502; Case, S. S., et al. 1999. Proc. Natl. Acad. Sci. USA. 96: 2988-2993). Andererseits zeigten Untersuchungen von Watanabe et al. (Watanabe, T., et al. 1996. Blood. 87: 5032-5039), dass der retrovirale MLV Promoter ein besserer Kandidat für Transduktionsstudien in hämatopoietischen Zellen gewesen wäre. (Bregni, M., et al. 1998. Gene Therapy. 5: 465-472).

Nachdem wir gezeigt haben, dass der Ad5GFP/F35 Vektor effizient Zellen transduziert, die Stammzell-spezifische Marker tragen, wäre der nächste logische Schritt die Durchführung von Kolonieassays mit prä-gesorteten GFP positiven/negativen Zellen. Dieser Assays wird jedoch durch die Tatsache erschwert, dass die erste Generation von Adenovirus-Vektoren cytotoxisch ist und die Bildung und das Wachstum von Vorläuferkolonien in MC-Kulturen beeinträchtigt (Mitani, K., et al. 1994. Human Gene Therapy. 5:941-948; Watanabe, T., et al. 1996.Blood. 87: 5032-5039). Diese Nebenwirkung wird durch die Expression von Ad Protein in transduzierten Zellen ausgelöst (Lieber, A.,C.-Y. et al. 1996. Journal of Virology. 70:8944-8960; Schiedner, G., et al. 1998. Nature Genetics. 18:180-183; Yang, Y., et al. 1994. Proc. Natl. Acad. Sci. USA. 91: 4407-4411). Einige dieser Proteine (z.B. E4-orf4, pTP oder E3.11.6k) haben eine proapoptotische Aktivität (Langer, S. J., Schaak, J. 1996.Virology. 221: 172-179; Lieber, A., et al. 1998. J. Virology. 72: 9267-9277; Shtrichman, R., Kleinberger, T. 1998. J.Virology. 72:297-2983 ; Tollefson, A. E., A et al.1996 J Virology. 70: 2296-2306). Dies würde natürlich den Ausgang von Transduktionsuntersuchungen mit Ad5GFP/F35 beeinträchtigen, der den effizienten Transfer von viralen Genomen in CD34+ Zellen erlaubt, implizierend, das eine signifikante Expression von viralen Proteinen stattfindet. Weiterhin zeigen neuere Daten, dass Kurzzeit-Kolonieassays in erster Linie reife Vorläufer messen und keinen starken Test auf die Transduktion von möglichen Stammzellen darstellen.

Eine definitive Demonstration, dass au Ad5GFP/F35 basierende Vektoren HSC transduzieren können erfordert Kolonieassays oder vorzugsweise, Repopulierungsassays in SCID-NOD Mäusen. Wir können diese Untersuchungen mit Gutless Vektoren (Steinwaerder, D. S., et al. 1999. J Virol 73: 9303-13) und integrierenden &Dgr;AdA.AAV Vektoren durchführen, die frei von alen viralen Genen sind. (Lieber, A., et al..1999. J. Virol 73:9314-24), die erzeugt wurden basierend auf Ad5GFP/F35 chimären Kapsiden. Alternativ können gutless, neu getargetete Vektoren dazu verwendet werden, einen retroviralen Rezeptor in CD34+ Zellen transient zu exprimieren, um deren Empfänglichkeit für die Infektion mit retroviralen Vektoren zu erhöhen basierend auf einem von uns früher publizierten Ansatz (Lieber, A., et al. 1995. Human Gene Therapy. 6: 5–11).

Unsere Erkenntnis, dass Ad5GFP/F35 hämatopoietische Zellen mit möglicher Stammzellkapazität effizient transduzieren kann, stellt einen wichtigen Schritt zum stabilen Gentransfer in HCSs dar und für die Gentherapie von Blutkrankheiten. Weiterhin tragen die virologischen Aspekte dieser Erfindung zu einem besseren Verständnis der adenoviralen Zell-Interaktionen bei.

I. Retargeting von auf Ad5 basierenden Vektoren mit modifizierten Fibern, die spezifische Ligandenpeptide für HSC und andere Zelltypen tragen

Eine andere Alternative zur Herstellung von Ad5-Kapsid-basierenden Vektoren, die für die Gentherapie von HSC geeignet sind, besteht in dem Einbau der kodierenden Sequent von HSC-spezifischen Peptiden in die H1 Loop-Region des Ad5 Fibergens. Die Modifikation des H1-Loop-Bereichs wurde durch Krasnykh et al. Mit einem 7 Aminosäuren langen FLAG Peptid (DYDDDDK) erfolgreich gezeigt. Unter Verwendung von Phagen-Display Peptidbibliotheken zeigte Renata Pasqualini (Pascqualini, R. et al., 1996, Nature, 380: 364-66) (La Jolla Cancer Research Center) kürzlich auf dem erstem Meeting der American Society for Gene Therapie die Identifikation kleiner Peptidliganden, die für Knochenmarkszellen spezifisch sind. Die entsprechenden Sequenzen, die für diese Peptide kodieren, können zugegeben werden, um die H1-Loop Sequenz durch ortsgerichtete Mutagenese zu modifizieren. Optimalerweise sollten diese Liganden die effiziente Internalisierung von adenoviralen Partikeln ermöglichen, basierend auf einem von CAR und Integrin unabhängigen Pathway. Modifizierte adenovirale Vektoren, die die AAVBG Kassette enthalten, können erzeugt werden und wie vorstehend beschrieben auf HSC-Tropismus untersucht werden.

Adenovirus-Peptid-Display:

Um Adenoviren auf einen interessierenden Zelltyp auszurichten, wird eine Strategie bereitgestellt, die die Herstellung einer Bibliothek umfasst von Adenovirus-Displayzufälligen Peptiden in deren Fiber-Knobs als Liganden und das Screening dieser Bibliothek auf Adenovirus-Varianten mit Tropfismus für einen bestimmten Zelltyp in vitro und möglicherweise in vivo.

Die Entwicklung der Adenovirus-peptid Display-technik basiert auf den folgenden Überlegungen: (i) Obwohl die Tertiärstruktur des Ad5 Fiber-Knob bekannt ist, bleibt es unklar, welche Domänen an der Rezeptorbindung beteiligt sind. Es gibt Daten, die nahe legen, dass die Rezeptor-bindenden Domänen teilweise mit Hämagglutinationsdomänen, die für eine Anzahl von Serotypen gut charakterisiert sind, überlappen. Daher können drei intramolekulare Loop-Bereiche, die mögliche Rezeptorbindestellen darstellen, durch zufällige Peptidbibliotheken ersetz werden. Acht Aminosäurereste im Zentrum der FG oder der GH Loops können durch oktamere zufällige Peptide ausgetauscht werden (26 und 27). Diese Austausche ersetzen den CAR Tropismus und ermöglichen die Infektion von unzugänglichen Zelltypen. (ii) Zur Synthese von Oligonukleotide, die für die Peptidbibliothek kodieren wird eine neue Technik zum Zusammenbau der präsynthetisierten Trinukleotide, die die Kodons für ale 20 Aminosäuren darstellen, verwendet. Dies vermeidet Terminationskodons und gewährleistet in humanen Zellen eine optimale Kodonverwendung und Translation. Die Synthese einer vollständig randomisierten Bibliothek ist mit alen 20 Aminosäuren möglich, die mit der gleichen Wahrscheinlichkeit eingebaut werden und mit einer partiell randomisisierten Bibliothek mit nur drei (durchschnittlich) zufälligen Aminosäure-Austauschen pro Oktamer in zufälligen Positionen mit einer zufälligen Aminosäure zur Beibehaltung bestimmter kritischer Eigenschaften der tertiären Knob-Struktur, während Variabilität eingebracht wird. Das letzte Modell beruht auf der Verteilung von Aminosäuren, die in der Hypervariablen CDR 1 oder 2 Region von Immunglobulinen anwesend ist. (iii) Zur Aufrechterhaltung einer repräsentativen Größe der Bibliothek von 1010 unterschiedlichen Oktameren pro modifiziertem Loop wird eine neue Klonierungsstrategie verwendet, um die Insertion der Bibliothek in das Wildtyp-Genom von Ad5 zu ermöglichen, ohne zusätzliche Aminosäuren an der Austauschstelle einzubauen und ohne Transformation in Bakterien. Diese Strategie basierten auf einer „seamless" Klonierungsstrategie, die von Stratagene erhältlich ist. (iv) Um eine Bibliothek von Viren herzustellen wird virale DNA, die die modifizierten Fibersequenzen enthält, in 293 Zellen ohne Verringerung der Größe der Bibliothek transfiziert. Dieser kritische Schritt wird durch konjugieren der viralen Bibliotheks-DNA an einen Träger-, auf Ad5 basierenden Adenovirus über Polylysin erreicht, um eine 100% Transfektionseffizienz zu gewährleisten. Diese Technik ermöglicht die Kopplung von ~1 &mgr;g Plasmid-DNA (oder von ~1 × 106 adenoviralen Genome) an 1010 virale Partikel, die dazu verwendet werden können, 293/cre Zellen mit einer MOI von 10–100 zu infizieren. Im Träger-adenoviralen Genom ist das Verpackungssignal von lox-Stellen flankiert, was die Verpackung von Träger-viraler DNA nach Infektion von 293 Zellen verhindert, die cre Rekombinase exprimieren (293/cre). Dieses Helfer-Virussystem wird dazu verwendet, sogenannte gutless Adenoviren zu erzeugen. Daher stellen die Virusnachkommen Bibliotheksgenome dar, die in Kapside verpackt sind, die vorzugsweise Ad5 Fibern enthalten. Dies ist wichtig für den nächsten Infektionsschritt in 293 Zellen bei einer MOI von 1, um eine homogene Fiber-Population auf dem Kapsid zu gewährleisten, wobei die Fibern vom verpackten Genom kodiert werden.

J. Produktion von Adenovirus-Vektoren mit erhöhtem Tropismus für Hepatozyten

Ein Beispiel für einen G-H-Loop Austausch zur Ausrichtung von Ad5 auf Hepatozyten war erfolgreich. Vorläufige Tests zeigen dass zwei evolutionär konservierte Bereiche innerhalb des Malaria Circumsporozoiten Oberflächenprotein (CS), die als RI und RII+ bezeichnet werden, die spezifische Interaktion mit Hepatozyten, aber nicht mit anderen Organen vermitteln (einschließlich Milz, Lunge, Herz und Gehirn), noch mit Kupferzellen (Cerami. C. et al.,1992, Cell, 70:1021-33; Shakibaei, M. and U. Frevert, 1996. J. Exp. Med., 184: 1699-711). Diese Bereiche sind in verschiedenen Spezies einschließlich Plasmodium berghei, P. cynomogli und P. falsiparum konserviert, die Hepatozyten von der Maus, vom Affen und vom Menschen infizieren (Cerami, C. et al., 1992, Cell, 70:1021-33 ; Chatterjee, S. et al., 1995,Infect Immun., 63: 4375-81). Von RI (KLKQPG) abgeleitete Peptide oder von RII (EWSPCSVTCGNGIQVRIK) blockierten die Bindung von CS an Hepatozyten und die Infektion mit Sporoziten in vivo (Cerami, C. et al., 1992, Cell, 70: 10233; Chatteree, S. et al., 1995,Infect Immun, 63: 4375-81). RI und RII+ Peptide wurden getrennt in den Ad5-fiber-Knob (H-I und G-H Schleife) inseriert, der eine Mutation enthielt, der die Bindung an CAR und &agr;v-Integrin verhinderte (Kirby, L. et al., 2000, J. Virol., 74: 2804 13; Wickham, T. J. et al.,1995, Gene Ther., 2: 750-6). Basierend auf vorläufigen Daten wurde eine Fiber mit kurzem Schaft verwendet, so dass die Eintrittsstrategie des Virus hauptsächlich auf der Interaktion mit dem primären Hepatozyten-spezifischen Rezeptor beruht. Die Hepatiozyten-spezifischen Liganden werden durch kurze Glycin-Bereiche flankiert, um Flexibilität bereitzustellen und sind in einen Loop aus zwei Cysteinen eingebettet. Dies ist eine der klassischen Strategien, um Liganden in ein Protein-Gerüst einzubauen (Doi, N. and H. Yanaga 1998, Cell. Mol. Life Sci 54:394-404; Koivunen, E. et al., 1999, Nat. Biotechnol, 17: 768-74) und um ihre Präsentation an der Zelloberfläche zu garantieren. Die Bioverteilung der besten Varianten wird in vivo on C56B1/6 Mäusen getestet, basierend auf Southern Blots oder PCR für Vektor-DNA in verschiedenen Organen. Man weiß, dass dieser Mausstamm für die Infektion mit P. berghei empfänglich ist (Chatterjee, S. et al., 1995, Infect Immun 63:4375-81).

K. Produktion von Adenovirus-Vektoren mit erhöhtem Tropismus für Tumorzellen

Eine ähnliche Strategie besteht darin, zwei Peptide, die nach der Selektion auf Tumortropismus erhalten wurden, durch Display von zufälligen Peptiden auf filamentösen Phagen zu inserieren. Das erste doppelte zyklische Peptid (RGD-4) erwies sich als spezifisch an Integrine bindend, die auf der Vaskulatur von Tumoren anwesend sind (Ellerby H.M et al., 1999, Nat. Med 5:1032-8). Das zweite Peptid ist auf spezifische Matrix-Metaloproteinasen gerichtet, die mit metastasierenden Tumorzellen asoziiert sind, wie für die Brustkrebszelllinie MDA-MB-435 gezeigt wurde (Koivunen, E. et al., 1999, Nat. Biotechnol. 17:768-74). Tropismus-modifizierte Vektoren warden in Tiermodellen mit Lebermetastasen getestet, die von MDA-MB-435 Zellen abgeleitet sind (28)

L. Entwicklung einer Peptid-Display-Technik basierend auf Adenoviren

Es wird eine synthetische Peptidbibliothek beschrieben, die es ermöglicht, dass Adenovirus-Vektoren zufällige Peptide in dem G-H-Loop der Fiber-Knob-Domäne exprimieren. Die Technik einer Phagen-Display-Bibliothek wird optimiert, um eine Bibliothek von Adenoviren zu erzeugen, die zufällige Peptide in ihrem Fiber-Knob präsentieren. Diese Bibliothek wird dann gescreent auf den Tropismus für einen bestimmten Zelltyp in vivo und in vitro. Die Oligonukleotide, die für die Peptidbibliothek kodieren, verwenden eine neue Technik zum Zusammenbau präsynthetisierter Trinukleotide, die die Kodons für ale 20 Aminosäuren darstellen. Dies wird die Terminationskodons beenden und eine optimale Kodonverwendung und Translation in humanen Zellen gewährleisten. Zur Beibehaltung einer repäsentativen größe der Bibliothel wird eine neue „seamless" Klonierungsstrategie verwendet, die es ermöglicht, das die Bibliothek in Wildtyp-Ad5-genom inseriert werden kann, ohne zusätzliche Aminosäuren an der Insertionsstelle einzubauen und ohne Transformation in Bakterien, Die Transfektion in 293 Zellen wird durch Konjugation der viralen Bibliotheks-DNA an einen auf Ad5 basierenden Trägervirus über Polylysin durchgeführt, um eine 100% Transfektionseffizienz zu gewährleisten. Das Verpackungssignal des viralen Träger-genoms ist von Lox-Stellen flankiert, um die Verpackung von viraler Träger-DNA nach Infektion von 293 Zellen, die Cre Rekombinase (293/cre) exprimieren, zu verhindern. Die Bibliothek wird mit E1-positiven Viren erzeugt, denen CAR und ein Tropismus für Integrine fehlen. Nur Varianten, die den interessierenden Zelltyp erfolgreich infiziert haben, werden replizieren, was zu de novo erzeugtem Virus führt. Die Sequenz des Peptidliganden, der den bestimmten Tropismus verliehen hat, wird dann in dem de novo erzeugten Virus analysiert werden.

BEISPIEL III KOMBINATION AUS NEUEM ADENOVIRALEN VEKTOR UND MODIFIZIERTEM FASERPROTEIN

Dieses beispiel beschreibt die folgenden Studien, die die Technologie des integrierenden Virus, der frei von alen adenoviralen Genen ist, mit dem modifizierten Fiberprotein, das den Vektor auf ruhende HSCs umleitet.

A. Transduktionsuntersuchungen mit re-targeted Vektoren in HSC:

Um ruhende HSC zu transduzieren und um in chromosomale DNA zu integrieren werden retargeted &Dgr;Ad.AAVfx Vektoren auf Expression von Reportergen und auf die Vektorintegration untersucht, während gleichzeitig deren klonbildende Fähigkeit bewertet wird. Die modifizierten &Dgr;Ad.AAVfx hybriden Vektoren enthalten Genome, die frei von alen adenoviralen Genen sind (ein „gutless" adenoviraler Vektor), verpackt in Ad5 Kapside mit modifizierten Fibern. Rep kann in diese &Dgr;Ad.AAVfx Vektoren eingebaut werden, um eine ortsspezifische Integration in AAVS1 zu ermöglichen.

Transduktionsuntersuchungen:

Aufgereinigte humane Cd34+ Zellen in IMDM/FCS+IL-3 und SCF werden mit unterschiedlichen Dosen von &Dgr;Ad.AAVfx-BG (1–107 genome pro Zelle) infiziert. CD34+ Zellen, die mit &Dgr;Ad.AAVfx-&bgr;Gal infiziert wurden, werden für 2 Tage in Suspension kultiviert und &bgr;-Gal+ Zellen werdend urch FACS mit FDG als Substrat sortiert. Dies bestimmt die Infektionseffizienz. &bgr;-Gal exprimierende Zelen werden dann einem klonbildenden Assays in halbfesten Kulturen unterzogen (in zwei Schälchen pro MOI) in Anwesenheit von mehreren Cytokinen (IL-3, SCF, EPO, G-CSF, GM-CSF, IL-7, Tpo). Ein erster Satz von halbfesten Kulturen kann nach 7 Tagen ausgewertet werden, ein anderer nach 14 Tagen. Kolonien, die sich in halbfester Kultur gebildet haben, können durch Lichtmikroskopie und nachfolgende Färbung mit X-Gal charakterisiert werden. Die meisten der Vektorgenome bleiben episomal und können durch aufeinanderfolgende Zellteilungen verloren gehen. Somit färbne die meisten der größeren Kolonien (analysiert am Tag 14 p.i.) nicht homogen für &bgr;-Gal, obwohl die meisten Zellen am Tag 2 oder 7 X-Gal positiv sein können. Eine repräsentative Anzahl von X-Gal positiven und negativen Kolonien kann gepickt werden und auf episomale und integrierte Vektor-DNA analysiert werden. Der Ausgang hängt von der für die Infektion verwendeten MOI und vom Integrationsstatus des Vektors ab. Diese Untersuchungen bestimmen, ob hybride Vektoren primitive Vorläufer infizieren können.

Ausführliche Charakterisierung der Integration des hybriden Vektors:

CD34+ Zellen können mit &Dgr;Ad.AAVfx-Snori (MOI 1–107) infiziert und einer G418-Selektion in Methylcellulose (MC) Kulturen in Anwesenheit von Wachstumsfaktoren (I1-3) und SCF unterzogen werden. Die entstehenden Kolonien sind meist ein Gemisch aus myeloiden Zellen. Die Anzahl und die Morphologie der G418-resistenten Kolonien kann 2 Wochen nach der Selektion bestimmt werden. Diese Strategie kann unvorteilhaft sein, wenn sich die geeignete Stammzelle nicht teilt und G418-resistents Kolonien unter den verwendeten Bedingungen bildet. Weiterhin kann es schwer sein, G418-Selektion mit einer heterogenen Population von Zellen durchzuführen, die sich in ihrer Sensitivität für G418 unterscheiden. Daher kann ein weiterer Satz von &Dgr;Ad.AAVSnori infizierten CD34+-Zellen in Methylcellulse (+IL-3, SCF) ohne G418 Selektion kultiviert werden, Nach 2–3 Wochen können Einzelkolonien von beiden MC Kulturen (mit und ohne Selektion) gepickt, morphologisch charakterisiert und auf Vektorintegration nach einem modifizierten Protokoll analysiert werden, das für Integrationsuntersuchungen in einer kleinen Anzahl von Zellen entwickelt wurde (siehe 8). Diese Strategie ermöglicht eine Bewertung, ob Hybride Vektoren in das Genom von CD34+ Zellen integrieren, die in Anwesenheit von Wachstumsfaktoren kultiviert wurden. Diese Untersuchung gibt uns eine Idee von den möglichen positionellen Effekten, die die neo oder &bgr;-Gal Expression aus integrierten Vektorkopien beeinträchtigen und der flankierenden chromosomalen Bereiche.

Ein alternatives Verfahren zur Bestätigung der Vektorintegration:

FISH Analyse kann in einzelnen Zellen aus MC-Kolonien durchgeführt werden. CD34+ Zellen werden in MC in Anwesenheit von Wachstumsfaktoren kultiviert, um die Zellteilung zu induzieren und werden nachfolgend mit Colchicin behandelt. Metaphase-Chromosomen-Spreads werden durch eine Biotin-markierte Sonde analysiert, die spezifisch für das &bgr;-Gal oder für das Snori Gen ist und mit einer mit Digoxigenin markierten UTP-markierten Sonde für das humane X-chromosom als Interne Kontrolle (bereitgestellt von Christine Disteche, University of Washington). Spezifische Hybridisierung kann sichtbar gemacht werden mit entsprechenden anti-Biotin oder anti-DIG Antikörpern, die mit verschiedenen Fluorochromen markiert sind (z.B. FITC oder Texas Rot). Hybride Vektor-DNA kann als Koncatemere integrieren, was den Nachweis durch FISH erleichtern würde. Diese technik ermöglicht die chromosomale Lokalisation der Integration der hybriden Vektoren.

Testtransduktion in ruhende Subpopulationen von Knochenmark:

Bisher beschriebene hybride Vektoren können getestet werden, um zu sehen, ob ruhenden CD34+ Zellen stabil transduziert werden können. Um eine signifikante Zellproliferation zu vermeiden, werden Cd34+ Zellen in serumfreien IMDM Medium kultiviert, das zusätzlich Thrombopoietin enthält. Tpo alein kann das Überleben von Stammzellen unterstützen, ohne gleichzeitig deren aktive Zellproliferation zu aktivieren (Matsunaga, T. et al., 1998, Blood, 92: 452-61; Papayannopoulou, T. et al., 1996,Experimental Hematology, 24: 660-69). Zur Analyse des Proliferationsstatus von CD34+ Zellen zum Zeitpunkt der Infektion mit dem &Dgr;Ad.AAVfxBG wird BrdU 2 Stunden vor der Infektion zum Kulturmedium gegeben. Ein Satz von Zellen wird als Suspensionskultur in IDAM, das nur Tpo enthält, für zwei tage gehalten. Ein anderer Satz von Zellen wird in IDAM+Tpo, ergänzt mit multiplen Cytokinen inkubiert. 48 Stunden nach der Infektion können CD34+ Zellen durch FACS auf &bgr;-Gal Expression mit FDG gesortet werden. FDG positive Zellen können auf zelluläre DNA-Replikation basierend auf dem Einbau von BrdU und von spezifischen CD34+ Markern analysiert werden. Um dies zu tun können Cytospins von FDG+ Zellen einer Immunfluoreszenz mit BrdU-spezifschen Antiköepre und mit Antikörpern gegen spezifsiche Zelloberflächenmarker unterzogen werden (zb CD38, CD41). Alternativ können aufeinanderfolgende Paraffinschnitte der gleichen Zelle auf (a) Expression des Transgens durch X-GaI-Färbung, (b) DNA-Synthese basierend auf Einbau von BrdU und (c) spezifische Oberflächenmarker analysiert werden. Dies ermöglicht die Bestätigung das die Kulturbedingungen mit Tpo alein die signifikante Replikation genomischer DNA und nachfolgende Zellproliferation verhindern als auch die Bestimmung, ob ruhende CD34+ Zellen infiziert werden können, basierend auf &bgr;-Gal Expression in Zellen, in denen Markierung mit BrdU fehlt.

Test-Integration von hybriden Vektoren in ruhende CD34+ Zellen:

Zwei Sätze von CD34+ Zellen werden infiziert. Ein erster Sazu von &Dgr;Ad.AAVfxSNori infizierten Zellen wird für 5–7 Tage in Anwesenheit von Cytokinen kultiviert; der andere Satz ohne Cytokine. Um die Lebensfähigkeit der CD34+ Zellen zu erhalten ohne Cytokine während dieses Zeitraums zu erhalten, werden die Zellen in Anwesenheit von Tpo kultiviert oder mit einer stromalen Zelllinie unterlegt (AFT024) (Moore, K. et al., 1997, Blood 89:4337-47), die HSC für 4–7 Wochen lebensfähig erhalten kann. Nach diesem spezifischen Zeitraum werden beide Sätze klonogenen Tests unterzogen (in Anwesenheit mehrerer Cytokine), entweder in Kombination mit G418 Selektion oder ohne. Einzelkolonien werden morphologisch untersucht und einer Analyse der genomischen DNA (8) unterzogen, um den Integrationsstatus des Vektors zu bestimmen. Der endgültige Beweis für die Transduktion von Stammzellen ist das in vivo Überleben/ der Expansionstest. Dazu werden die Cd34+ Zellen, die &bgr;-Gal exprimieren, für Transplantationsexperimente verwendet. Wenn die Anzahl von FDG+-Zellen nicht ausreicht, dann können &Dgr;Ad.AAVfxBG infizierte Zellen als auch &Dgr;Ad.AAVfx-Snori infizierte Zellen direkt ohne Selektion verwendet werden. Transplantation kann durch Schwanzvenen-Injektion in subletal bestrahlte SCID NOD Mäuse erfolgen (Dao, M. A., et al., 1998, Blood, 4,1243-1255; Matsunaga, T. et al., 1998,Blood, 92: 452-61). Zu verschiedenen Zeitpunkten auch der Transplantation (4–8 Wochen) können die Mäuse getötet werden, um Knochenmarkszellen zu erhalten, die dann in suspension kultiviert werden können, bis verschiedene Assays auf X-Gal oder für ander Zellmarker wie vorher beschrieben durchgeführt werden. Diese Zellen können auch einem sekundären Kolonieassay in MC oder einer sekundären Transplantation in SCID NOD Mäuse unterzogen werden. Weiterhin können von diesen Zellen abgeleitete MC-Kolonien auf die Anwesenheit von integrierter DNA durch das in 8 veranschaulichet Verfahren untersucht werden. Die Expressions- und Integrationsdaten ermöglichen ZusammenSchlußfolgerungen über die Repopulationseffizienz und über mögliche positionelle Effekte.

B. Optimierung von &Dgr;Ad.AAVfx-Vektoren für y r-Globin Expression in hämatopoietischen Stammzellen:

Ein spezifisches Beispiel der Erfindung ist (a) die Konstruktion eines retargeted Hybrid-Vektors mit dem y-Globin als Transgen unter der Kontrolle des erythroiden zell-spezifischen Promoter, (b) die Analyse des Spiegels und der Kinetik der Expression von y-Globin nach Transduktion mit hybriden Vektoren in in vivo und in vitro Assays, (c) wenn erforderlich, der Schutz der Genexpression vor positionellen Effekten durch Verwendung von y-Globin LCR oder Insulatoren, die in hybriden Vektoren eingebaut werden und (d) die Untersuchung, ob y-Globin Introns oder heterologe Introns die Expression von y-Globin steigern können Ein weiteres zentrales Thema der Erfindung besteht darin, zu zeigen, das hybride Vektoren größere Transgene als Retroviren und rAAV Vektoren aufnehmen können. Die Grenze für die Insertgröße dieser Vektoren beträgt 5 kb. In die beschriebenen Hybriden Vektoren können bis zu 8 kb aufgenommen werden. Die maximale Insertgröße kann 14 kn sein, wenn hybride Vektoren auf Basis von E2a und/oder E4 deletierten rAD Vektoren generiert werden in entsprechenden Verpackungslinien. Die maximale Insertgröße in hybriden Vektoren wird durch das Verpackungslimit der Viren der ersten generation (&Dgr;Ad.AAV) (>36kb) diktiert, die notwendige Intermediate für die Produktion des hybriden Virus in großem Maßstab sind. Man nimmt an, das die Stabilität und der Titer von &Dgr;Ad.AAV Vektoren mit einer 8kb großen Globinkasserre vergleichbar zu einem Vektor ist, der die 2,5–3.5 kb große Kassette enthält, die in Ad.AAVBG, Ad.AAV1 und Ad.AAVSNori verwendet wird. Die folgenden Beispiele gehen darauf ein.

Erzeugung von dAd.AAVfx mit großen Globin-Expressionskassetten

Zur Linderung der Sichelzellanämie muss de Expressionslevel des transferierten y-Globin Gens mindestens 50% des endogenen &bgr;-gens betragen. Dieser Level an Transgenexpression kann nur erreicht werden durch optimale Expressionskassetn, einschließlich verlängerten LCRs und Intron-haltigen Gamma-genen (Forrester, W. C., et al., 1986, Proc.Natl. Acad. Sci. USA 83, 1359-1363; Fraser, P., et al., 1998, Curr. Opinion in Cell Bio., 10, 361-365; Grosveld, F., et a.1, 1998, Seminars in Hematology, 35, 105-111; Martin, D. et al., 1996, Current Opinion in Genetics and Development, 6: 488-95). Die meisten der bestehenden y-Globinkassetten sind für retroviralen und rAAV-Vektoren bestimmt, somit für weniger als 5 kb und frei von internen Spleissstellen oder Polyadenylierungssignalen. Mit den hier beschriebenen Vektoren ist es möglich, diese Größenbeschränkung zu umgehen. Dies ermöglicht die Verbesserung der y-Globin Expression in Knochenmarkszellen in Form eines geeigneten Expressionslevels und einer Langzeit-Persistenz. Dazu werden y-Globin-Konstrukte die von Li et al. (Emery, D. W., et al. 1999 Hum Gene Ther 10:877-88 ; Li, Q., et al. 1999. Blood 93: 2208-16) or durch Ellis et al (Ellis, J., et al., 1996, EMBO J., 15,562-568; Ellis, J., et al., 1997, Nucleic Acids Res. 25,1296-1302) entwickelt wurden, gewählt.

  • (i) Die erste Kassette enthält eine y-Globin-Expressionseinheit, die in retroviralen
  • Vektoren verwendet wird. Dies ermöglicht den direkten Vergleich zwischen den System. Dieses Konstrukt enthät den beta Promoter von –127 des beta-Initiationskodon, der im Leserahmen mit dem gamma-kodierenden Bereich gekoppelt ist. Der beta Promoter ist mit dem 300 bp großen von HS40 abgeleiteten aus dem humanen alpha Globin-Locus kombiniert, der als starker Enhancer der Expression von Globin wirkt. Das Globingen ist die 1.1 kb große Version mit Intron 1 und partiell deletiert aus Intron 2. Eine zweite Kassette wird erzeugt, die den HS40 beta Promoter und das Gamma-Globingen mit dem gesamten 3.3 kb großen Globingen enthält.
  • (ii) Das zweite Konstrukt enthält den 6.5 kb LCR, der eine dominante Aktivität zur Chromatin-Öffnung verleiht und ein geeignetes Maß an Expression von gamma Globin in transgenen Mäusen. LCR ist an die kurze 1.1 kb Version des gamma Globin-Gens oder an das vollständige 3.3 hb Gamma gen gekoppelt.
  • (iii) Eine zusätzliche Globin-Expressionskassette kann erzeugt werden, die Insulatoren, MARs oder SARs einschließt, als auch andere Elemente, die die Expression des Transgens aus integrierten vektoren oder in transgenen Tieren fördern, wie z.B. Introns aus HPRT oder hGH Genen (Chung, J. H., et al., 1997, Proc. Natl. Acad. Sci. USA 94,575-580; Dunaway, M., et al, 1993, Mol. Cell.Biol., 17,182-189; Felsenfeld, G., et al., 1996, Proc.Natl. Acad. Sci. USA 93.93840-9388; Klehr, D., et al., 1991, Biochemistry, 30, 1264-1270).

Transduktionsuntersuchungen mit dAd.AAVfx-Globinvektoren:

Diese Untersuchungen wurden wie zuvor beschrieben durchgeführt (Steinwaerder, D. S., et al. 1999. J Virol 73: 9303-13). Transduzierte CD34+ Zellen werden in Kolonieassays der Differenzierung unterzogen oder durch in vivo Expansionsassays in SCID-NOD Mäusen untersucht. MC-Kolonien oder Knochenmarkszellen aus experimentellen Mäusen werden auf Expression von Globin untersucht. Expression von Gamma-Globin wird mit fluoreszierenden anti-gamma-Globin-Antiköpern nachgewiesen. RNAase-Schutzstudien können durchgeführt werden, um gamma-Globin mRNA im Vergleicht mit -Globin RNA zu quantifizieren. Für diese Untersuchungen benötigt man etwa 104–105 Zellen pro Test.

Positionelle Effekte

In Abwesenheit von LCR sind Globingene starken positionellen Effekten unterworfen, wenn sie in kultivierte CD34+ Zellen oder in erythroleukämische Linie transferiert werden (Fraser, P., et al., 1998, Curr. Opinion in Cell Bio., 10, 361-365; Grosveld, F., et al, 1998, Seminars in Hematology,35,105-111). Weitere Bedenken bestehen darin, das die ortsspezifische Integration von &Dgr;Ad.AAV/rep Vektoren in AAVS1 die Expression des Transgens silencen könnte. Wenn silencing auftritt, kann es durch Einbau von LCRs wie z.B. das 6.5 kb große Globin &mgr;LCR verhindert werden (Ellis, J., et al., 1996, EMBOJ., 15,562-568; Grosveld, F., et a.l, 1998,Seminars in Hematology, 35,105-111) oder durch Einbau von Insulatoren in &Dgr;Ad.AAV-basierte Expressionseinheiten. Insulatoren sind DNA-Elemente, die ein integriertes Reportergen von chromosomalen positionellen Effekten schützen oder die Enhancer-aktivierte Transkription von einem stromabwärts gelegenen Promoter verhindern. Insulator-Elemente kennt man für Drosophila melanogaster Gene (Gypsy, Suppressro von Hairy Wing, scs, scs', Fab-7), für das Hühner beta-GlobinGen (Hs4) und für den T-Zell-Rezeptor (BEAD1; 14, 21.25). Spezifisch können der Drosophila Gipsy Insulator oder der beta-Globin Insulator als zwei Kopien, flankierend die Globin-Expressionskassette, in hybride Vektoren eingesetzt werden. Die positionellen Effekte können in transduzierten MC-Kolonien basierend auf der Analyse von integierter Vektor-DNA (siehe 29) bewertet werden und die gamma-Globin mRNA kann quantifiziert werden. Analoge Untersuchungen können mit transduzierten humanen Knochenmarkszellen durchgeführt werden, nach Transplantation von infizierten CD34+ Zelle in SCID-NOD Mäuse.

Intron-Effekte auf die Expression von gamma-Globin:

Eine Anzahl von Berichten zeigt, dass die Deletion von Globin-Introns, insbesondere des zweiten Introns der beta- und gamma-Gene, die Stabilität der Globin mRNA verringern und somit auch die Expressionslevel (Antoniou, M. ET al., Nucleic Acids Res. 26:721-9). RNA Viren wie onco-retro, lenti- und foamy-Viren sind problematisch als Vehikel for Transgene, die Introns enthalten. Da &Dgr;Ad.AAV ein DNA-Virus ist, sollte er Globin-Introns und LCRs, wenn nötig, verpacken, und zwar ohne die verminderten Titer und Rearrangements, die man bei retroviralen Vektoren beobachtet.

ANHANG I

Humane und tierische Adenoviren, die von der ATCC erhältlich sind:

  • 1. Adenovirus Typ 21 ATCC VR-1099 (NIAID V-221-002-014)
  • 2. SA18 (Affen Adenovirus 18) ATCC VR-943 Klassifikation
  • 3. SA17 (Affen adenovirus 17) ATCC VR-942 Klassifikation
  • 4. Adenovirus Typ 47 ATCC VR-1309 Klassifikation: Adenov
  • 5. Adenovirus Typ 44 ATCCVR-1306 Klassifikation: Adenov
  • 6. Vogel Adenovirus Typ 4 ATCC VR-829 Klassifikation : Ad
  • 7. Vogel Adenovirus Typ 5 ATCCVR-830 Klassifikation: Ad
  • 8. Vogel Adenovirus Typ 7 ATCC VR-832 Klassifikation: Ad
  • 9. Vogel Adenovirus Typ 8 ATCC VR-833 Klassifikation: Ad
  • 10. Vogel Adenovirus Typ 9 ATCC VR-834 Klassifikation Ad
  • 11. Vogel Adenovirus Typ 10 ATCC VR-835 Klassifikation: A
  • 12. Vogel Adenovirus Typ 2 ATCC VR-827 Klassifikation : Ad
  • 13 Adenovirus Typ 45 ATCC VR-1307 Klassifikation: Adenov
  • 14. Adenovirus Typ38 ATCC VR-988 PermitPHS perrnit requ
  • 15. Adenovirus Typ 46 ATCC VR-1308 Klassifikation: Adenov
  • 16. Affen Adenovirus ATCCVer-541 Klassifikation: Adenovir
  • 17. SA7 (Affen Adenovirus 16) ATCC VR-941 Klassifikation:
  • 18. Frosch Adenovirus (FAV-1) ATCC VR-896 Klassifikation: Ad
  • 19. Adenovirus Typ48 (Kandidat) ATCC VR-1406 Classifica
  • 20: Adenovirus Typ 42 ATCCVR-1304 Klassifikation: Adenov
  • 21: Adenovirus Typ 49 (Kandidat) ATCC VR-1407 Classifica
  • 22: Adenovirus Typ 43 ATCCVR-130) Klassifikation. Adenov
  • 23: Vogel Adenovirus Typ 6 ATCCVR-831 Permit: USDA permi
  • 24: Vogel Adenovirus Typ3 (Inclusion body hepatitisvirus)
  • 25: Bovines Adenovirus Typ 3 ATCCVR-639 Klassifikation: A
  • 26: Bovines Adenovirus Typ 6 ATCC VR-642 Permit: USDA perm
  • 27: Hunde Adenovirus ATCCVR-800 Classificatin: Adenovir
  • 28: Bovines Adenovirus Typ5 ATCC VR-641 Permit: USDA perm
  • 29: Adenovirus Typ36 ATCCVR-913 Klassifikation: Adenovi
  • 30: Schaf Adenovirus Typ5 ATCC VR-1343 Klassifikation: A
  • 31: Adenovirus Typ 29 ATCCVR-272 Klassifikation: Adenovi
  • 32: Schwein Adenovirus ATCCVR-359 Klassifikation: Adenoviru
  • 33: Bovines Adenovirus Typ 4 ATCC VR-640 Permit : USDA perm
  • 34: Bovines Adenovirus Typ8 ATCC VR-769 Permit USDA perm
  • 35: Bovines Adenovirus Typ 7 ATCC VR-768 Permit: USDA perm
  • 36: Adeno-assoziiertes virus Typ2 (AAV-2H) ATCC VR-680 Cla
  • 37: Adenovirus Typ 4 ATCC VR-4 Klassifikation: Adenovirus
  • 38: Adeno-assoziiertes Virus Typ 3(AAV-3H) ATCC VR-681 Cla
  • 39: Peromyscus adenovirus ATCC VR-528 Klassifikation : Aden
  • 40: Adenovirus Typ 15 ATCC VR-661 Klassifikation: Adenovi
  • 41: Adenovirus Typ20 ATCCVR-662 Klassifikation: Adenovi
  • 42: Schimpansen Adenovirus ATCCVR-593 Klassifikation: Aden.
  • 43: Adenovirus Typ 31 ATCC VR-357 Klassifikation: Adenovi
  • 44: Adenovirus Type 25 ATCC VR-223 Klassifikation: Adenovi
  • 45: Schimpansen Adenovirus ATCC VR-592 Klassifikation: Aden
  • 46: Schimpansen Adenovirus ATCCVR-591Klassifikation:Aden
  • 47: Adenovirus Typ26 ATCCVR-224 Klassifikation : Adenovi
  • 48: Adenovirus Typ 19 ATCCVR-254 Klassifikation : Adenovi
  • 49: Adenovirus Typ23 ATCCVR-258K1assifikation:Adenovi
  • 50: Adenovirus Typ 28 ATCC VR-226 Klassifikation: Adenovi
  • 51: Adenovirus Typ 6 ATCCVR-6 Klassifikation: Adenovirus
  • 52: Adenovirus Typ 2 Antiserum: ATCCVR-1079 AS/Rab (NIA
  • 53: Adenovirus Typ6 ATCC VR-1083 NARDV-206-003-014)
  • 54: Schaf Adenovirus Typ 6 ATCC VR-1340 Klassifikation: A
  • 55: Adenovirus Typ 3 ATCC VR-847 (Abgeleitet von NIAID V-20
  • 56: Adenovirus Typ7 ATCC VR-7 Klassifikation:Adenovirus
  • 57: Adenovirus Typ39 ATCCVR-932 Klassifikation: Adenovi
  • 58: Adenovirus Typ 3 ATCCVR-3 Klassifikation: Adenovirus
  • 59: Bovines Adenovirus Typ 1 ATCCVR-313 Klassifikation: A
  • 60: Adenovirus Typ 14 ATCC VR-15 Klassfikation: Adenovir
  • 61: Adenovirus Typ 1 ATCCVR-1078 (NIAIDV-201-001-014)
  • 62: Adenovirus Typ 21 ATCC VR-256 Klassifikation: Adenovi
  • 63: Adenovirus Typ) 18 ATCC VR-1095 (NIAID V-218-003-014)
  • 64: Baboon adenovirus ATCCVR-275 Klassifikation: Adenovir
  • 65: Adenovirus Typ 10 ATCCVR-I I Klassifikation: Adenovir
  • 66: Adenovirus Typ 33 ATCCVR-626 Klassifikation: Adenovir
  • 67. Adenovirus Typ 34 ATCCVR-716 Klassifikation : Adenovi
  • 68: Adenovirus Typ 15 ATCCVR-16 Klassifikation : Adenovir
  • 69: Adenovirus Typ22ATCCVR-257Klassifikation:Adenovi

  • 70. Adenovirus Typ 24 ATCC VR-259 Klassifikation: Adenovi
  • 71. AdenovirusTyp)7ATCCVR-!094fNIAfDV-2t7-003-0)4
  • 72. Adenovirus Typ 4 ATCC VR-1081 (NIAID V-204-003-014)
  • 73: Adenovirus Typ 16 ATCC VR-17Klassifikation:Adenovir
  • 74: Adenovirus Typ 17 ATCCVR-18 Klassifikation : Adenovir
  • 75: Adenovirus Typ 16 ATCCVR-1093 (NIAIDV-216-003-014)
  • 76. Bovines Adenovirus Typ 2 ATCC VR-314 Klassifikation:: A
  • 77: SV-30 ATCC VR-203Klassifikation : Adenovirus Affen (
  • 78: Adenovirus Typ 32 ATCCVR-625 HIassifikation: Adenovi
  • 79: Adenovirus Typ20 ATCC VR-255 Klassifikation: Adenovi
  • 80: Adenovirus Typ 13 ATCC VR-14 Klassifikation: Adenovir
  • 81: Adenovirus Typ14 ATCCVR-1091 (NIADV-214-001-014)
  • 82: Adenovirus Typ18 ATCCVR-19 Klassifikation: Adenovir
  • 83: SV-39 ATCC VR-353 Klassifikation: Adenovirus. Affen (
  • 84: adenovirus Typ 11 11ATCCVR-849 abgeleitet von NIAID V-2
  • 85: Enten Adenovirus (Ece drop syndrome) ATCCVR-921 Permi
  • 86: Adenovirus NIAID V-20 91:SV-31 ATCC Vr-204 Classification: Adenovirus.
  • 87: Schimpansen Adenovirus ATCC VR-594 Klassifikation:Aden
  • 88: Adenovirus Typ 15 ATCC VR-1092 (NIAID V-215-003-014)
  • 89: Adenovirus Typ 13 ATCC VR-1090 (NIAID V-213-003-014)
  • 90: Adenovirus Typ 8 ATCC VR-1368 (abgeleitet von NIAID V-20
  • 91: SV31 ATCC VR-204 Klassifikation: Adenovirus, Simian
  • 92: AdenovirusTyp 9 ATCC VR-1086 (NIAID V-209-003-014)
  • 93: MAUS adenovirus ATCCVR-5) 0 Klassifikation: Adenovin
  • 94: Adenovirus Typ 9 ATCC VR-10 Klassifikation: Adenoviru
  • 95: Adenovirus Typ 41 ATCC VR0930 Klassifikation: Adenovi
  • 96: ClATCC VR-20 Klassifikation :Adenovirus. Affen (Mast
  • 97: Adenovirus Typ 40 ATCCVR-931Klassifikation:Adenovi
  • 98: Adenovirus Typ 37 ATCC VR-929 Klassifikation : Adenovi
  • 99: Marble spleen disease virus (Hemorrhagic enteritis virus
  • 100: Adenovirus Typ 35 ATCCVR-718 Klassifikation : Adenovi
  • 101: SV-32(M3) ATCC VR-205 Klassifikation:Adenovirus.
  • 102: Adenovirus Typ 28 ATCC VR-1106 (NIAIDV-228-003-014)
  • 103: Adenovirus Typ 10 ATCC VR-1087 (NIAID V-210-003-014)
  • 104: Adenovirus Tvpe 20 ATCCVR-1097 (NIAIDV-220-003-014)
  • 105: Adenovirus Typ21 ATCC VR-1098(NIAIDV-221-011-014)
  • 106: Adenovirus Typ25ATCCVR-1103 (NIAIDV-225-003-014)
  • 107: Adenovirus Typ26ATCCVR-1104(NIAIDV-226-003-014)
  • 108: Adenovirus Typ 31 ATCC VR-1109 (NIAID V-231-001-014)
  • 109: Adenovirus Typ 19 ATCCVR-1096 (NTAID V-219-002-014)
  • 110: SV-36 ACCVR-208 Klassifikation: Adenovirus,Affen
  • 111: SV-38 ATCC VR-355 Klassifikation: Adenovirus, Affen (
  • 112: SV-25 (M8) ATCC VR-201 Klassifikation:Adenovirus Sim
  • 113: SV-15 (M4)ATCC VR-197 Klassifikation: Adenovirus Sim
  • 114: Adenovirus Typ 22 ATCC VR-1100 (NIAIDV-222-003-014
  • 115: SV-23 VR-200 HIassifikation:Adenovirus.SimATCC
  • 116: AdenovirusTyp 11 ATCC VR-12 Klassifikation: Adenovir
  • 117: Adenovirus Typ 24 ATCC VR-1102 (NIAIDV-224-003-0140
  • 118: Vogel Adenovirus Typ 1 ChickenEmbrvo Letlial Orphan; C
  • 119: SV-II (M5)ATCC-VR-196 Klassifikation: Adenovirus, Sim
  • 120: Adenovirus Typ 5 ATCCVR-5 Klassifikation : Adenovirus
  • 121: Adenovirus Typ 23 ATCC VR-1101 (NIAID V-223-003-014)
  • 122: SV-27(M9) ATCCVR-202 Klassifikation:Adenovirus. Sim
  • 123: Vogel Adenovirus Typ2 (GAL) ATCC VR-280 Classificati
  • 124: SV-I (M1) ATCC VR-195 Klassifikation: Adenovirus. Simi
  • 125: SV-17 (M6) ATCC VR-198 Klassifikation : Adenovirus. Sim
  • 126: Adenovirus Typ 29 ATCC VR-1107 CArD V-299-003-014)
  • 127: Adenovirus Typ 2 ATCC VR-846 Klassifikation: Adenovir
  • 128: SV-34 ATCC VR-207 Klassifikation: Adenovirus, Affen
  • 129: SV-20(M7) ATCC VR-199 Klassifikation: Adenovirus, Sim
  • 130: SV-37 ATCC VR-209 Klassifikation:Adenovirus. Affen
  • 131: SV-33 (M10) ATCC VR-206 Klassifikation: Adenovirus. Si
  • 132: Vogel Adeno-assoziiertes virus ATCC VR-865 Classificatio
  • 133: Adeno-assoziiertes (satellite) virus Typ 4 ATCC VR-646
  • 134: Adenovirus Typ 30 ATCCVR-273 Klassifikation:Adenovi
  • 135: Adeno-assoziiertes (satellite) virus Typ I ATCC VR-645
  • 136: Infektiöse canine Hepatitis (Rubarth's disease. Fox ence)
  • 137: Adenovirus Typ 27 ATCCVR-1105(NIAIDV-227-003-014)
  • 138: Adenovirus Typ 12 ATCC VR-863 (Abgeleitet von NIAIDV-2
  • 139: Adeno-assoziiertes Virus Typ 2 (molekular kloniert) ATCC
  • 140: Adenovirus Typ 7a ATCC VR-848 (Abgeleitet von NIAID V-2

Anspruch[de]
  1. Rekombinanter, doppelsträngiger, Adenovirusvektor, wobei der erste Strang umfasst:

    a. eine links invertierte terminale Repeat-Sequenz von Adenovirus;

    b. eine Packsequenz von Adenovirus;

    c. eine erste Adenovirus-assoziierte invertierte terminale Repeat-Sequenz;

    d. eine erste invertierte Repeat-Sequenz;

    e. eine heterologe Promotor-Sequenz, welche die Transkription in eine Richtung zu der linken invertierten terminalen Repeat-Sequenz in Schritt a. vermittelt;

    f. eine fremde Gen-Sequenz;

    g. eine zweite invertierte Repeat-Sequenz;

    h. eine zweite Adenovirus-assoziierte invertierte terminale Repeat-Sequenz;

    i. eine Nukleotidsequenz, welche die Replikation eines Adenvirus in einer transduzierten Zelle vermittelt; und

    j. eine rechts invertierte terminale Repeat-Sequenz von Adenovirus; und wobei der zweite Strang eine Nukleotidsequenz umfasst, die für ein modifiziertes adenovirales Fiber-Protein kodiert, das den Tropfismus des Adenvirusvektors verändert und wobei das modifizierte adenovirale Fiber-Protein ein modifizierter Fiber-Kopf, ein modifizierter Fiber-Schwanz oder ein modifizierter Fiber-Schaft ist.
  2. Rekombinanter, doppelsträngiger, Adenovirusvektor, wobei der erste Strang umfasst:

    a. eine links invertierte terminale Repeat-Sequenz von Adenovirus;

    b. eine Packsequenz von Adenovirus;

    c. eine erste Adenovirus-assoziierte invertierte terminale Repeat-Sequenz;

    d. eine erste invertierte Repeat-Sequenz;

    e. eine heterologe Promotor-Sequenz, welche die Transkription in einer Richtung von der linken invertierten terminalen Repeat-Sequenz weg in Schritt a. vermittelt;

    f. eine fremde Gen-Sequenz;

    g. eine zweite invertierte Repeat-Sequenz;

    h. eine zweite Adenovirus-assoziierte invertierte terminale Repeat-Sequenz;

    i. eine Nukleotidsequenz, welche die Replikation eines Adenvirus in einer transduzierten Zelle vermittelt; und

    j. eine rechts invertierte terminale Repeat-Sequenz von Adenovirus; und wobei der zweite Strang eine Nukleotidsequenz umfasst, die für ein modifiziertes adenovirales Fiber-Protein kodiert, das den Tropfismus des Adenvirusvektors verändert und wobei das modifizierte adenovirale Fiber-Protein ein modifizierter Fiber-Kopf, ein modifizierter Fiber-Schwanz oder ein modifizierter Fiber-Schaft ist.
  3. Adenoviraler Vektor nach Anspruch 1 oder 2, wobei der modifizierte Fiber-Kopf, der modifizierte Fiber-Schwanz oder der modifizierte Fiber-Schaft von einem adenoviralen Serotyp stammt, der sich von dem Serotyp der linken oder der rechten adenoviralen invertierten terminalen Repeat-Sequenz unterscheidet.
  4. Adenoviraler Vektor nach Anspruch 1 oder 2, wobei der modifzierte Fiber-Kopf, der modifizierte Fiber-Schwanz oder der modifizierte Fiber-Schaft von den adenoviralen Serotypen Ad3, Ad7, Ad9, Ad 11 oder Ad35 stammt.
  5. Adenoviraler Vektor nach Anspruch 1 oder 2, wobei der modifizierte Fiber-Kopf an ein Zelloberflächen-Protein auf einer interessierenden Zielzelle bindet.
  6. Adenoviraler Vektor nach Anspruch 1 oder 2, wobei der modifzierte Fiber-Kopf in der G-H-Loop-Region oder der H-I-Loop-Region modiziert ist.
  7. Adenoviraler Vektor nach Anspruch 1 oder 2, wobei der modifizierte Fiber-Kopf einen heterologen Peptid-Liganden umfasst, der die G-H-Loop-Region oder die H-I-Loop-Region ersetzt.
  8. Adenoviraler Vektor nach Anspruch 7, wobei der heterologe Peptid-Ligand ein RI- oder ein RII-Protein von dem Malaria Circumsporozoit Oberflächenprotein (CS) ist.
  9. Adenoviraler Vektor nach Anspruch 8, wobei das RI-Protein von dem Malaria Circumsporozoit Oberflächenprotein (CS) die Aminosäuresequenz KLKQPG umfasst.
  10. Adenoviraler Vektor nach Anspruch 8, wobei das RII-Protein von dem Malaria Circumsporozoit Oberflächenprotein (CS) die Aminosäuresequenz EWSPCSVTCGNGIQVRIK umfasst.
  11. Adenoviraler Vektor nach Anspruch 7, wobei der heterologe Peptid-Ligand die Aminosäuresequenz umfasst:

    a. LGGKPDQ;

    b. LNGCGSC;

    c. LNGCGSGC; oder

    d. LNGCG GC.
  12. Adenoviraler Vektor nach Anspruch 1 oder 2, der Hepatozyten, Knockenmarkszellen, Stammzellen oder Brustkrebszellen infiziert.
  13. Adenoviraler Vektor nach Anspruch 1 oder 2, wobei der modifizierte Fiber-Schaft eine verkürzte Länge aufweist.
  14. Adenoviraler Vektor nach Anspruch 1 oder 2, wobei die adenovirale Packsequenz und die linke und rechte adenovirale invertierte terminale Repeat-Sequenzen von demselben adenoviralen Serotyp sind.
  15. Adenoviraler Vektor nach Anspruch nach 1 oder 2, wobei die adenovirale Packsequenz und die linke und rechte adenovirale Repeat-Sequenzen von dem Serotyp Ad5 sind.
  16. Adenoviraler Vektor nach Anspruch nach 1 oder 2, wobei die fremde Gensequenz für ein therapeutisches Genprodukt, ein selektierbares Genprodukt oder ein Reporter-Genprodukt kodiert.
  17. Adenoviraler Vektor nach Anspruch nach 1 oder 2, wobei das therapeutische Genprodukt gamma-Globulin oder humanes alpha-1-anti-Trypsin ist.
  18. Adenoviraler Vektor nach Anspruch nach 1 oder 2, wobei das selektierbare Genprodukt Neomycin, Ampicillin, Penicillin, Tetracyclin oder Gentamycin ist.
  19. Adenoviraler Vektor nach Anspruch nach 1 oder 2, wobei das Reporter-Genprodukt grün fluoreszierendes Protein, beta-Galaktosidase oder alkaline Phosphatase ist.
  20. Adenoviraler Vektor nach Anspruch nach 1 oder 2, der weiter eine Insulatorelement-Sequenz umfasst.
  21. Adenoviraler Vektor nach Anspruch nach 1 oder 2, der weiter einen bakteriellen Replikationsstartpunktumfasst.
  22. Adenoviraler Vektor nach Anspruch nach 1 oder 2, der weiter eine Nukleotidsequenz, die für ein rep78-Protein kodiert, umfasst.
  23. Adenoviraler Vektor nach Anspruch nach 1 oder 2, wobei die Gensequenz, welche die Replikation eines Adenovirus in der transduzierten Zelle vermittelt, ausgewählt ist aus der Gruppe bestehend aus E2 und E4; E1, E2 und E4; E2 und E4; und E2, E3 und E4.
  24. Adenoviraler Vektor nach Anspruch 1 oder 2, wobei die fremde Gensequenz einen 5'-Teil der fremden Gensequenz umfasst.
  25. Adenoviraler Vektor nach Anspruch nach 1 oder 2, wobei die fremde Gensequenz einen 3'-Teil der fremden Gensequenz umfasst.
  26. Verfahren zur Herstellung eines gelösten adenoviralen Gutless-Vektors in einer Zelle, umfassend das in Kontakt bringen von mindestens einem ersten und einem zweiten adenoviralen Vektor nach Anspruch 1 und/oder 2 in der Zelle, unter Bedingungen, die für eine homologe Rekombination in der Zelle geeignet sind.
  27. Verfahren nach Anspruch 26, wobei der erste adenovirale Vektor einen 5'-Teil der fremden Gensequenz umfasst und der zweite adenovirale Vektor einen 3'-Teil der fremden Gensequenz umfasst und wobei die 5'- und 3'-Teile der fremden Gensequenz überlappen, was eine homologe Rekombination erlaubt.
Es folgen 34 Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

  Patente PDF

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com