PatentDe  


Dokumentenidentifikation DE69926729T2 08.06.2006
EP-Veröffentlichungsnummer 0001049767
Titel TRANSGENES KANINCHEN, DASS EIN FUNKTIONELLES MENSCHLICHES LIPOPROTEIN(A) EXPRIMIERT
Anmelder Aventis Pharmaceuticals Inc., Bridgewater, N.J., US;
The Regents of the University of California, Oakland, Calif., US;
Institut National de la Recherche Agronomique, Paris, FR
Erfinder ROUY, Didier, F-94320 Thiais, FR;
DUVERGER, Nicolas, F-75010 Paris, FR;
EMMANUEL, Florence, F-93300 Aubervilliers, FR;
DENEFLE, Patrice, F-94100 Saint Maur, FR;
HOUDEBINE, Louis-Marie, F-78530 Buc, FR;
VIGLIETTA, Celine, F-78000 Versailles, FR;
RUBIN, Edward, Berkeley, US;
HUGHES, D., Steven, Oakland, US
Vertreter Zumstein & Klingseisen, 80331 München
DE-Aktenzeichen 69926729
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 08.01.1999
EP-Aktenzeichen 999040512
WO-Anmeldetag 08.01.1999
PCT-Aktenzeichen PCT/US99/00401
WO-Veröffentlichungsnummer 0099035241
WO-Veröffentlichungsdatum 15.07.1999
EP-Offenlegungsdatum 08.11.2000
EP date of grant 17.08.2005
Veröffentlichungstag im Patentblatt 08.06.2006
IPC-Hauptklasse C12N 5/00(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 9/00(2006.01)A, L, I, 20051017, B, H, EP   C12N 11/10(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/00(2006.01)A, L, I, 20051017, B, H, EP   A61K 49/00(2006.01)A, L, I, 20051017, B, H, EP   G01N 31/00(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]

Die vorliegende Erfindung wurde mit Unterstützung der Regierung unter Bewilligung PPG HL 18574, die den National Institutes of Health erteilt wurde, und durch Vertrag Nr. DE-AC03-76SF 00098 zwischen dem U.S. Department of Energy und der University of California, gemacht. Die US-Regierung hat gewisse Rechte an der Erfindung.

Querbezug zu verwandten Anmeldungen

Diese Anmeldung basiert auf der vorläufigen US-Anmeldung Nr. 60/070 727, eingereicht am 08. Januar 1998, und beansprucht deren Priorität.

Gebiet der Erfindung

Die vorliegende Erfindung bezieht sich auf Modelle humaner Krankheiten und auf Verfahren unter Verwendung dieser Modelle zur Identifizierung von Verbindungen, die zur Behandlung dieser Krankheiten wirksam sind. Die vorliegende Erfindung stellt insbesondere ein neues experimentelles Modell für die in vivo-Analyse von humanem Lipoprotein (a) [Lp(a)] und die Entwicklung therapeutischer Strategien zur Verringerung der Gesundheitsrisiken, die mit hohen Leveln dieses Lipoproteins verbunden sind, dar.

Dyslipoproteinämien sind Störungen im Metabolismus der Lipoproteine, die zum Transport von Lipiden, z.B. Cholesterin und Triglyceride, im Blut und den peripheren Flüssigkeiten verantwortlich sind. Dyslipoproteinämien sind in der Folge mit lebensbedrohenden Erkrankungen, die mit Hypercholesterinämie, Hypocholesterinämie oder Hypertriglyceridämie, z.B. Atherosklerose, verknüpft sind, assoziiert.

Atherosklerose ist eine komplexe, polygene Krankheit, die auf der histologischen Ebene durch Ablagerungen (Lipid- oder Fibrolipid-Plaques) von Lipiden und anderen Blutderivaten in der Wand der großen Arterien (Aorta, Koronararterien und Carotid) definiert wird. Die Plaques, die entsprechend dem Fortschreiten der Krankheit mehr oder weniger verkalkt sind, können mit Läsionen assoziiert sein und sind mit der Akkumulierung von Fettabscheidungen, die im wesentlichen aus Cholesterinestern bestehen, in den Arterien verknüpft. Die Plaques werden von einer Verdickung der Arterienwand zusammen mit Hypertrophie des glatten Muskels, dem Auftreten von Schaumzellen und der Akkumulierung von Fasergewebe begleitet. Die Plaques werden an der Arterienwand gebildet, was zu einer Stenose führt, d.h. einer Verengung oder Struktur der Arterie. Bei den am schlimmsten betroffenen Patienten ist diese Stenose für die Gefäßverschlüsse, z.B. Atherom, Thrombose und Embolien, verantwortlich. Dementsprechend kann eine übermäßige Akkumulierung von Cholesterin (Hypercholesterinämien) zu sehr schweren kardiovaskulären Erkrankungen wie z.B. Infarkt, plötzlicher Tod, Herzdekompensation, Herzkreislauferkrankungen und dergleichen, führen.

Es ist daher besonders wichtig, sofort verfügbare Behandlungen zu haben, die in einigen Krankheitssituationen die Level an Plasmacholesterin senken oder den Efflux von Cholesterin (Umkehrtransport von Cholesterin) aus den peripheren Geweben stimulieren, um die Zellen zu entlasten, die das Cholesterin in Verbindung mit der Bildung von Atheromplaque akkumuliert haben. Cholesterin wird im Blut durch eine Vielzahl von Lipoproteinen transportiert, einschließlich Lipoproteine niedriger Dichte (LDL) und Lipoproteine hoher Dichte (HDL). Die LDLs werden in der Leber synthetisiert und sind für die Versorgung der peripheren Gewebe mit Cholesterin verantwortlich. Dagegen nehmen die HDLs Cholesterin in den peripheren Geweben auf und transportieren es zu der Leber, wo es gespeichert und/oder abgebaut wird.

Zahlreiche Studien brachten erhöhte Plasmaspiegel an Lipoprotein (a) [Lp(a)] mit dem verstärkten Auftreten kardiovaskulärer Erkrankungen und Schlaganfall in Beziehung (Übersicht in G. Utermann, Science (1989) 246, 904–910; V.M.G. Maher & B.G. Brown, Curr. Opin. Lipidol. (1995) 6, 229–235). Lipoprotein (a) ist ein komplexes Partikel, das aus einer Lipidgruppierung und zwei Disulfid-verknüpften Untereinheiten besteht: Apolipoprotein B-100 (apoB-100) und Apolipoprotein (a) [apo(a)]. Das Vorliegen von apo(a), ein hydrophiles Glycoprotein, das strukturell mit Plasminogen verwandt ist, unterscheidet Lp(a) von Lipoprotein niedriger Dichte (LDL) und verleiht seine charakteristischen biologischen und physikalischen Eigenschaften.

Apolipoprotein B-100 (apoB) ist der Hauptproteinbestandteil von Lipoproteinen sehr niedriger Dichte (VLDL), Lipoproteinen niedriger Dichte (LDL) und Lipoprotein Lp(a). Dieses Protein ist der physiologische Ligand des LDL-Rezeptors und seine Plasmakonzentration steht in positiver Korrelation mit der Entwicklung von Atherosklerose (Brunzell et al., 1984, Arteriosclerosis 4, 79–93). ApoB-100 ist eines der größten bekannten Proteine mit einer Masse von 550 kDa; es enthält 4536 Aminosäuren (Chen et al., 1986, J. Biol. Chem., 261, 12919–21). Dieses Apolipoprotein wird nur in der Leber synthetisiert. Seine Plasmakonzentration ist 1,0–1,2 g/l. ApoB-100 spielt beim Transport von Cholesterin, das in der Leber synthetisiert wird, durch das Plasma zu den anderen Zellen des Organismus die Hauptrolle. Eine andere Version von apoB, d.h. apoB-48, kommt in den Chylomikronen vor. Beim Menschen wird apoB-48 im Intestinum synthetisiert. ApoB-48 hat eine Masse von 260 kDa und enthält 2152 Aminosäuren, die linear 48% des N-terminalen Endes von apoB-100 entsprechen (Powell et al., 1987, Cell 50, 831–40). Da die C-terminale Gruppierung von apoB-100 die Zone zur Bindung des apoB-100 an den LDL-Rezeptor enthält, bindet apoB-48 nicht an diesen zuletzt genannten Rezeptor und verhält sich metabolisch anders.

Um die Krankheitszustände zu untersuchen, die mit Dyslipoproteinämien in Verbindung stehen, ist es vorteilhaft, ein Tiermodell zu haben, das ein Protein oder einen Proteinkomplex exprimiert, der mit einem Risiko für eine Krankheit, die mit Dyslipoproteinämien verbunden ist, assoziiert ist. Ein derartiges Tiermodell wäre zum Verständnis dieser Krankheiten und insbesondere der regulatorischen Mechanismen, die diese Proteine oder Proteinkomplexe initiieren, besonders vorteilhaft. Dies würde es möglich machen, schnell und in vivo eine beachtliche Anzahl von therapeutischen Mitteln oder Verbindungen zum Zwecke des Detektierens einer potentiellen Aktivität, die mit der Expression der Proteine assoziiert ist, zu untersuchen, Außerdem wäre ein derartiges Modell zur Entwicklung neuer therapeutischer Methoden zur Behandlung dieser Krankheitstypen, z.B. Methoden, die auf der Gentherapie basieren, von Interesse. Die in vivo-Analyse von Lp(a), ein unabhängiger Atherosklerose-Risikofaktor bei Menschen, wurde zum Teil durch seine beschränkte Verteilung unter Säugern limitiert. Apo(a) kommt natürlicherweise ausschließlich bei Affen der alten Welt, Menschen und einer Nicht-Primaten- Spezies, dem europäischen Igel, vor. Eine derartig begrenzte Verteilung von apo(a) unter Säugern hat Studien über seine in vivo-Eigenschaften limitiert.

Dementsprechend bezieht sich die vorliegende Erfindung auf Tiermodelle von Krankheitszuständen, bei denen Lp(a) involviert ist, einschließlich Atherosklerose, um ein Screening und eine Identifizierung von Verbindungen zur Behandlung dieser Krankheiten, insbesondere Atherosklerose, durchführen zu können.

Beschriebene Entwicklungen

Allgemein gesprochen, die murinen Tiere, nämlich Mäuse, Ratten und Meerschweinchen, sind die am meisten verwendeten Tiermodelle. Sie sind leicht zu manipulieren und billig. Unglücklicherweise sind diese kleinen Tiere nicht immer mit der angestrebten Anwendung kompatibel, da sie für die Menschen und ihren Metabolismus nicht immer repräsentativ sind. Schimpansen werden zum Testen therapeutischer Mittel und Vakzine, die gegen verschiedene Krankheiten gerichtet sind, einschließlich AIDS und Krebs, verwendet. Allerdings bilden die äußerst wesentlichen Kosten, die bei der Verwendung von Schimpansen als Modellsystem auftreten, ein Haupthindernis und stellen ein zwingendes Hindernis bezüglich ihrer Verwendung dar.

Trotz der Nachteile eines Systems, das Mäuse verwendet, stellte die Entwicklung von transgenen Mäusen, die humane apo(a)-cDNA exprimieren, ein Mittel bereit, um Hypothesen zu untersuchen, die den Effekt von Lp(a) auf das Gefäßsystem erklären. Spezifisch ausgedrückt, diese Mäuse wurden verwendet, um die Fähigkeit von apo(a), eine Atherogenese durch Inhibierung von Plasminbildung und damit verbundene Konsequenzen zu fördern (Lawn et al., Nature (1992) 360, 670–672; Grainger et al., Nature (1994) 370, 460–462). Studien an transgenen apo(a)-Mäusen haben auch zu verschiedenen wichtigen Einsichten in den Lp(a)-Zusammenbau geführt, einschließlich zu der Beobachtung, dass apo(a) unfähig war, eine kovalente Kombination mit LDL enthaltendem murinen apoB zu bilden (Chiesa et al., J. Biol. Chem. (1992 267, 24369–24374). Dieses Resultat legte gekoppelt mit dem Beweis einer Lp(a)-Bildung, wenn den Mäusen humanes LDL infundiert wurde oder ein humanes apoB-Transgen exprimiert wurde (Linton et al., J. Clin. Invest (1993) 92, 3029–3037; Callow et al., Proc. Natl. Acad. Sci., USA (1994) 91, 2130–2136), nahe, dass murinem apoB strukturelle Anforderungen fehlen, die für einen Lp(a)-Zusammenbau notwendig sind. Dies war im Hinblick auf das Fehlen des apo(a)-Gens in Mäusen keine vollständig unerwartete Feststellung; und es wird angenommen, dass die sequenzspezifischen Wechselwirkungen zwischen apo(a) und apoB den Lp(a)-Zusammenbau in Menschen vermitteln. Zwei Studien, die eine ortsspezifische Mutagenese von humanen apoB-Transgenen in Mäusen verwendeten, beschreiben eine Lokali-sierung eines einzelnen Cysteins in humanem apoB (Cys 4326), das die Befestigungsstelle für apo(a) bereitstellt (M.J. Callow & E.M. Rubin, J. Biol. Chem. (1995) 270, 23914–23917; McCormick et al., (1995) 92, 10147–10151).

In jüngster Zeit wurde die Regulation der apo(a)-Genexpression in transgenen Mäusen studiert, die einen humanen genomischen apo(a)-Klon enthalten (Frazer et al., Nat. Gen (1995) 9, 424–431). Dieses Transgen umfasst das apo(a)-Gen zusammen mit seinem nativen Promotor und cis-wirkende Elemente, die in der etwa 60 kb 5'- und 80 kb 3'-flankierenden DNA vorliegen. Das Transgen wurde effizienter exprimiert (d.h. alle transgenen apo[a]-Stammlinien, die geschaffen wurden und ein intaktes Transgen enthielten, exprimierten apo[a]) und führte zu deutlich höheren Plasma-apo(a)-Spiegeln als sie bei Mäusen beobachtet wurden, die ein apo(a)-cDNA-Konstrukt enthalten. Eine überraschende Feststellung bei Mäusen, die das humane genomische apo(a)-Transgen exprimieren, waren die tiefen Geschlechtshormon-induzierten Änderungen bei der apo(a)-Expression, die weit über die Größenordnung der mit Androgen und Östrogen in Verbindung stehenden Änderungen, die bei Menschen beobachtet werden, hinausgehen. Diese Änderungen waren qualitativ allerdings bei Menschen und transgenen Mäusen ähnlich. In beiden Fällen senken diese Hormone die apo(a)-Plasmaspiegel.

Die Verwendung von genomischen Klonen bei der Beschaffung transgener Tiere hat im allgemeinen Vorteile gegenüber der Verwendung von cDNA-Konstrukten. Am bedeutendsten ist, dass die Transgenexpression in geeigneter Weise reguliert wird und von der Integrationsstelle unabhängig ist. Dieser Ansatz war allerdings infolge der technischen Schwierigkeit, extrem große genomische Klone zu manipulieren, und der geringeren Wirksamkeit der Transgenese bei anderen Tieren auf die Produktion von transgenen Mäusen für große Gene, wie z.B. apo(a), begrenzt.

Obgleich transgene Mäuse geschaffen wurden, die Lp(a) enthalten, hat die kleine Größe der Maus und die Unterschiede bei den Lipoprotein-Profilen zwischen Mäusen und Menschen verschiedene Studien ausgeschlossen. Folglich ist es wünschenswert, ein Tiermodellsystem zu identifizieren, das dem Menschen näher kommt, das allerdings die Kosten, die mit primaten Modellsystemen verbunden sind, vermeidet.

Callow et al., Proc. Natl. Acad. Sci. USA (1994) 91, 2130–2134 beschreibt die Isolierung eines 90 Kilobasen P1-Phagemids, das das humane apoB-Gen enthält, und die Erzeugung von 13 Linien transgener Mäuse, von denen 11 humanes apoB exprimierten. Das humane apoB-Transkript wurde in der Leber der transgenen Mäuse exprimiert und sezerniert.

WO 95/25793 offenbart ein transgenes Kaninchen, das ein Protein exprimiert, das fähig ist, mit Krankheiten, welche mit Dyslipoproteinämie in Verbindung stehen, zu Wechselwirken, ein Verfahren zur Herstellung desselben und seine Verwendung in einem Tiermodell.

Fan et al., Arteriosclerosis, Thrombosis und Vascular Biology (1995) 15, 1889–1899 beschreibt eine Studie, in der ein humanes genomisches DNA-Fragment mit 80 kb, das das humane apoB-Gen umspannt, zur Erzeugung von transgenen weißen Neuseeland-Kaninchen, welche humanes apoB-100 exprimierten, verwendet wurde.

Demnach besteht auf dem Fachgebiet Bedarf für ein geeignetes Tiermodell für Lp(a)-vermittelte Krankheiten und Störungen. Es besteht weiterhin Bedarf auf dem Fachgebiet für ein transgenes Tier, das humanes Lp(a) exprimiert. Um wirklich nützlich zu sein, muss ein transgenes Tier darüber hinaus die Lp(a)-Bestandteilsproteine bei einem ausreichend hohen Level exprimieren und muss eine kovalente Assoziierung der Bestandteile erlauben, um so physiologisch relevante Level an Lp(a) zu produzieren. Bis dato wurden die technischen Schwierigkeiten bei der Erzeugung eines solchen Tiers bis zur vorliegenden Erfindung nicht überwunden.

Die vorliegende Erfindung überwindet diesen Mangel des Standes der Technik, indem sie ein nützliches transgenes Tier, das physiologische Level an humanem Lp(a) produziert, trotz der Schwierigkeiten bei Durchführung einer solchen Erfindung bereitstellt.

Die vorliegende Erfindung bezieht sich insbesondere auf transgene Tiere, die sowohl humanes Apolipoprotein (a) [apo(a)]- als auch Apolipoprotein B (apoB)-Gene exprimieren. Diese Tiere exprimieren humanes Lipoprotein (a) [Lp(a)], das komplexe Partikel, das aus einer Lipidgruppierung und zwei Disulfid-verknüpften Untereinheiten apo(a) und apoB besteht.

Zusammenfassung der Erfindung

Erfindungsgemäß wird ein transgenes Kaninchen bereitgestellt, das in seiner genomischen DNA Sequenzen hat, die für humane Apolipoprotein (a)- und humane Apolipoprotein B-Polypeptide, die fähig sind, sich unter Herstellung von humanem Lipoprotein (a) zu kombinieren, codieren.

Die vorliegende Erfindung stellt auch ein transgenes Kaninchen bereit, das fähig ist, Lipoprotein (a) zu produzieren, wobei das Kaninchen menschenartige atherosklerotische Läsionen entwickelt, wenn es mit cholesterinreichener Nahrung gefüttert wird.

Die vorliegende Erfindung stellt auch transgene Kaninchen bereit, die fähig sind, Lipoprotein (a) zu produzieren, die exogene humane DNA-Sequenzen haben. Die DNA-Sequenzen können aus genomischen DNAs und cDNAs ausgewählt werden.

Wie oben festgestellt wurde, haben die transgenen Kaninchen der vorliegenden Erfindung in ihrer genomischen DNA Sequenzen, die für Apolipoprotein (a) und Apolipoprotein B codieren. Die vorliegende Erfindung stellt transgene Kaninchen bereit, die fähig sind, Lipoprotein (a) zu produzieren, und die Leberzellen haben, die die DNA-Sequenzen exprimieren, und die Erfindung stellt transgene Kaninchen bereit, die fähig sind, Lipoprotein (a) zu produzieren, die Testiszellen haben, welche die DNA-Sequenzen exprimieren.

Noch ein weiterer Aspekt der vorliegenden Erfindung ist ein transgenes Kaninchen, das während seiner Geschlechtsreife einen stabilen Plasmaspiegel an humanem Apolipoprotein (a)-Polypeptid hat.

Ein transgenes Kaninchen, das fähig ist, Apolipoprotein (a)- und Apolipoprotein B-Polypeptide zu exprimieren, kann durch ein Verfahren erzeugt werden, welches Kombinieren der Keimbahnzellen (germ line cells) eines ersten Kaninchens, das fähig ist, Apolipoprotein (a) zu exprimieren, mit den Keimzellen eines zweiten Kaninchens, das fähig ist, Apolipoprotein B zu exprimieren, umfasst. Keimbahnzellen umfassen z.B. Eier und Sperma.

Ein transgenes Kaninchen, das fähig ist, Apolipoprotein (a)- und Apolipoprotein B-Polypeptide zu exprimieren, kann durch Paarung eines ersten Kaninchens, das fähig ist, Apolipoprotein (a) zu exprimieren, mit einem anderen Kaninchen, das fähig ist, Apolipoprotein B zu exprimieren, geschaffen werden. In einem bevorzugten Verfahren zur Erzeugung eines transgenen Kaninchen, das fähig ist, Lipoprotein (a) zu exprimieren, wird das Kaninchen, das Apolipoprotein B-Protein exprimiert, bereitgestellt, indem einem Kaninchenembryo ein Phagemid injiziert wird, der das humane Apolipoprotein B-Gen enthält.

In einem bevorzugten Verfahren zur Erzeugung eines transgenen Kaninchens, das fähig ist, Lipoprotein (a) zu exprimieren, wird das Kaninchen, das Lipoprotein (a) exprimiert, bereitgestellt, indem einem Kaninchenembryo künstliches Hefechromosom, welches ein humanes Apolipoprotein (a)-Gen enthält, injiziert wird.

In noch einem anderen Verfahren zur Erzeugung eines transgenen Kaninchen, das fähig ist, Lipoprotein (a) zu exprimieren, wird das Kaninchen, das Apolipoprotein (a) exprimiert, bereitgestellt, indem in eine embryonale Kaninchenstammzelle wenigstens ein humanes DNA-Fragment, das für Apolipoprotein (a)-Protein codiert, eingeführt wird, die Stammzelle mit einem Kaninchenblastocyst kombiniert wird und der Embryo in ein weibliches Empfängerkaninchen übertragen wird.

In noch einem anderen Verfahren zur Erzeugung eines transgenen Kaninchens, das fähig ist, Lipoprotein (a) zu exprimieren, wird das Kaninchen, das Apolipoprotein B exprimiert, bereitgestellt, indem in eine embryonale Kaninchenstammzelle wenigstens ein humanes DNA-Fragment, das für das Apolipoprotein B-Protein codiert, eingeführt wird, die Stammzelle mit einem Kaninchenblastocyst kombiniert wird und der Embryo in ein weibliches Empfängerkaninchen transferiert wird.

In noch einem anderen Verfahren zur Erzeugung eines transgenen Kaninchens, das zum Exprimieren eines Lipoprotein (a) fähig ist, wird das Kaninchen, das Apolipoprotein (a) trägt und exprimiert, bereitgestellt, indem eine Kaninchenblastomere mit einem Retrovirus, das wenigstens ein humanes DNA-Fragment umfasst, welches für Apolipoprotein (a)-Protein codiert, infiziert wird und das Blastomere auf ein weibliches Empfängerkaninchen übertragen wird.

In noch einem anderen Verfahren zum Produzieren eines transgenen Kaninchens, das zum Exprimieren von Lipoprotein (a) fähig ist, wird das Kaninchen, das Apolipoprotein B trägt und exprimiert, bereitgestellt, indem eine Kaninchenblastomere mit einem Retrovirus infiziert wird, das wenigstens ein humanes DNA-Fragment trägt, welches für Apolipoprotein B-Protein codiert, und das Blastomere in ein weibliches Empfängerkaninchen transferiert wird.

Die vorliegende Erfindung stellt auch ein Verfahren zur Bestimmung, ob eine Verbindung eine Krankheit oder Störung, die mit Lipoprotein (a)-Expression oder -Metabolismus verknüpft ist, inhibieren kann, bereit, umfassend Vergleichen eines ersten transgenen Kaninchens, das fähig ist, humanes Lipoprotein (a) zu produzieren, und eine Krankheit oder Störung zeigt, die mit humanem Lipoprotein (a) verbunden ist, und das mit der Verbindung behandelt worden ist, mit einem zweiten transgenen Kaninchen, das fähig ist, humanes Lipoprotein (a) zu produzieren und eine Krankheit oder Störung zeigt, die mit Lipoprotein (a) verbunden ist, und das nicht mit der Verbindung behandelt worden ist. Die vorliegende Erfindung stellt auch die Verwendung dieses Verfahrens bereit, wobei die Krankheit oder Störung aus der Gruppe ausgewählt ist, bestehend aus Atherosklerose, kardiovaskulärer Erkrankung, Ischämie, Schlaganfall, Restenose, Erkrankung der Koronararterien, peripherer arterieller Verschlusskrankheit, Myokardinfarkt, Thrombose und einem unerwünschten Lipidprofil.

Die vorliegende Erfindung stellt auch ein Verfahren zur Bestimmung, ob eine Verbindung eine Anordnung eines Lipoprotein-(a)-Partikels inhibieren kann, bereit, umfassend Vergleichen des Spiegels der humanen Lipoprotein (a)-Produktion in einem ersten transgenen Kaninchen, das mit der Verbindung behandelt worden ist und das fähig ist, humanes Lipoprotein (a) zu produzieren, mit dem Level der Produktion an humanem Lipoprotein (a) in einem zweiten transgenen Kaninchen, das nicht mit der Verbindung behandelt worden ist und das fähig ist, humanes Lipoprotein (a) zu produzieren. Die vorliegende Erfindung stellt auch die Verwendung dieses Verfahrens bereit, wobei die Verbindung aus der Gruppe, bestehend aus Antisense-Nukleinsäuren und intrazellulären Bindungsproteinen, ausgewählt ist.

Die vorliegende Erfindung stellt transgene Kaninchen, ein geeignetes Tiermodell für durch Lipoprotein (a) vermittelte Krankheiten und Störungen bereit. Die Kaninchen exprimieren die Lipoprotein (a)-Proteine auf hohem Level, um so eine kovalente Assoziierung der Bestandteile unter Produktion physiologisch relevanter Level an Lipoprotein (a) zu erleichtern. Die Kaninchen bieten gegenüber transgenen Mäusen deutliche Vorteile, und zwar teilweise durch die größere Größe des Kaninchens, was Studien einer vaskulären Verletzung und der Restenosierung erleichtert. Obgleich Kaninchen Mäusen bezüglich des Fehlens von Apolipoprotein (a) und Lipoprotein (a) ähnlich sind, ahmt das Lipoproteinprofil des Kaninchens das von Menschen genauer nach, wobei LDL das vorherrschende Plasmaprotein ist. Außerdem entwickeln Kaninchen auch gute charakterisierte Menschen-ähnliche atherosklerotische Läsionen, wenn sie mit cholesterinreicher Nahrung gefüttert werden.

Kurze Beschreibung der Zeichnungen 1. PCR-Analyse von humanem apoB und apo(a) in transgenen Kaninchen

Genomische DNA, die aus "Founder"-Tieren und Nachkommenschaft, welche aus einer Kreuzung von apo(a)- und apoBtransgenen Organismen entstanden war, erhalten worden war, wurde einer Analyse durch Polymerasekettenreaktion (PCR) unterworfen. Das apo(a)-transgene "Founder"-Tier (Probe 2) enthält den vollständigen genomischen apo(a)-Klon, wie es durch Amplifikation mit vier verschiedenen Primersets beurteilt wurde: Plasminogen-5'-Region (PMG-5'), apo(a)-5', apo(a)-3' und apo(a)-artiges Gen-3' (Positionen unterhalb des Diagramms des genomischen Klons angegeben). ApoB-transgene Stammtiere (Probe 1) wurden detektiert, indem eine einzelne PCR-Reaktion, die für humane Sequenzen spezifisch ist, verwendet wurde. Analysen der repräsentativen Nachkommenschaft aus den apo(a)/apoB-Paarungen, die in den Proben 3 und 4 gezeigt sind (apo(a) allein bzw. die Kombination apo(a)/apoB) bestätigten eine Transgentransmission. Für jeden Primersatz war genomischer apo(a)- oder apoB-Klon-DNA als positive Kontrolle enthalten (Probe 5).

2. Gewebeverteilung der apo(a)- und apoB-Transgenexpression

Eine Expression von apo(a) (Teil A) und humanem apoB (Teil B) wurde in den angegebenen Geweben von Kontrollkaninchen (c) und transgenen (tg)-Kaninchen durch reverse Transkriptase-Polymerasekettenreaktions-(RT-PCR)-Analyse analysiert. Als Kontrolle für humane apoB-Spezifität wie auch für die Probenqualität wurde auch Kaninchen-apoB-mRNA amplifiziert, wobei Spezies-spezifische Primer verwendet wurden (Teil C).

3. Zeitlicher Verlauf der apo(a)-Spiegel in transgenen Kaninchen

Von männlichen und weiblichen apo(a)-transgenen Kaninchen wurden zu drei Zeitpunkten nach der Geburt Plasmaproben genommen: 3, 6 und 9 Monate. 1 &mgr;l jeder Probe wurde einer SDS-PAGE unter reduzierten Bedingungen und einem Immunblotting unter Verwendung von Antikörpern, die gegen apo(a) gerichtet waren, unterworfen.

4. Immunblotting von transgenem Kaninchenplasma

Gleiche Voluma Plasma (1 &mgr;l) aus einem humanen apo(a)-transgenen Kaninchen (1), einem humanen apoB/apo(a)-transgenen Kaninchen (2) und einem humanen apoB-transgenen Kaninchen (3) wurden durch SDS-PAGE größenfraktioniert. Gele wurden unter nicht-reduzierenden Bedingungen (Teil A) und unter reduzierenden Bedingungen (Teile B und C) laufen gelassen. Immunblotting wurde unter Verwendung von Antikörpern gegen apo(a) (Teile A und B) und gegen humanes apoB (Teil C) durchgeführt. Humanes Plasma war als Kontrolle enthalten. Die Größen der beobachteten Proteine wurden unter Verwendung einer Migrationskurve aus vorgefärbten Molekulargewichtsstandards vs. Migrationsentfernung beurteilt.

5. Immunblotting von Lipoproteinfraktionen aus transgenen Kaninchen

100 &mgr;l Plasma aus humanen apoB/apo(A)-transgenen Kaninchen (A) oder apo(a)-transgenen Kaninchen (B) wurden durch Chromatographie an einer Superose 6-Säule größenfraktioniert. Elf nummerierte Fraktionen (6–40) wurden einer SDS-PAGE unter nicht-reduzierenden Bedingungen und einem Immunblotting unter Verwendung von Antikörpern gegen apo(a) unterworfen. Lipoprotein-Größenbereiche, bestimmt durch einen Cholesterinassay der Fraktionen, sind in dem Balken zwischen den Teilen A und B angegeben.

6: Proteinsequenzanordnung von humanem und KaninchenapoB

Die Proteinsequenz von Kaninchen-apoB (Reste 4315–4364; SEQ ID NO: 7), angeordnet mit homologen Regionen von humanem (SEQ ID NO: 8)-, Ratten (SEQ ID NO: 9)-, Schweine (SEQ ID NO: 10)- und Hühner (SEQ ID NO: 11)-apoB. Eine Sequenzidentität wird durch Großbuchstaben angegeben. Eine Nummerierung über den Sequenzen entspricht der humanen apoB-Sequenz. Das * bezeichnet die Stelle der apo(a)-Anknüpfung an humanes apoB.

Definitionen

Die folgenden definierten Ausdrücke werden durch die vorliegende Beschreibung hindurch verwendet und sollten beim Verständnis des Rahmens und der Durchführung der Erfindung hilfreich sein.

Ein "Polypeptid" ist eine polymere Verbindung, die aus kovalent verknüpften Aminosäureresten besteht. Aminosäuren haben die folgende Struktur:

Aminosäuren werden auf der Basis der Seitenkette R in sieben Gruppen klassifiziert: (1) aliphatische Seitenketten, (2) Seitenketten, die eine Hydroxyl(OH)-Gruppe enthalten, (3) Seitenketten, die Schwefelatome enthalten, (4) Seitenketten, die eine Säure- oder Amidgruppe enthalten, (5) Seitenketten, die eine basische Gruppe enthalten, (6) Seitenketten, die einen aromatischen Ring enthalten und (7) Prolin, eine Iminosäure, in der die Seitenkette an die Aminogruppe fusioniert ist.

Ein "Protein" ist ein Polypeptid, das in einer lebenden Zelle eine strukturelle oder funktionelle Rolle spielt. Innerhalb der Bedeutung der vorliegenden Erfindung ist die Bezeichnung "Lipoprotein (a)-Komplex" so zu verstehen, dass er die Apolipoproteine (a) und B wie auch Lp(a) und ein beliebiges anderes Protein-artiges bzw. Protein-haltiges Produkt, das Lp(a)-Aktivität hat, abdeckt. Vorzugsweise bezeichnet der Ausdruck "Protein-artiges bzw. Protein-haltiges" Produkt eine Mutante, ein Fragment oder ein Peptid, die/das wenigstens eine biologische Eigenschaft eines Apolipoproteins besitzt, wie auch irgendeine natürliche Variante der Apolipoproteine. Die Polypeptide und Proteine der Erfindung können glycosyliert oder unglycosyliert sein.

Eine "Variante" eines Polypeptids oder eines Proteins kann irgendein Analogon, Fragment, Derivat oder eine Mutante sein, das/die von einem Polypeptid oder Protein abgeleitet ist und das/die wenigstens eine biologische Eigenschaft des Polypeptids oder Proteins beibehält. Verschiedene Varianten des Polypeptids oder Proteins können in der Natur vorkommen. Diese Varianten können allelische Variationen sein, die durch Unterschiede in den Nukleotidsequenzen des Strukturgens, das für das Protein codiert, charakterisiert sein oder können ein differenzielles Spleißen oder eine post-translationale Modifikation beinhalten. Varianten umfassen auch ein verwandtes Protein, das im wesentlichen dieselbe biologische Aktivität hat, aber aus einer anderen Spezies erhalten wird.

Der Fachmann kann Varianten produzieren, die einzelne oder mehrere Aminosäure-Substitutionen, -Deletionen, -Additionen oder -Austausche aufweisen. Diese Varianten können inter alia umfassen: (a) Varianten, in denen ein Aminosäurerest oder mehrere Aminosäurereste mit konservativen oder nichtkonservatigen Aminosäuren substituiert sind, (b) Varianten, in denen eine Aminosäure oder mehrere Aminosäuren an das Polypeptid oder Protein angefügt sind, (c) Varianten, in denen eine Aminosäure oder mehrere Aminosäuren eine Substituentengruppe enthalten, und (d) Varianten, in denen das Polypeptid oder Protein mit einem anderen Polypeptid, z.B. Serumalbumin, fusioniert ist. Die Techniken zur Herstellung dieser Varianten, die genetische (Suppressionen, Deletionen, Mutationen usw.), chemische und enzymatische Techniken beinhalten, sind Personen mit normalem Fachwissen auf diesem Gebiet bekannt.

Wenn solche allelischen Varianten, Analoga, Fragmente, Derivate, Mutanten und Modifikationen, einschließlich alternativer mRNA-Spleißformen und alternativer post-translationaler Modifikationsformen, zu Derivaten des Polypeptids führen, die irgendeine der biologischen Eigenschaften des Polypeptids beibehalten, sollen sie im Rahmen der vorliegenden Erfindung enthalten sein.

Eine "Nukleinsäure" ist eine polymere Verbindung, die aus kovalent verknüpften Untereinheiten, sogenannten Nukleotiden, besteht. Nukleinsäure umfasst Polyribonukleinsäure (RNA) und Polydesoxyribunukleinsäure (DNA), von denen beide einzelsträngig oder doppelsträngig sein können. DNA beinhaltet cDNA, genomische DNA, synthetische DNA und halbsynthetische DNA. Die Sequenz von Nukleotiden, die ein Protein codiert, wird Sense-Sequenz genannt. Ein "apo(a)-Gen" ist ein beliebiges Gen, das für ein Apolipoprotein (a)-Protein codiert. Ein "apoB-Gen" ist ein beliebiges Gen, das für ein Apolipoprotein B-Protein codiert. Bevorzugte apo(a)- und apoB-Gene codieren für humane apo(a)- und apoB-Proteine.

Der hierin verwendete Ausdruck "homolog" bezieht sich in all seinen grammatikalischen Formen und orthografischen Variationen auf die Beziehung zwischen Proteine, die einen "gemeinsamen Evolutationsursprung" besitzen, einschließlich Proteine aus Superfamilien (z.B. die Immunoglobulin-Superfamilie) und homologe Proteine aus verschiedenen Spezies (z.B. leichte Myosinkette usw.) (Reeck et al., 1987, Cell 50:667). Solche Proteine (und ihre codierenden Gene) haben Sequenzhomologie, wie sie durch ihren hohen Grad der Sequenzähnlichkeit wiedergegeben wird.

Dementsprechend bezieht sich der Ausdruck "Sequenzähnlichkeit" in all seinen grammatikalischen Formen auf den Grad der Identität oder der Korrespondenz zwischen Nukleinsäure- oder Aminosäuresequenzen von Proteinen, die einen gemeinsamen Evolutionsursprung haben oder nicht (siehe Reeck et al., supra). Bei der üblichen Verwendung und auch in der vorliegenden Anmeldung kann sich der Ausdruck "homolog", wenn er mit einem Adverb, wie z.B. "in hohem Maße" modifiziert ist, auf Sequenzähnlichkeit und nicht auf einen gemeinsamen Evolutionsursprung beziehen.

In einer spezifischen Ausführungsform sind zwei DNA-Sequenzen "im wesentlichen homolog" oder "im wesentlichen ähnlich bzw.

gleich", wenn wenigstens etwa 50% (vorzugsweise wenigstens etwa 75% und am bevorzugtesten mindestens etwa 90 oder 95%) der Nukleotide über die definierte Länge der DNA-Sequenzen übereinstimmen. Sequenzen, die im wesentlichen homolog sind, können identifiziert werden, indem die Sequenzen unter Anwendung einer Standardsoftware, die in Sequenzdatenbanken verfügbar ist, oder in einem Southern-Hybridisierungs-Experiment unter beispielsweise stringenten Bedingungen, wie sie für das besondere System definiert sind, verglichen werden. Die Definition geeigneter Hybridisierungsbedingungen liegt innerhalb des Fachwissens eines Fachmanns auf diesem Gebiet. Siehe z.B. Maniatis et al., supra; DNA Cloning, Band I und II, supra; Nucleic Acid Hybridization, supra.

Entsprechend sind in einer besonderen Ausführungsform zwei Aminosäuresequenzen "im wesentlichen homolog" oder "im wesentlichen ähnlich bzw. gleich", wenn mehr als etwa 30% der Aminosäuren identisch sind oder mehr als etwa 60% ähnlich (funktionell identisch) sind. Vorzugsweise werden die ähnlichen oder homologen Sequenzen durch Anordnung unter Verwendung z.B. des GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin)-"pileup"-Programm identifiziert.

Der Ausdruck "entsprechend" bzw. "korrespondierend zu" wird hierin verwendet, um ähnliche oder homologe Sequenzen zu bezeichnen, unabhängig davon, ob die exakte Position identisch zu der des Moleküls oder unterschiedlich zu der des Moleküls, an dem die Ähnlichkeit oder Homologie gemessen wird, ist. Eine Nukleinsäure- oder Aminosäuresequenzanordnung kann Abstände enthalten. Somit bezieht sich der Ausdruck "entsprechend" bzw. "korrespondierend zu" auf die Sequenzähnlichkeit und nicht auf die Nummerierung der Aminosäurereste oder Nukleotidbasen.

Die vorliegende Erfindung betrifft transgene Tiere, d.h. Kaninchen, die Gene enthalten, die für Analoga und Derivate von Apolipoproteinen, die dieselbe oder homologe funktionelle Aktivität wie die Apolipoproteine haben, und Homologe davon aus anderen Spezies codieren. Die Produktion und Verwendung von Derivaten und Analoga, die mit Apolipoproteinen in Verbindung stehen, liegen im Rahmen der vorliegenden Erfindung. In einer spezifischen Ausführungsform ist das Derivat oder Analogon funktionell aktiv, d.h. fähig, eine oder mehrere funktionelle Aktivitäten aufzuweisen, die mit einem Volllängen-, Wildtyp-Apolipoprotein der Erfindung in Verbindung stehen. Ein Apolipoproteinderivat der Erfindung ist insbesondere fähig, ein funktionelles humanes Lp(a)-Partikel zu bilden.

Apolipoproteinderivate können hergestellt werden, indem codierende Nukleinsäuresequenzen durch Substitutionen, Additionen oder Deletionen, die für funktionell äquivalente Moleküle sorgen, verändert werden. Vorzugsweise werden Derivate hergestellt, die im Vergleich zu nativen Apolipoproteinen, d.h. apo(a) und apoB, eine verstärke oder erhöhte funktionelle Aktivität haben. Der Ausdruck "Apolipoprotein", wie er hier verwendet wird, bezieht sich auf apo(a) oder apoB.

Aufgrund der Degeneriertheit codierender Nukleotidsequenzen können andere DNA-Sequenzen, die im wesentlichen dieselbe Aminosäuresequenz codieren, als Apolipoproteingen bei der Durchführung der vorliegenden Erfindung eingesetzt werden. Diese umfassen, sind aber nicht beschränkt auf, allele Gene, homologe Gene aus anderen Spezies und Nukleotidsequenzen, die alle Apolipoproteingene oder Teile davon umfassen, welche durch Substitution verschiedener Codon, die für denselben Aminosäurerest innerhalb einer Sequenz codieren, verändert sind, wodurch eine stumme Veränderung erzeugt wird. In ähnlicher Weise umfassen die Apolipoproteinderivate der Erfindung, sind aber nicht beschränkt auf, solche, die als primäre Aminosäuresequenz die Aminosäuresequenz eines Apolipoproteins ganz oder teilweise umfassen, wobei diese veränderte Sequenzen enthält, in denen funktionell äquivalente Aminosäurereste für Reste innerhalb der Sequenz eingesetzt sind, was zu einer konservativen Aminosäuresubstitution führt. Beispielsweise kann ein Aminosäurerest oder können mehrere Aminosäurereste innerhalb der Sequenz durch eine andere Aminosäure ähnlicher Polarität ersetzt sein, welche als funktionelles Äquivalent wirkt, was zu einer stummen Veränderung führt. Austausche für eine Aminosäure innerhalb der Sequenz können aus anderen Gliedern der Klasse, zu der der Aminosäure gehört, ausgewählt sein. Beispielsweise umfassen die nicht-polaren (hydrophoben) Aminosäuren Alanin, Leucin, Isoleucin, Valin, Prolin, Phenylalanin, Tryptophan und Methionin. Aminosäuren, die aromatische Ringstrukturen enthalten, sind Phenylalanin, Tryptophan und Tyrosin. Die polaren neutralen Aminosäuren umfassen Glycin, Serin, Threonin, Cystein, Tyrosin, Asparagin und Glutamin. Die positiv geladenen (basischen) Aminosäuren umfassen Arginin, Lysin und Histidin. Die negativ geladenen (sauren) Aminosäuren umfassen Asparaginsäure und Glutaminsäure. Solche Säuren umfassen Asparaginsäure und Glutaminsäure. Es wird nicht erwartet, dass solche Veränderungen das scheinbare Molekulargewicht, wie es durch Polyacrylamidgelelektrophorese bestimmt wird, oder den isoelektrischen Punkt beeinflussen. Besonders bevorzugte Substitutionen sind:

  • – Lys für Arg und umgekehrt, so dass eine positive Ladung aufrechterhalten werden kann;
  • – Glu für Asp und umgekehrt, so dass eine negative Ladung aufrechterhalten werden kann;
  • – Ser für Thr, so dass ein freies -OH aufrechterhalten werden kann; und
  • – Gln für Asn, so dass ein freies CONH2 aufrechterhalten werden kann.

Aminosäuresubstitutionen können auch eingeführt werden, um eine Aminosäure mit einer besonders vorteilhaften Eigenschaft einzusetzen. Beispielsweise kann ein Cys als potentielle Stelle für Disulfidbrücken mit einem anderen Cys eingeführt werden. Ein His kann als eine besonders "katalytische" Stelle eingeführt werden (d.h. His kann als Säure oder Base wirken und ist in der biochemischen Katalyse die gängigste Aminosäure). Pro kann wegen seiner besonders planaren Struktur eingeführt werden, welche &bgr;-Turns in der Proteinstruktur induziert.

Die Gene, die für Apolipoproteinderivate und Analoga der Erfindung codieren, können durch verschiedene Verfahren, die auf dem Fachgebiet bekannt sind, produziert werden. Die Manipulationen, die zu ihrer Produktion führen, können auf dem Gen- oder Proteinlevel auftreten. Beispielsweise kann die klonierte Apolipoproteingensequenz durch irgendeine von zahlreichen Strategien, die auf dem Fachgebiet bekannt sind, modifiziert werden (Sambrook et al., 1989, supra). Die Sequenz kann an geeigneten Stellen mit Restriktionsendonuklease(n) gespalten werden, worauf sich eine weitere enzymatische Modifizierung anschließt, wenn es gewünscht wird, eine Isolierung und in vitro-Ligation erfolgen. Bei der Herstellung des Gens, das ein Derivat oder ein Analogon eines Apolipoproteins codiert, sollte darauf geachtet werden, dass sichergestellt ist, dass das modifizierte Gen innerhalb desselben translationalen Leserasters wie das native Apolipoproteingen bleibt, nicht durch translationale Stoppsignale unterbrochen in der Genregion ist, in der die gewünschte Aktivität codiert wird.

Zusätzlich kann die zur Apolipoprotein codierende Nukleinsäuresequenz in vitro oder in vivo mutiert werden, um Translations-, Initiations- und/oder Terminationssequenzen zu schaffen und/oder zu zerstören, oder um Variationen in codierenden Regionen zu schaffen und/oder neue Restriktionsendonukleasestellen zu dulden oder vorher existierende zu zerstören, um eine in vitro-Modifizierung weiter zu erleichtern. Vorzugsweise verstärken solche Mutationen die funktionelle Aktivität des mutierten Apolipoproteingenprodukts. Es kann eine beliebige Technik zur Mutagenese, die auf dem Fachgebiet bekannt ist, eingesetzt werden, einschließlich, aber nicht beschränkt auf, ortsspezifische in vitro-Mutagenese (C. Hutchinson et al, 1978, J. Biol. Chem. 253:6551; Zoller und Smith, 1984, DNA 3: 479–488; Oliphant et al., 1986, Gene 44: 177; Hutchinson et al., 1986, Proc. Natl. Acad. Sci. USA, 83: 710), Verwendung von TAB"-Linkern (Pharmacia) usw. Zur ortsspezifischen Mutagenese sind PCR-Techniken bevorzugt (siehe Higuchi 1989, "Using PCR to Engineer DNA" in PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, Herausg., Stockton Press, Kapitel 6, S. 61–70).

Im allgemeinen sind die Nukleinsäuren der vorliegenden Erfindung mit einer oder mehreren regulatorischen Regionen verknüpft. Eine Selektion der geeigneten regulatorischen Region oder der geeigneten regulatorischen Regionen ist im Rahmen der Aufgaben eines Fachmanns Routinearbeit. "Regulatorische Region" meint eine Nukleinsäuresequenz, die die Expression einer zweiten Nukleinsäuresequenz reguliert. Eine regulatorische Region kann Sequenzen umfassen, die natürlicherweise für das Exprimieren einer besonderen Nukleinsäure (einer homologen Region) verantwortlich sind, oder kann Sequenzen eines anderen Ursprungs enthalten (verantwortlich für die Expression unterschiedlicher Proteine oder sogar synthetischer Proteine). Die Sequenzen können insbesondere Sequenzen von eukaryotischen oder viralen Genen oder abgeleitete Sequenzen, die eine Transkription eines Gens in spezifischer oder nichtspezifischer Weise und in induzierbarer oder nichtinduzierbarer Weise stimulieren oder unterdrücken, sein. Regulatorische Regionen umfassen Replikationsursprünge, RNA-Spleißstellen, Verstärker, Transkriptionsterminationssequenzen, Signalsequenzen, die das Polypeptid in die Sekretionswege der Zielzellen lenkt, und Promotoren.

Die regulatorischen Regionen können eine Promotorregion zur funktionellen Transkription in Endothelialzellen, Leber, Testis, Gehirn oder anderen Zelltypen, in denen eine apo(a)- und apoB-Expression erwünscht ist, wie auch eine Region in 3' des Gens von Interesse, die ein Signal zur Termination und Transkription spezifiziert, und eine Polyadenylierungsstelle umfassen. Alle diese Elemente bilden eine Expressionskassette.

"Promotoren", die in der vorliegenden Erfindung eingesetzt werden können, umfassen sowohl konstitutive Promoten als auch regulierte (induzierbare) Promotoren. Der Promotor kann natürlicherweise für die Expression der Nukleinsäure verantwortlich sein. Er kann auch aus einer heterologen Quelle stammen. Es kann sich insbesondere um Promotorsequenzen handeln, die aus dem Genom der Zelle stammen, die infiziert werden soll. Entsprechend können es Promotorsequenzen sein, die aus dem Genom eines Virus, einschließlich des verwendeten Adenovirus, abgeleitet sind. Diesbezüglich können z.B. die Promotoren der E1A-, MLP-, CMV- und RSV-Gene und dergleichen genannt werden. Die nicht-viralen Promotorsequenzen, die vorzugsweise verwendet werden, sind die ApoAI-Promotoren oder die hepatischen Enhancer von ApoE oder die intestinalen Enhancer von apoCIII. Diese Expressionssequenzen können natürlicher Weise zusätzlich modifiziert werden, indem aktivierende Sequenzen, regulatorische Sequenzen usw. angefügt werden. Die genomische DNA kann auch in einem Expressionsvektor großer Kapazität, z.B. in dem P1-Vektor oder auch in den YAC-, Cosmid- oder Plasmidvektoren enthalten sein.

Außerdem kann der Promotor durch Addition von aktivierenden oder regulatorischen Sequenzen oder Sequenzen, die eine gewebespezifische oder vorwiegende Expression ermöglichen, modifiziert sein (Enolase- und GFAP-Promotoren und dgl.). Wenn darüber hinaus die Nukleinsäure keine Promotorsequenzen enthält, kann sie z.B. in das Virusgenom stromabwärts einer solchen Sequenz insertiert werden.

Einige Promotoren, die zur Durchführung der vorliegenden Erfindung einsetzbar sind, sind ubiquitäre Promotoren (z.B. HPRT, Vimentin, Actin, Tubulin), intermediäre Filamentpromotoren (z.B. Desmin, Neurofilamente, Keratin, GFAP), therapeutische Genpromotoren (z.B. MDR-Typ, CFTR, Faktor VIII), gewebespezifische Promotoren (z.B. Actinpromotor in Zellen des glatten Muskels), Promotoren, die vorzugsweise in sich teilenden Zellen aktiviert werden, Promotoren, die auf einen Stimulus reagieren (z.B. Steroidhormonrezeptor, Retinsäurerezeptor), Tetracyclin-regulierte transkriptionale Modulatoren, immediate-early retrovirale LTR des Cytomegalovirus, Metallothionein, SV-40, E1a- und MLP-Promotoren. Tetracyclinregulierte transkriptionale Modulatoren und CMV-Promotoren sind in WO 96/01313, US 5 168 062 und 5 385 839 beschrieben.

Eine regulatorische Region aus einer "heterologen Quelle" ist eine regulatorische Region, die natürlicherweise mit der exprimierten Nukleinsäure assoziiert ist. Unter den heterologen regulatorischen Regionen sind regulatorische Regionen aus einer unterschiedlichen Spezies, regulatorische Regionen aus einem anderen Gen, regulatorische Hybridsequenzen und regulatorische Sequenzen, die in der Natur nicht auftreten, die aber von einem Fachmann entwickelt werden, eingeschlossen.

Ein "Vektor" ist ein Mittel für den Transfer einer Nukleinsäure gemäß der Erfindung in eine Wirtszelle. Der Ausdruck "Vektor" beinhaltet sowohl virale als auch nicht-virale Mittel für eine Einführung der Nukleinsäure in vitro, ex vivo oder in vivo in eine Zelle. Nicht-virale Vektoren umfassen Plasmide, Phagemide, BAC, PAC, YAC, P1, Liposome, elektrisch geladene Lipide (Cytofectine), DNA-Protein-Komplexe und Biopolymere. Die Vektoren, die eine Nukleinsäure gemäß der Erfindung enthalten, können Plasmid-, Phagemid-, P1-, BAC-, PAC-, YAC- oder Cosmid-Vektoren sein. Die Vektoren, die für die Erfindung von besonderem Interesse sind, umfassen die, die fähig sind, große DNA-Sequenzen unterzubringen (d.h. Phagemide, Plasmide, P1-, BAC-, PAC-, YAC- oder Cosmidvektoren), speziell im Fall von genomischen DNA-Sequenzen, die die Erfindung betreffen. Zusätzlich zu einer erfindungsgemäßen Nukleinsäure kann ein Vektor auch eine regulatorische Region oder mehrere regulatorische Regionen und/oder selektierbare Marker, die beim Selektieren, Messen und Überwachen von Nukleinsäuretransferresultaten nützlich sind (Transfer auf welche Gewebe, Dauer der Expression usw.) enthalten.

"Lipidprofil" bezeichnet einen Satz von Konzentrationen an Cholesterin, Triglycerid, Lipoproteincholesterin und anderen Lipiden im Körper eines Menschen oder eines anderen Tiers.

Ein "unerwünschtes Lipidprofil" ist der Zustand, bei dem die Konzentrationen an Cholesterin, Triglycerid oder Lipoproteincholesterin außerhalb der Alters- und Geschlechtsspezifischen Referenzbereiche liegen. Im allgemeinen wird eine Konzentration an Gesamtcholesterin > 200 mg/dl, von Plasmatriglyceriden > 200 mg/dl, an LDL-Cholesterin > 130 mg/dl, an HDL-Cholesterin < 39 mg/dl oder ein Verhältnis von Gesamtcholesterin zu HDL-Cholesterin > 4,0 als unerwünschtes Lipidprofil angesehen. Ein unerwünschtes Lipidprofil ist mit einer Vielzahl von pathologischen Zuständen, einschließlich Hyperlipidämien, Diabetes, Hypercholesterinämie, Atherosklerose und anderen Formen koronarer Arterienerkrankung, verbunden.

Die Herabregulierung der Genexpression unter Verwendung von Antisense-Nukleinsäure kann auf dem Translations- oder Transkriptionslevel erreicht werden. Antisense-Nukleinsäuren der Erfindung sind vorzugsweise Nukleinsäurefragmente, die fähig sind, spezifisch mit einer Nukleinsäure, die für Apolipoprotein (a) oder B codiert, oder den entsprechenden Messenger-RNAs zu hybridisieren. Diese Antisense-Nukleinsäuren können synthetische Oligonukleotide sein, die gegebenenfalls modifiziert sind, um ihre Stabilität und Selektivität zu verbessern. Sie können DNA-Sequenzen sein, deren Expression in der Zelle RNA produziert, die zu der gesamten mRNA oder einem Teil der RNA, die für das Apolipoprotein (a) oder B codiert, komplementär ist. Antisense-Nukleinsäuren können durch Expression der gesamten Nukleinsäure oder eines Teils davon, die für Apolipoprotein (a) oder B codiert, in entgegengesetzter Richtung, wie es in EP 0 140 308 beschrieben ist, hergestellt werden. Eine beliebige Länge einer Antisense-Sequenz ist zur Durchführung der Erfindung geeignet, solange sie fähig ist, eine Expression von Apolipoprotein (a) oder B herabzuregulieren oder zu blockieren. Vorzugsweise hat die Antisense-Sequenz eine Länge von mindestens 20 Nukleotiden. Die Herstellung und Verwendung von Antisense-Nukleinsäuren, DNA, die für Antisense-RNAs codiert, und die Verwendung von Oligo- und genetischem Antisense ist in WO 92/15680 offenbart.

Der Ausdruck "pharmazeutisch annehmbarer Träger" umfasst Verdünnungsmittel und Füllstoffe, die pharmazeutisch für Verabreichungsverfahren annehmbar sind, steril sind und die wässrige oder ölige Suspensionen sein können, die unter Verwendung geeigneter Dispergier- oder Netzmittel und Suspendiermittel formuliert sind. Der besondere pharmazeutisch annehmbare Träger und das Verhältnis von aktiver Verbindung zu Träger werden durch die Löslichkeits- und chemischen Eigenschaften der Zusammensetzung, den besonderen Verabreichungsmodus und die pharmazeutische Standardpraxis bestimmt.

Der Ausdruck "physiologischer Level" bzw. "physiologischer Spiegel" wird hierin verwendet, um einen Level der Proteinexpression bzw. einen Grad der Proteinexpression oder der Lp(a)-Produktion zu bezeichnen, der zu einem transgenen Tier führt, das ein Lipoproteinprofil besitzt, das das von Menschen eng nachahmt. Das transgene Tier ist insbesondere fähig, gut charakterisierte Menschen-artige atherosklerotische Läsionen zu entwickeln, wenn es mit einer Cholesterin-reichen Nahrung gefüttert wird. In einer spezifischen Ausführungsform ist der Level von Lp(a) im transgenen Tier in dem Bereich, der beim Menschen gefunden wird.

Die Ausdrücke "transgene Tiere" und "Tier" wird hier verwendet, um alle Vertenbrate-Tiere, ausgenommen Menschen, zu umfassen. Der Ausdruck umfasst auch ein einzelnes Tier in allen Entwicklungsstufen, einschließlich embryonalen und fötalen Stufen. Ein "transgenes Tier" ist ein Tier, das eine Zelle oder mehrere Zellen enthält, die genetische Informationen tragen, die sie direkt oder indirekt durch absichtliche genetische Manipulation auf subzellulärem Level, wie z.B. durch Mikroinjektion oder Infektion mit rekombinantem Virus, erhalten haben. Das eingeführte DNA-Molekül kann in einem Chromosom integriert sein oder es kann extra-chromosomal replizierende DNA sein. Der Ausdruck "Keimzelllinien-transgenes Tier" bezieht sich auf ein transgenes Tier, in dem genetische Information in eine Keimzelllinie eingeführt worden war, wodurch die Fähigkeit verliehen wurde, die Information auf Nachkommenschaft zu übertragen, verliehen wird. Wenn eine solche Nachkommenschaft tatsächlich einige Informationen oder die gesamte Information besitzt, dann sind sie ebenfalls transgene Tiere.

Detaillierte Beschreibung der Erfindung

Wie oben definiert wurde, besteht auf dem Fachgebiet ein Bedarf für ein geeignetes Tiermodell für Lp(a)-vermittelte Krankheiten und Störungen. Es ist insbesondere wichtig, ein experimentelles Modell für die in vivo-Analyse von humanem Lipoprotein (a) bereitzustellen. Die Anmelder haben erstmals auf dem Fachgebiet transgene Kaninchen erhalten, die fähig sind, Lipoprotein (a) bereitzustellen.

Transgene Kaninchen stellen einen in steigendem Maße verwendeten Ansatz für die Untersuchung von Apolipoproteinen und ihren Einfluss auf den Lipoprotein-Metabolismus und die Atherogenese dar (Fan et al., Arterioscler. Thromb. Vasc. Biol. (1995) 15, 1889–1899; Duverger et al., Arterioscler. Thromb. Vasc. Biol. (1996) 16, 1424–1429). Die Vorteile dieses Tiers im Vergleich zur Maus beziehen sich teilweise auf seine relativ größere Größe, was einfache Studien der Gefäßverletzung und Restenosierung möglich macht. Während Kaninchen Mäusen bezüglich des Fehlens von apo(a) und Lp(a) ähnlich sind, ahmt ihr Lipoproteinprofil außerdem das von Menschen mit LDL als vorherrschendes Plasmalipoprotein genauer nach (M.J. Chapman in Methods in Enzymology, Bd. 128: Plasma Lipoproteins, Teil A, Preparation, Structure and Molecular Biology, J.P. Segrest & J.J. Albers, Herausg. (Academic Press, Inc., New York, 1986), Bd. 128, S. 70–143). Kaninchen entwickeln auch gut charakterisierte Menschen-artige atherosklerotische Läsionen, wenn sie mit einer Cholesterin-reichen Nahrung gefüttert werden.

Im Rahmen der vorliegenden Erfindung hat sich das Kaninchen als das geeignete Tiermodell erwiesen. Es existiert ein umfangreiches Wissen über den Metabolismus des Kaninchens und über Krankheiten dieses Tiers, die mit Lipoproteinen verbunden sind. Das Kaninchen ist ein Tier, das als "LDL-Säuger" klassifiziert ist, d.h, die LDLs sind die Haupttransporteure von Plasmacholesterin wie beim Menschen, im Gegensatz zu Ratten und Mäusen, die Tiere sind, die als "HDL-"Säuger" klassifiziert werden. Darüber hinaus gibt es eine ganze Reihe von genetischen Variationen in den Lipoproteinen innerhalb der Kaninchenlinien, z.B. die WHHL-Kaninchen, die bezüglich des LDL-Rezeptors defizient sind (vererbbar hyperlipidämische Watanabe-Kaninchen) oder auch die "St Thomas Hospital"-Kaninchen, die LDLs überproduzieren (Rosenfeld et al., 1990, Arteriosclerosis 10, 680–687; Sedon et al., 1987, Arteriosclerosis 7, 113–124).

Die vorliegende Erfindung stellt ein neues, relativ großes Tiermodell zur Untersuchung der biologischen Eigenschaften von Lp(a) in Form eines Kaninchens bereit, das humane genomische Transgene für apo(a) oder apoB enthält. Die Kaninchen zeigen eine effiziente, gewebespezifische Expression von beiden humanen Transgenen und den Aufbau von Lp(a)-Partikeln. Außerdem wechselwirkt apo(a) kovalent in vivo mit KaninchenapoB und das transgene Kaninchenmodell stellt ein Mittel dar, um diese neue Wechselwirkung zu charakterisieren. Die Anmelder haben ein transgenes Kaninchen hergestellt, in dessen Genom exogene genomische DNA-Sequenzen insertiert worden waren, die für Apolipoprotein (a)- und Apolipoprotein B-Proteine codieren, die einen Lipoprotein (a)-Komplex bilden.

Zusätzlich zur Bereitstellung einzigartiger Einsichten in den Lp(a)-Aufbau und in die apo(a)-Expression stellen mehrere Merkmale der Lp(a)-transgenen Kaninchen, die durch die vorliegende Erfindung bereitgestellt werden, Verbesserungen gegen derzeit verfügbaren Tiermodellen zur Untersuchung von Lp(a) dar. Diese Tiere besitzen ein Lipoproteinprofil, das das von Menschen sehr eng nachahmt, und sie entwickeln gut charakterisierte Menschen-artige atherosklerotische Läsionen, wenn sie mit einer Cholesterin-reichen Nahrung gefüttert werden. Infolge ihrer relativ großen Größe wurden sie auch erfolgreich in Studien der vaskulären Verletzung und Restenosierung eingesetzt. So werden diese transgenen Kaninchen eine wertvolle Resource darstellen, um Faktoren zu untersuchen, die Lp(a)-Level beeinflussen, und auch um die Effekte von Lp(a) auf das Fortschreiten von Atherosklerose und vaskulären Erkrankungen zu untersuchen.

Zur Herstellung eines transgenen Tiers der Erfindung kann ein beliebiges Kaninchen verwendet werden. Vorzugsweise ist das Kaninchen ein homogener Laborstamm, der von einer beliebigen Tierquelle, z.B. Charles River oder Jackson Laboratories (Bar Harbor, Maine) erhalten werden kann. In einer spezifischen Ausführungsform unten ist das Kaninchen ein weißes Neuseeland-Kaninchen ("New Zealand White rabbit"). Alternativ kann ein transgenes hyperlipidämisches Watanabe-Kaninchen der Erfindung erzeugt werden.

Ein bevorzugtes Verfahren zur Schaffung eines transgenen Kaninchens umfasst Injizieren exogener genomischer DNA-Sequenzen, die für apo(a)- oder apoB-Proteine codieren, die einen Lipoprotein (a)-Komplex bilden, in einen Kaninchenembryo, Transferieren des Embryos auf ein Empfängerkaninchen und nach der Geburt Untersuchen auf Vorliegen der genomischen DNA-Sequenzen im Genom der neugeborenen Kaninchen. Apo(a)-transgene Kaninchen und apoB-transgene Kaninchen werden dann gepaart, um das apo(a)-apoB-transgene Kaninchen zu erzeugen, das Lp(a) exprimiert.

Das Verfahren zur Schaffung eines transgenen Kaninchens ist im Beispiel 2 unten näher beschrieben. Die Durchführung eines solchen Verfahrens bereitet dem Fachmann, der mit den Techniken der Mikroinjektion und der Entfernung und Implantierung von Embroys wie auch der Tierhaltung vertraut ist, keine Schwierigkeiten.

Die vorliegende Erfindung bezieht sich insbesondere auf die Verwendung eines künstlichen Hefechromosom-(YAC)-Klons mit 270 kb, der das humane apo(a)-Gen enthält und auf die Verwendung eines P1-Phagemid-Klons mit 90 kb, der das humane apoB-Gen enthält, um ein transgenes Kaninchen zu schaffen, das beide Transgene exprimiert. Das transgene Kaninchen der vorliegenden Erfindung weist eine Gewebe-spezifische Expression beider Transgene auf, die vornehmlich in der Leber lokalisiert ist. Im Gegensatz zu den Beobachtungen bei apo(a)-transgenen Mäusen führt die vorliegende Erfindung zu apo(a)-Plasmaspiegeln, die während der Geschlechtsreife der Kaninchen stabil sind. Außerdem ist apo(a) fähig, eine kovalente Verbindung mit dem endogenen Kaninchen-apoB zu bilden, wenn auch mit einer niedrigeren Effizienz als seine Verbindung mit humanem apoB. Die Erfindung dieses Lp(a)-transgenen Kaninchenmodells liefert neue Einsichten in die strukturellen Erfordernisse für einen Lp(a)-Zusammenbau und die Regulierung der apo(a)-Expression. Außerdem stellen diese transgenen Kaninchen ein neues experimentelles Modell für die in vivo-Analyse von Lp(a) und die Entwicklung von therapeutischen Strategien zur Verringerung der Atherosklerosegefahr, die mit hohen Leveln dieses Lipoproteins verbunden ist, dar.

Folglich stellt die vorliegende Erfindung ein transgenes Kaninchen bereit, das das apo(a)- und apoB-Gen beide oder Varianten davon umfasste das Kaninchen ist fähig, diese Gene zu exprimieren, so dass ein Lipoprotein (a)-Komplex gebildet wird.

Die genetische Information, die in den transgenen Kaninchen vorhanden ist, kann für die Tierspezies, zu der der Empfänger gehört, fremd sein (d.h. exogen), fremd sein (d.h. exogen), nur für den besonderen einzelnen Empfänger fremd sein (d.h. exogen), oder die genetische Information wird bereits vom Empfänger besessen. Im zuletzt genannten Fall kann das eingeführte Gen im Vergleich zu dem nativen endogenen Gen unterschiedlich exprimiert werden.

Die Gene können erhalten werden, indem sie aus genomischen Quellen isoliert werden, sie können durch Herstellung von cDNAs aus isolierten RNA-Matrizen erhalten werden, sie können durch direkte Synthese oder durch eine Kombination davon erhalten werden. In einer bevorzugten Ausführungsform der Erfindung werden die humanen apo(a)- und apoB-Gene aus genomischer DNA geklont, so dass die Expression der Transgene in geeigneter Weise reguliert wird und von der Integrationsstelle in die chromosomale DNA des transgenen Tiers unabhängig ist.

Ein transgenes Kaninchen gemäß der Erfindung kann die genomischen DNA-Sequenzen in alle seine Zellen oder nur in seinen bestimmten prozentualen Anteil an Zellen integrieren; im letztgenannten Fall würde dies Mosaik genannt. Im allgemeinen werden die genomischen DNA-Sequenzen in alle Zellen integriert. Die insertierten genomischen DNA-Sequenzen gemäß der Erfindung codieren alle Proteine oder einen aktiven Teil der Proteine, die bei der Lipoprotein (a)-Komplexbildung und/oder dem Metabolismus desselben involviert sind. Diese genomischen DNA-Sequenzen können auch verschiedene Gene enthalten, die, wenn es notwendig ist, in Clusterform organisiert sind.

Solche insertierten DNA-Sequenzen innerhalb der Bedeutung der vorliegenden Erfindung, die spezifischer genannt werden, sind die Gene, die die ganzen Apolipoproteine (a), B oder eine Variante oder ein Derivat dieser Lipoproteine, die einen Lp(a)-Komplex bilden, oder einen Teil davon codieren.

Um exprimiert zu werden, sollte ein Gen funktionell an eine regulatorische Region gebunden sein. Regulatorische Regionen, z.B. Promotoren, können verwendet werden, um die Expression eines Gens zu verstärken, zu verringern, zu regulieren oder für bestimmte Gewebe oder bestimmte Entwicklungsstufen zu bestimmen. Der Promotor muss kein natürlich auftretender Promotor sein. Die "transgenen, nicht-menschlichen Tiere" der Erfindung werden produziert, indem "Transgene" in die Keimzelllinie eines nicht-menschlichen Tiers eingeführt werden. Die Verfahren, die die Einführung von DNA in Zellen ermöglichen, sind auf dem Fachgebiet allgemein verfügbar und gut bekannt. Es können verschiedene Verfahren zur Einführung von Transgenen verwendet werden. Im allgemeinen ist die Zygote das bevorzugte Ziel zur Mikroinjektion. Die Verwendung von Zygoten als Ziel für einen Gentransfer hat einen Hauptvorteil. In den meisten Zellen wird die injizierte DNA vor der ersten Spaltung in das Wirtsgen eingebaut (Brinster et al.(1985) Proc. Natl. Acad. Sci., USA 82, 4438–4442). Folglich werden nahezu alle Zellen des transgenen nicht-menschlichen Tiers das eingebaute Transgen tragen. Im allgemeinen wird dies auch zu der effizienten Transmission des Transgens auf die Nachkommenschaft des "Founder" führen, da 50% der Keimzellen das Transgen tragen werden. Die Mikroinjektion von Zygoten ist ein bevorzugtes Verfahren zum Einbau von Transgenen bei der Durchführung der Erfindung.

Zur Einführung eines Transgens in ein nicht-menschliches Tier kann auch eine retrovirale Infektion verwendet werden. Der sich entwickelnde nicht-humane Embryo kann in vitro zur Blastocystenstufe kultiviert werden. Während dieser Zeit können Elastomere Ziele für die retrovirale Infektion sein (R. Jaenich (1976), Proc. Natl. Acad. Sci., USA 73, 1260–1264). Eine effiziente Infektion der Blastomeren wird durch enzymtische Behandlung unter Entfernung der Zona pellucida erhalten (Hogan et al. (1986) in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

Das virale Vektorsystem, das zur Einführung des Transgens verwendet wird, ist typischerweise ein Replikationsdefektives Retrovirus, das das Transgen trägt (Jahner et al. (1985), Proc. Natl. Acad. Sci. USA 82, 6927–6931; Van der Putten et al. (1985), Proc. Natl. Acad. Sci USA 82, 6148–6152). Eine Transfektion wird effizient und einfach durch Kultivieren der Blastomere auf einer Monolayer aus Virusproduzierenden Zellen erhalten (Van der Putten et al. (1985), Proc. Natl. Acad. Sci. USA 82, 6148–6152; Stewart et al. (1987) EMBO J. 6: 383–388). Alternativ kann eine Infektion zu einem späteren Stadium durchgeführt werden. Virus oder Virusproduzierende Zellen können in die Blastocoele injiziert werden (Jahner et al. (1982), Nature 298: 623–628). Die meisten der "Founder"-Tiere werden für das Transgen ein Mosaik sein, da ein Einbau nur in einem Untersatz der Zellen, die das transgene nicht-menschliche Tier bilden, erfolgt. Darüber hinaus kann das Founder-Tier retrovirale Insertionen des Transgens an einer Vielzahl von Positionen im Genom enthalten; diese spalten sich im allgemeinen in der Nachkommenschaft. Außerdem ist es auch möglich, Transgene in die Keimzelllinie einzuführen, jedoch mit geringer Wirksamkeit, durch intrauterine retrovirale Infektion des "Midgestation"-Embryos (Jahner et al. (1982) Nature 298: 623–628) einzuführen.

Ein dritter Typ an Zielzellen zur transgenen Einführung ist die embryonale Stammzelle (ES). ES-Zellen werden vor Implatation von Embryos, die in vitro kultiviert worden waren, erhalten (M.J. Evans et al. (1981), Nature 292, 154–156; A. Bradley et al. (1984), Nature 309, 255–258; Gossler et al. (1986), Proc. Natl. Acad. Sci USA 83, 9065–9060; und Robertson et al. (1986), Nature 322, 445–448). Transgene können durch DNA-Transfektion oder durch Retrovirus-vermittelte Transduktion effizient in ES-Zellen eingeführt werden. Die resultierenden transformierten ES-Zellen können danach mit Blastocyten aus einem nicht-menschlichen Tier kombiniert werden. Die ES-Zellen kolonisieren den Embryo und tragen zu der Keimzelllinie des resultierenden chimären Tiers bei (für eine Übersicht siehe R. Jaenisch (1988), Science 240, 1468–1474).

Die Verfahren zur Beurteilung des Vorliegens der eingeführten DNA wie auch ihre Expression sind auf dem Fachgebiet bereits verfügbar und gut bekannt. Solche Verfahren umfassen, sind aber nicht beschränkt auf, DNA (Southern)-Hybridisierung, um die exogene DNA zu detektieren, Polymerasekettenreaktion (PCR), Polyacrylamidgelelektrophorese (PAGE) und Western Blots, um DNA, RNA und Protein zu detektieren.

Kaninchen, die Sequenzen, welches für humanes Apolipoprotein (a) codieren, einschließlich ihrer Keimzelllinien-DNA, besitzen, werden mit Kaninchen gepaart, die humanes Apolipoprotein B in ihrer genomischen DNA, einschließlich ihrer Keimzelllinien-DNA, besitzen. In einer spezifischen Ausführungsform kann ein transgenes Kaninchen, das apoB exprimiert, mit einem transgenen Kaninchen, das physiologische Level an apo(a) exprimiert, gepaart werden, wie es in WO 95/25793 und erteilter US-Patentanmeldung Nr. 08/704,582, nun US-Patent Nr. 5,792,902, erteilt am 11.08.1998, beschrieben ist.

Die resultierende Nachkommenschaft wird durchgemustert, um solche Kaninchen zu identifizieren, die Apolipoprotein (a) und Apolipoprotein B exprimieren, so dass Lipoprotein (a) produziert wird.

Der Ausdruck "transgen", wie er hier verwendet wird, ist eine DNA-Sequenz, die in die Keimbahn eines nicht menschlichen Tiers durch menschliche Intervention eingeführt wird, z.B. wie in den unten beschriebenen Beispielen.

Nukleinsäuren

Transgene Tiere gemäß der Erfindung umfassen Nukleinsäuresequenzen, die Gene umfassen, welche für apo(a) und apoB oder Varianten davon, und sind fähig, diese Gene unter Bildung eines Lipoprotein (a)-Komplexes zu exprimieren. Die Nukleinsäure kann natürlichen oder künstlichen Ursprungs sein. Sie kann genomische DNA (gDNA), komplementäre DNA (cDNA), Hybridsequenzen oder synthetische oder halbsynthetische Sequenzen sein. Sie kann menschlichen, tierischen, pflanzlichen, bakteriellen oder viralen Ursprungs und dgl. sein. Sie kann durch eine beliebige Technik, die den Fachleuten auf diesem Gebiet bekannt ist, erhalten werden, und zwar speziell durch Durchmustern von Bibliotheken, durch chemische Synthese oder al-ternativ durch gemischte Verfahren, einschließlich chemischer oder enzymatischer Modifikation von Sequenzen, die durch Durchmustern von Bibliotheken erhalten werden. Sie ist vorzugsweise cDNA oder gDNA.

Ein YAC-Klon, der das humane apo(a)-Gen enthält (Klon 366H2 in der CEPH-Bibliothek) wurde bereits früher beschrieben (K.A. Frazer, G. Narla, J.L. Zhang & E.M. Rubin, Nat. Gen (1995), 9, 424–341). Um das humane apo(a)-Gen zu isolieren, kann der YAC durch Pulsfeld-Gelelektrophorese von den Hefenchromosomen abgetrennt werden. Die Bande, die den YAC enthält, wird dann aus SeaPlaque-GTG-Agarose (RMC, Rockland, MD) ausgeschnitten, mit beta-Agarose (NEB, Beverley, MA) behandelt und gegen 0,1 M NaCl, 10 mM Tris, 0,1 mM EDTA dialysiert (L.B. Couto, E.A. Spangler & E.M. Rubin, Nuc. Acid Res. (1989) 17 (19), 8010).

Ein 90 kb P1-Phagemid, das das humane apoB-Gen enthält, wurde bereits früher beschrieben (Callow et al., Proc. Natl. Acad. Sci. USA (1994) 91, 2130–2136). Alternativ kann ein DNA-Fragment, das die Nukleinsäuresequenz enthält, welche für humanes apo(a) oder apoB unter der Kontrolle ihres eigenen Promotors enthält, durch Screening humaner genomischer oder cDNA-Expressionsbibliotheken erhalten werden. Um dies zu tun, wird die Bibliothek durch Hybridisierung mit einer DNA-Sonde, die zu dem humanen Apolipoprotein (a) oder apoB komplementär ist, durchgemustert. Der apo(a)- oder apoB-DNA enthaltende Klon (die apo(a)- oder apoB-DNA enthaltende Klone), die bei diesem Screening isoliert werden, werden dann durch Vergleich mit ihren entsprechenden veröffentlichten Sequenzen analysiert (K.A.Frazer, G. Narla, J.L. Zhang & E.M. Rubin, Nat. Gen (1995) 9, 424–431 und Callow et al., Proc. Natl. Acad. Sci. USA (1994) 91, 2130–2136).

Regulatorische Regionen

Im allgemeinen werden die Gene, die für apo(a) und apoB oder Varianten davon codieren, an eine regulatorische Region oder mehrere regulatorische Regionen gebunden. Die Selektion der geeigneten regulatorischen Region oder der geeigneten regulatorischen Regionen ist im Rahmen des Fachwissens eines Fachmanns auf diesem Gebiet Routinearbeit.

Die regulatorischen Regionen können eine Promotorregion für eine funktionelle Transkription wie auch eine Region, die in 3' des Gens von Interesse liegt und die ein Signal zur Transkriptionsterminierung spezifiziert, und eine Polyadenylierungsstelle umfassen. Alle diese Elemente bilden eine Expressionskassette.

Promotoren, die in der vorliegenden Erfindung eingesetzt werden können, umfassen sowohl konstitutive Promotoren als auch regulierte (induzierbare) Promotoren. Der Promotor kann natürlicher Weise für die Expression der Nukleinsäure verantwortlich sein. Er kann aus einer heterologen Quelle sein und kann Promotorsequenzen eukaryotischer oder viraler Gene sein. Sie kann Promotorsequenzen sein, die von dem Genom der Zelle stammen, die infiziert werden soll. Entsprechend können sie Promotorsequenzen sein, die aus dem Genom eines Virus, einschließlich des verwendeten Adenovirus stammen. Diesbezüglich können z.B. die Promotoren der E1A-, MLP-, HCMV- und RSV-Gene und dgl. genannt werden. Außerdem kann der Promotor durch Addition aktivierender oder regulatorischer Sequenzen oder Sequenzen, die eine Gewebe-spezifische oder vorherrschende Expression erlauben, modifiziert sein. Gewebe-spezifische Promotoren stellen die Mittel zur Modulierung einer Vielzahl von Krankheiten bereit. Wenn die Nukleinsäure keine Promotorsequenzen enthält, kann eine insertiert werden.

Zusätzliche Promotoren, die zur Durchführung der vorliegenden Erfindung einsetzbar sind, sind die ubiquitären Promotoren HPRT, Vimentin, Acetin und Tubulin und die intermediären Filamentpromotoren Desmin-Neurofilamente, Keratin und GFAP; die therapeutische Genpromotoren MDR, CFTR und Faktor VIII-Promotoren, die vorzugsweise in sich teilenden Zellen aktiviert werden; Promotoren, die auf einen Stimulus reagieren, z.B. Steroidhormonrezeptor- und Retinsäurerezeptor-Promotoren; Tetracyclin-regulierte transkriptionale Modulatoren; Cytomegalovirus-immediate-early; retrovirales LTR-Metallothionein; SV40-, E1a- und MLP-Promotoren. Tretracylinregulierte transkriptionale Modulatoren und CMV-Promotoren sind in WO 96/01313, US 5,168,062 und 5,385,839 beschrieben.

In bestimmten Ausführungsformen der Erfindung sind humane apo(a)- und apoB-Gene oder Varianten davon funktionell mit einem starken Promotor, z.B. einem humanen Cytomegalovirus (HCMV)-Promotor, funktionell verknüpft, so dass hohe Level der Transgenexpression erreicht werden. Ein transgenes Tier, das solche Konstrukte umfasst, würde ein Modell der humanen Lipoprotein (a)-Expression und daher für Atherosklerose, Schlaganfall, Ischämie, Restenosierung, Herz-Kreislauf-Erkrankung, Erkrankung der Koronararterie, periphere arterielle Verschlusskrankheit, Myokardinfarkt, unerwünschtes Lipidprofil wie auch Thrombose sein.

In einer anderen Ausführungsform der Erfindung sind die humanen apo(a)- und apoB-Gene funktionell an einen Gewebespezifischen Promotor (an Gewebe-spezifische Promotoren) gebunden, um eine Überexpression der Transgene in besonderen Zellen zu lokalisieren. Bevorzugte Gewebe-spezifische Promotoren umfassen Gefäß- und Endothelzellen.

Es ist auch möglich, die humanen apo(a)- und apoB-Gene, die funktionell an eine Sequenz gebunden sind, die für eine mutierte Liganendenbindungsdomäne aus einem Glucocorticoid- oder Östrogenrezeptor codiert, die an die Gene fusioniert ist. In dieser Ausführungsform wird die Expression der Gene durch Gucocorticoide oder Tamoxifen reguliert.

Vektoren

Wie oben diskutiert, ist ein "Vektor" ein Mittel für den Transfer einer Nukleinsäure in eine Wirtszelle. Bevorzugte Vektorten sind Plasmide und virale Vektoren, z.B. Tetroviren.

Virale Vektoren können verwendet werden, um ein transgenes Tier gemäß der Erfindung zu produzieren. Vorzugsweise sind die viralen Vektoren replikationsdefektiv, d.h., sie sind unfähig, autonom in der Zielzell zu replizieren. Im allgemeinen fehlt dem Genom der replikationsdefektiven viralen Vektoren, die im Rahmen der vorliegenden Erfindung verwendet werden, wenigstens eine Region, die für die Replikation des Virus in der infizierten Zelle notwendig ist. Diese Regionen können entweder (ganz oder teilweise) eliminiert werden oder durch eine beliebige Technik, die dem Fachmann bekannt ist, nicht funktionell gemacht werden. Diese Techniken beinhalten die totale Entfernung, den Ersatz (durch andere Sequenzen, insbesondere durch die insertierte Nukleinsäure), partielle Deletion oder Addition einer oder mehrerer Basen an eine essentielle (zur Replikation) Region. Solche Techniken können in vitro (an der isolierten DNA) oder in situ durchgeführt werden, wobei die Techniken der genetischen Manipulation eingesetzt werden, oder dies kann durch Behandlung mit mutagenen Agenzien geschehen.

Vorzugsweise behält das Replikations-defektive Virus die Sequenzen seines Genoms zurück, die für eine Einkapselung der viralen Partikel notwendig sind.

Die Retroviren sind integrierende Viren, die sich teilende Zellen infizieren. Das Retrovirusgenom umfasst zwei LTRs, eine Einkapselungssequenz und drei codierende Regionen (gag, pol und env). Die Konstruktion von rekombinanten retroviralen Vektoren wurde beschrieben: siehe insbesondere EP 0 453 242, EP 0 178 220, Bernstein et al., Genet. Eng. (1985) 7: 235; McCormick, BioTechnology (1985) 3: 689 etc. In rekombinanten retroviralen Vektoren sind die gag-, pol- und env-Gene im allgemeinen deletiert, ganz oder teilweise, und durch eine heterologe Nukleinsäuresequenz von Interesse ersetzt. Diese Vektoren können aus verschiedenen Retrovirustypen, wie z.B. HIV, MoMuLV ("Moloney murine leukemia virus"), MSV ("murine Moloney sarcoma virus"), HaSV ("Harvey sarcoma virus"); SNV ("spieen necrosis virus"); RSV (Rous sarcoma virus") und Friend-Virus, konstruiert werden. Defektive retrovirale Vektoren sind in WO 95/02697 offenbart.

Um rekombinante Retroviren zu konstruieren, die eine Nukleinsäuresequenz enthalten, wird ein Plasmid konstruiert, das die LTRs, die Einkapselungssequenz und die codierende Sequenz enthält. Dieses Konstrukt wird verwendet, um eine Verpackungszelllinie zu transfizieren, wobei die Zelllinie fähig ist, die retroviralen Funktionen, die im Plasmid defizient sind, in trans zuzuführen. Im allgemeinen sind die Verpackungszelllinie so fähig, das gag-, pol- und env-Gen zu exprimieren. Solche Verpackungszelllinien wurden im Stand der Technik beschrieben, insbesondere die Zelllinie PA317 (US-Patent Nr. 4,861,719); die PsiCRIP-Zelllinie (WO 90/02806) und die GP+envRm-l2-Zelllinie (WO 89/07150. Außerdem können die rekombinanten retroviralen Vektoren innerhalb der LTRs Modifikationen zur Suppression der transkriptionalen Aktivität wie auch als extensive Verkapselungssequenzen, die einen Teil des gag-Gens umfassen können, enthalten (Bender et al., J. Virol. (1987) 61: 1639). Rekombinante retrovirale Vektoren werden durch Standardtechniken gereinigt, die dem Fachmann bekannt sind.

Arzneimittel-Screening-Assays

Transgene Tiere, die das humane apo(a)- und apoB-Gen oder Varianten davon überexprimieren, sind in Arzneimittel-Screening-Assays einsetzbar. Diese Assays sind zur Identifizierung von Verbindungen, die für die Behandlung von Krankheiten, z.B. Atherosklerose, Schlaganfall, Ischämie, Restonosierung, kardiovaskuläre Erkrankung, Koronaraterienerkrankung, periphere arterielle Verschlusskrankheit, Myokardinfarkt, unerwünschtes Lipidprofil, Thrombose und dergleichen, wirksam sind, nützlich.

Die vorliegende Erfindung stellt Verfahren zur Bestimmung der Fähigkeit einer Verbindung, apo(a)-, apoB- und Lipoprotein (a)-Funktionen in einer Zelle zu modulieren, bereit. Bevorzugte Verfahren umfassen Verabreichen einer Verbindung an ein transgenes nicht-menschliches Tier, das humanes apo(a)- und apoB-Gen oder Varianten davon umfasst, die exprimiert werden und einen humanen Lipoprotein (a)-Komplex bilden, und Vergleichen der potentiellen therapeutischen Wirkungen der Verbindung in den transgenen Tieren im Vergleich zu der in Kontrolltieren. Potentielle therapeutische Verbindungen, die die Krankheiten oder Störungen, die mit Lp(a)-Expression in Verbindung stehen, dadurch induziert und/oder verschlimmert werden, z.B. Atherosklerose, Restenosierung, Schlaganfall, Ischämie, Restenosierung, Herzkreislauferkrankung, Koronararterienerkrankung, periphere arterielle Verschlusskrankheit, Myokardinfarkt, unerwünschtes Lipidprofil und Thrombose und dergleichen, verhindern und/oder behandeln, können bestimmt werden.

Die vorliegende Erfindung bezieht sich auch auf die Verwendung des beanspruchten transgenen Kaninchens zum Detektieren der Aktivität von therapeutischen Agenzien/Verbindungen oder therapeutischen Verfahren mit der Absicht, Krankheiten, die mit einer Lp(a)-Expression verbunden sind, zu verhindern und/oder zu behandeln, wie auch auf Verfahren zum Detektieren neuer Verbindungen unter Verwendung dieses Kaninchens wie auch auf die Verbindungen, die auf diese Weise charakterisiert werden. Das transgene Kaninchen als Tiermodellsystem ist für die Detektion spezifischer therapeutischer Agenzien/Verbindungen zur Behandlung und/oder Prävention von Krankheiten, die mit der Lp(a)-Expression und/oder dem Lp(a)-Metabolismus verknüpft sind, insbesondere auf dem Gebiet der Herzkreislauferkrankungen, z.B. Atherosklerose, kardiovaskuläre Erkrankung, Koronararterienerkrankung, Schlaganfall, Ischämie, periphere arterielle Verschlusskrankheit, Restenosierung, Thrombose, Myokardinfarkt, Angina Pectoris, plötzlicher Tod, unerwünschtes Lipidprofil, Herzinsuffizienz oder cerebrovaskulärer Erkrankungen, vorteilhaft.

Die vorliegende Erfindung stellt auch Verfahren zur Identifizierung einer Verbindung bereit, die für die Behandlung von Krankheiten und Störungen wirksam ist, welche mit der Lp(a)-Expression verbunden sind, durch diese induziert und/oder verschlimmert werden, z.B. Atherosklerose, Restenosierung, Schlaganfall, Ischämie, Restenosierung, kardiovaskulärer Erkrankung, Koronararterienerkrankung, periphere arterielle Verschlusskrankheit, Myokardinfarkt, unerwünschtes Lipidprofil und Thrombose und dergleichen. Solche Verfahren umfassen Verabreichung einer Verbindung an ein transgenes nichtmenschliches Tier, das das humane apo(a)- und apoB-Gen oder Varianten davon umfasst, wobei Transgene exprimiert werden und einen humanen Lipoprotein (a)-Komplex bilden, und Vergleichen der potentiellen therapeutischen Wirkungen der Verbindung in den transgenen Tieren mit der in transgenen Kontrolltieren.

Die vorliegende Erfindung stellt auch ein Verfahren zur Identifizierung einer Verbindung bereit, die fähig ist, eine humane Lp(a)-Anordnung bzw. ein humanes Lp(a)-System in einer Zelle zu moduzieren, indem eine Verbindung an ein transgenes nicht-menschliches Tier verabreicht wird, das das humane apo(a)- und apoB-Gen oder Varianten davon umfasst, wobei die Transgene exprimiert werden und einen humanen Lipoprotein (a)-Komplex bilden, und Überwachen der humanen Lp(a)-Level und/oder der biologischen Aktivität in dem behandelten transgenen Tier im Vergleich zu den Kontrolltieren. Nach einem bevorzugten Aspekt der Erfindung sind die Zellen Zellen eines Tiers, das an einer Krankheit oder einer Störung leidet, die mit der Lp(a)-Expression in Verbindung steht, dadurch induziert und/oder verschlimmert wird, und umfasst das Verfahren Verabreichen an die Zellen eines Tiers eine Verbindung, die fähig ist, die Lp(a)-Funktion zu modulieren, um die Krankheit/Störung zu verhindern und/oder zu behandeln. Solche Krankheiten umfassen Atherosklerose, Restenosierung, Schlaganfall, Ischämie, Restenosierung, kardiovaskuläre Krankheit, Koronararterienkrankheit, periphere arterielle Verschlusskrankheit, Myokardinfarkt, unerwünschtes Lipidprofil und Thrombose und dergleichen.

Die Arzneimittel-Screening-Assays der Erfindung können in einem großen Maßstab oder in einem kleinen Maßstab durchgeführt werden. Ein Screening in großem Maßstab beeinhalt die visuelle Beobachtung des Gefäßsystems oder eines anderen Gewebes, das die apo(a)- und apoB-Transgene exprimiert und einen Vergleich mit Kontrolltieren. Wenn z.B. die humane Lp(a)-Produktion in dem transgenen Tier zur atherosklerotischen Plaque-Bildung in den Blutgefäßen führt, würde der Beobachter einen Arzneimittelkandidaten auf der Basis seiner Fähigkeit, diese Bildung im Vergleich zu unbehandelten Tieren zu verringern, beurteilen.

Alternativ umfassen die transgenen Tiere der Erfindung, die humanes Lp(a) oder eine Variante davon exprimieren, auch ein Reportergen funktionell mit einem Promotor verknüpft, dessen Expression durch Lp(a) oder eine Variante davon verändert wird, hergestellt werden. Beispielsweise würde ein solcher Promotor, der funktionell mit dem &bgr;-Galactosidasegen (LacZ) verknüpft ist, in Abhängigkeit vom entsprechenden Vorliegen oder Fehlen einer korrektiven Behandlung zur Lp(a)-Expression nicht induziert oder induziert werden.

Arzneimittel-Screening-Assays der Erfindung können auch in kleinem Maßstab durchgeführt werden. Assays in kleinem Maßstab involvieren eine Biopsie und histologische und/oder immunhistochemische Analysen. Diese Charakteristika können vom durchführenden Fachmann histologisch beurteilt werden. Eine immunohistochemische Analyse kann unter Verwendung eines Markers für Atherosklerose, Schlaganfall, Ischämie, Restenosierung, kardiovaskuläre Erkrankung, Koronararterienerkrankung, periphere arterielle Verschlusskrankheit, Myokardinfarkt, unerwünschtes Lipidprofil, Thrombose und dergleichen, durchgeführt werden.

Verbindungen, die fähig sind, die Lp(a)-Funktion zu modulieren, umfassen solche, die fähig sind, eine Herabregulierung der Expression eines oder beider Gene, das apo(a)- und apoB-Gen, zu inhibieren, die Bildung des Lp(a)-Komplexes oder die biologische Aktivität von Lp(a) in einer Zelle zu inhibieren oder den Plasmalevel von Lipoprotein (a) zu reduzieren. Sol-che Verbindungen umfassen Antisense-Nukleinsäuren, intrazelluläre Bindungsproteine, einschließlich Antikörper und eine beliebige natürliche oder synthetische Verbindung, die durch Verwendung der transgenen Tiere und Assays, die hierin beschrieben werden, identifiziert wurde.

Herstellung und Verwendung von Antisense-Polynukleotiden, für DNA-codierenden Antisense-RNA-Molekülen und Verwendung von Oligonukleotid und genetischem Antisense sind in WO 92/15680 offenbart, deren Inhalt hier durch Referenz aufgenommen wird. Antisense-Nukleinsäuren zur Verwendung gemäß der Erfindung sind vorzugsweise RNA, die fähig sind, spezifisch mit den ganzen apo(a)- und/oder apoB-Genen ganz oder teilweise oder ihren entsprechenden Messenger-RNAs zu hybridisieren. Die Antisense-Sequenz kann von DNA-Sequenzen abgeleitet sein, deren Expression in der Zelle RNA produziert, die für die ganzen apo(a)- und apoB-Gene oder Teilen davon komplementär ist. Diese Antisense-Sequenzen können durch Expression einer Sequenz, die für apo(a) und/oder apoB codiert, ganz oder teilweise in entgegengesetzter Richtung hergestellt werden. Eine beliebige Länge der Antisense-Sequenz ist zur Durchführung der Erfindung geeignet, solange sie fähig ist, eine Expression des apo(a)- und/oder apoB-Gens herabzuregulieren oder zu blockieren. Die Antisense-Sequenz ist vorzugsweise wenigstens 20 Nukleotide lang.

Nach einem Aspekt codiert die Nukleinsäure für Antisense-RNA-Moleküle. In dieser Ausführungsform ist die Nukleinsäure funktionell an geeignete regulatorische Regionen (oben diskutiert) gebunden, die eine Expression der Nukleinsäuresequenz ermöglichen, und wird in eine Zelle eingeführt, wobei vorzugsweise rekombinante Vektorkonstrukte verwendet werden, welche die Antisense-Nukleinsäure exprimieren werden, sobald der Vektor in die Zelle eingeführt ist. Beispiele für geeignete Vektoren umfassen Plasmide, Adenoviren, Adenoassoziierte Viren (siehe WO 91/18088; WO 93/09239; US-Patent Nr. 4,797,368, US-Patent Nr. 5,139,941, EP 0 488 528), Retroviren (siehe oben) und Herpes-Viren. Zur Abgabe eines therapeutischen Gens ist der Vektor vorzugsweise ein Adenovirus.

Adenoviren sind eukaryotische DNA-Viren, die modifiziert werden können, so dass sie effizient eine Nukleinsäure der Erfindung an eine Vielzahl von Zelltypen abgeben können.

Es existieren verschiedene Serotypen vom Adenovirus. Von diesen Serotypen ist es im Rahmen der vorliegenden Erfindung bevorzugt, Typ 2 oder Typ 5 der humanen Adenoviren (Ad 2 oder Ad 5) oder Adenoviren tierischen Ursprungs (siehe WO 94/26914) zu verwenden. Solche Adenoviren tierischen Ursprungs, die im Rahmen der vorliegenden Erfindung verwendet werden können, umfassen Adenoviren von Hund, Rind, Maus, Schaf, Schwein, Vogel und Affen (Beispiel: SAV). Vorzugsweise ist das Adenovirus tierischen Ursprungs ein Hundeadenovirus, bevorzugter ein CAV2-Adenovirus (z.B. Manhattan oder A26/61-Stamm (ATCC VR-800, beispielsweise).

Die Replikations-defektiven adenoviralen Vektoren zur Verwendung in der Erfindung umfassen vorzugsweise die ITRs, eine Einkapselungssequenz und die Nukleinsäure von Interesse. Noch bevorzugter ist wenigstens die E1-Region des adenoviralen Vektors nicht funktionell. Die Deletion in der E1-Region erstreckt sich vorzugsweise von den Nukleotiden 455 bis 3329 in der Sequenz des Ad5-Adenovirus (PvuII-Bg1II-Fragment) oder von 382 bis 3446 (HinfII-Sau3A-Fragment). Andere Regionen können auch modifiziert sein, insbesondere die E3-Region (WO 95/02697), die E2-Region (WO 94/28938), die E4-Region (WO 94/28152, WO 94/12649 und WO 95/02697) oder in einem der späten Gene L1–L5.

In einer bevorzugten Ausführungsform hat der adenovirale Vektor eine Deletion in der E1-Region (Ad 1.0). Beispiele für E1-deletierte Adenoviren sind in EP 0 185 573 offenbart.

In einer anderen bevorzugten Ausführungsform hat der adenovirale Vektor eine Deletion in der E1- und E4-Region (Ad 3.0). Beispiele für E1/E4-deletierte Adenoviren sind in WO 95/02697 und WO 96/22378 offenbart.

In noch einer anderen bevorzugten Ausführungsform hat der adenovirale Vektor eine Deletion in der E1-Region, in die die E4-Region und die Nukleinsäuresequenz insertiert sind (siehe FR 94 13355).

Die Replikations-defektiven rekombinanten Adenoviren können durch irgeneine dem Fachmann bekannte Technik hergestellt werden (Levrero et al. (1991), Gene 101, 195; EP 0 185 573; Graham (1984) EMBO J. 3, 2917). Sie können insbesondere durch homogene Rekombination zwischen einem Adenovirus und einem Plasmid, das inter alia die DNA-Sequenz von Interesse trägt, hergestellt werden. Die homologene Rekombination wird nach Co-Transfektion des Adenovirus und Plasmids in eine geeignete Zelllinie durchgeführt. Die Zelllinie, die verwendet wird, sollte vorzugsweise (i) durch die Elemente transformierbar sein und (ii) die Sequenzen enthalten, die fähig sind, den Teil des Genoms des Replikations-defektiven Adenovirus vorzugsweise in integrierter Form zu komplementieren, um die Gefahren einer Rekombination zu vermeiden. Beispiele der Zelllinien, die verwendet werden können, sind die humane Embryonierenzelllinie 293 (Graham et al. (1977) J. Gen. Virol. 36, 59), die den linken Teil des Genoms eines Ad5-Adenovirus (12%) in ihr Genom integriert enthält, und Zelllinien, die fähig sind, die E1- und E4-Funktionen zu komplementieren, wie es in den Anmeldungen WO 94/26914 und WO 95/02697 beschrieben ist. Rekombinante Adenoviren werden unter Verwendung molekularbiologischer Standardtechniken isoliert und gereinigt, wobei diese Techniken dem Fachmann gut bekannt sind.

Eine andere Ausführungsform des erfindungsgemäßen Verfahrens zur spezifischen Inhibierung der Lp(a)-Aktivität umfasst Inhibieren der Lp(a)-Funktion durch Expression einer Nukleinsäuresequenz, die für ein intrazelluläres Bindungsprotein codiert, welches fähig ist, selektiv mit apo(a), apoB und/oder dem Lp(a)-Komplex innerhalb einer transfizierten Zellen wechselzuwirken. WO 94/29446 und WO 94/02610 offenbaren die zelluläre Transfektion mit Genen, die für ein intrazelluläres Bindungsprotein codieren. Ein intrazelluläres Bindungsprotein umfasst ein beliebiges Protein, das fähig ist, selektiv mit apo(a), apoB und/oder dem Lp(a)-Komplex, einschließlich humanes apo(a), apoB und/oder Lp(a) in der Zelle, in die es exprimiert wird, zu Wechselwirken oder daran zu binden und die Funktion von gebundenem apo(a), apoB und/oder Lp(a) zu neutralisieren. Die intrazelluläre Bindungsprotein ist vorzugsweise ein Antikörper oder ein Fragment oder eines Antikörpers. Vorzugsweise ist das intrazelluläre Bindungsprotein ein Einzelketten-Antikörper. Der Antikörper kann monoklonal oder polyklonal sein.

WO 94/02610 offenbart die Herstellung von Antikörpern und die Identifizierung der Nukleinsäure, die für einen besonderen Antikörper codiert. Unter Verwendung der apo(a)-, apoB- oder Lp(a)-Komplexproteine oder Fragmenten davon wird ein monoklonaler Antikörper, der für apo(a), apoB oder Lp(a) spezifisch ist, nach Techniken, die dem Fachmann auf diesem Gebiet bekannt sind, hergestellt. Ein Vektor, der die Nukleinsäure, welche für ein intrazelluläres Bindungsprotein codiert, oder einen Teil davon umfasst und zur Expression in einer Wirtszelle fähig ist, wird anschließend zur Verwendung im erfindungsgemäßen Verfahren präpariert. Geeignete Vektoren und Verfahren zur Abgabe von Nukleinsäuren, die für intrazelluläre Bindungsproteine codieren, an Zellen, die apo(a), apoB und/oder Lp(a) enthalten, umfassen die, die oben zur Abgabe von Antisense-Nukleinsäuren diskutiert wurden.

In einem bevorzugten Aspekt dieser Ausführungsform umfasst die Nukleinsäuresequenz, die für ein apo(a)-, apoB- und/oder Lp(a)-intrazelluläres Bindungsprotein codiert, zusätzlich eine Sequenz, die für 1) ein Lokalisierungssignal zum Targeting des intrazellulären Bindungsproteins zu einem geeigneten zellulären Ort, um eine Wechselwirkung des intrazellulären Bindungsproteins und seines Zielmoleküls (seiner Zielmoleküle) zu ermöglichen, und/oder 2) eine Sequenz, die eine Insertion des intrazellulären Bindungsproteins in die Plasmamembran ermöglicht, codiert. Das Lokalisierungssignal oder die Insertionssequenz können irgendwo am intrazellulären Bindungsprotein lokalisiert sein, solange sie mit der Fähigkeit des Proteins, an apo(a), apoB und/oder Lp(a) zu binden, nicht wechselwirkt. Beispiele für Lokalisierungssignale sind in WO 94/02610 offenbart.

Pharmazeutische Zusammensetzungen

Verbindungen, die fähig sind, die Lp(a)-Funktion zu modulieren, umfassen Antisense-Nukleinsäuren, intrazelluläre Bindungsproteine und Verbindungen, die unter Verwendung der transgenen Tiere und der hierin beschriebenen Assays identifiziert wurden.

Antisense-Nukleinsäure-Konstrukte, die zur Herabregulierung oder Blockierung der Expression der apo(a)- und apoB-Transgene fähig sind, können an betroffene Zellen abgegeben werden. Die Nukleinsäuren können entweder in Form eines Vektors oder in Form nackter DNA mit einem oder mit mehreren pharmazeutisch annehmbaren Trägern für eine injizierbare Formulierung kombiniert werden. Diese können insbesondere isotonische, sterile Salzlösungen (Mononatrium- oder Dinatriumphosphat, Natrium-, Kalium-, Calcium- oder Magnesiumchlorid und dgl. oder Gemische solcher Salze) oder trockene, speziell gefriergetrocknete Zusammensetzungen sein, die entsprechend dem Fall nach Zusatz von sterilisiertem Wasser oder physiologischer Kochsalzlösung die Bildung injizierbarer Lösungen erlauben.

Die bevorzugten sterilen injizierbarer Präparationen können eine Lösung oder Suspension in einem nicht-toxischen parenteral annehmbaren Lösungsmittel oder Verdünnungsmittel sein. Beispiele für pharmazeutisch annehmbare Träger sind Salzlösung, gepufferte Salzlösung, isotonische Salzlösung (z.B. Mononatrium- oder Dinatriumphosphat, Natrium-, Kalium-, Calcium- oder Magnesiumchlorid oder Gemische solcher Salze), Ringer-Lösung, Dextrose, Wasser, steriles Wasser, Glycerin, Ethanol und Kombinationen davon. 1,3-Butandiol und sterile fixierte Lösungen werden zweckdienlicherweise als Lösungsmittel oder Suspendiermedien eingesetzt. Es kann ein beliebiges mildes fixiertes Öl, einschließlich synthetischer Mono- oder Diglyceride, verwendet werden. Fettsäuren, z.B. Ölsäure, können bei der Herstellung von injizierbaren Lösungen ebenfalls Verwendung finden.

Bei Verabreichung als Virus kann die Dosis/können die Dosen als Funktion verschiedener Parameter angepasst werden, und zwar insbesondere als Funktion der in Betracht gezogenen Verabreichungsstelle, der Anzahl der Injektionen, des zu exprimierenden Gens oder alternativ der gewünschten Behandlungsdauer. Im allgemeinen werden rekombinante Adenoviren in Form von Dosen mit zwischen 104 und 1014 pfu und vorzugsweise 106 bis 1011 pfu formuliert und verabreicht. Der Ausdruck pfu (Plaque forming unit = Plaque-bildende Einheit) entspricht der Infektivität einer Viruslösung und wird bestimmt, indem eine geeignete Zellkultur infiziert wird und die Anzahl der Plaques infizierter Zellen im allgemeinen nach 15 Tage messen wird. Die Technik zur Bestimmung des pfu-Titers einer viralen Lösung ist in der Literatur gut dokumentiert.

Eine Nukleinsäure, z.B. die, die für ein Antisense- oder intrazelluläres Bindungsprotein codiert, kann auch als nackte DNA verabreicht werden. Verfahren zur Formulierung und Verabreichung nackter DNA an Säuger-Muskelgewebe sind in den US-Patenten 5,580,859 und 5,589,466 offenbart.

BEISPIELE

Die vorliegende Erfindung wird anhand der folgenden Beispiele, die als erläuternd und nicht beschränkend angesehen werden sollen, detaillierter erläutert.

Allgemeine Molekularbiologie

Gemäß der vorliegenden Erfindung können herkömmliche Molekularbiologie-, Mikrobiologie- und rekombinante DNA-Techniken im Rahmen des Fachwissens verwendet werden. Solche Techniken sind in der Literatur vollständig erläutert. Siehe z.B. Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, 2. Auflage (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, new York (hierin "Sambrook et al., 1989"); DNA Cloning: A Practical Approach, Bd. I und II, Ausgabe (Herausg. D.N. Glover, (1985)); Oligonucleotide Synthesis (Herausg. M.J. Gait, 1984)); Nucleic Acid Hybridization (Herausg. B.D. Hames & S.J.E. Higgins (1985)); Animal Cell Culture (R.I. Freshney, Herausg. (1986)); B.E. Perbal, A Practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (Herausg.) Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).

Beispiel 1: Herstellung und Charakterisierung von humaner apo(a)- und apoB-DNA

Ein YAC-Klon, der das humane apo(a)-Gen enthielt (Klon 366H2 in der CEPH-Bibliothek) wurde bereits früher beschrieben (K.A. Frazer, G. Narla, J.L. Zhang & E.M. Rubin, Nat. Gen (1995) 9, 424–431). Der YAC wurde durch Pulsfeld-Gelelektrophorese von den Hefechromosomen abgetrennt. Die Bande, die YAC enthielt, wurde aus DeaPlaque-GTG-Agarose (FMC, Rockland, MD) ausgeschnitten mit beta-Agarase (NEB, Beverly, Ma) behandelt und dann gegen 0,1 M NaCl, 10 mM Tris, 0,1 mM EDTA dialysiert (L.B. Couto, E.A. Spangler & E.M. Rubin, Nuc. Acid Res. (1989) 17 (19), 8010). Das 90 kb P1-Phagemid, das das humane apoB-Gen enthält, wurde bereits früher beschrieben (Callow et al., Proc. Natl. Acad. Sci, USA (1994) 91, 2130–2136).

Beispiel 2: Produktion und Screening von transgenen Kaninchen

Die Produktion von transgenen Kaninchen verwendete die bereits beschriebenen Verfahren (Duverger et al., Arterioscler.

Thromb. Vasc. Biol. (1996) 16, 1424–1429). Kurz ausgedrückt, weibliche erwachsene Neuseeland-Kaninchen wurden zu einer vorzeitigen Evulation gebracht, dann am selben Tag, an dem luteinisierendes Hormon injiziert worden war, gepaart. 17 Stunden später wurden Embryos gesammelt. Embryo-Injektion, -Transfer in Weibchen mit Pseudo-Schwangerschaft und Tierhaltung waren wie früher beschrieben (Fan et al., Arterioscler. Thromb. Vasc. Biol. (1995) 15, 18889–1899); Duverger et al., Arterioscler. Thromb. Vasc. Biol. (1996) 16, 1424–1429). Etwa 2 pl einer 1 ng/ml DNA-Lösung, die entweder den humanen apo(a)-YAC oder das humane apoB-P1-Phagemid enthielt, wurde in die männlichen Pronuclei injiziert.

Um die apo(a)-transgenen Kaninchen zu schaffen, wurden 280 mikroinjizierte Embryos in Weibchen mit Pseudoschwangerschaft transferiert, was zu 17 lebend geborenen Kaninchen führte. Kaninchen-DNA, die aus Ohrbiopsien extrahiert worden waren, wurden durch PCR unter Verwendung von früher beschriebenen Verfahren und Primern auf das Vorliegen von humanem apo(a) durchgemustert (Frazer et al., Nat. Gen (1995), 9, 424–431). Zwei weibliche Kaninchen waren transgen und das Tier mit dem höchsten apo(a)-Plasmaspiegel wurde in den nachfolgenden Studien verwendet. Ein PCR-Screening wurde verwendet, um Kaninchen zu identifizieren, die die Transgene enthalten, und um die vollständige Integration des apo(a)-Gens und seiner flankierenden Regionen zu bestätigen (1). Die apo(a)-"Founder"-Kaninchen enthielten eine intakte Kopie des gesamten genomischen YAC-Klons, was durch vier verschiedene PCR-Reaktionen, die die gesamte Länge des Klons überspannten, bestimmt wurde. Um die apoB-Transgene zu bestimmen, wurden 780 mikroinjizierte Embryos in scheinschwangere Weibchen transferiert. Von den 20 lebend geborenen Kaninchen wurden zwei apoB-Transgene identifiziert, die Ohren-Biopsie-DNA, PCR und humanen apoB-spezifischen Primern aus der Promotorregion des Gens: 5'-AGAAGGTTCCAGATGTCTATGAGG (SEQ ID NO: 1) und 5'TCCAAGTATCTGTCTTCAAGAAACC (SEQ ID NO: 2) identifiziert. Das Tier mit dem höchsten apoB-Plasmalevel wurde in nachfolgenden Studien eingesetzt. Das humane apoB-Gen wurde durch eine einzelne PCR-Reaktion, die für humane Sequenzen spezifisch ist, im Promotorbereich detektiert. Die Nachkommenschaft der apo(a)- und apoB-"Founder"-Tiere war auf die geeigneten Marken positiv und zeigte ein Mendel'sches (Übertragungsmuster der zwei Transgene. Eine Paarung zwischen den apo(a)- und apoB-transgenen "Foundern" produzierte Kaninchen der vorausgesagten Genotypen, die Gegenstand der vorliegenden Erfindung sind.

Beispiel 3: Analyse der Gewebeverteilung von transgenem apo(a) und apo(b) durch RT-PCR

Gesamt-RNA wurde aus Kontroll- und transgenen Kaninchen-Gewebe extrahiert, wobei RNAstat-60 (Tel-Test B, Frienswood, TX) verwendet wurde, danach einer DNAse-Behandlung unterworfen, dann einer Umkehrtranskription unterzogen [5 &mgr;g RNA, inkubiert mit 10 &mgr;g apo(a)-RT-Primer:

5'-GATGACCAAGCTTGGCAGGTTCTTCC-3' (SEQ ID NO: 3) oder apoB M46-Primer: 5'-CCACATTTTGAATCCAGGATGCAGTACTACT-3' (SEQ ID NO: 4) in einem Volumen von 12 &mgr;l bei 65°C für 10 min, dann supplementiert mit Supercript II/Puffer (GibcoBRL, Bethesda, MD) und für 1 Stunde bei 42°C inkubiert]. Der erste Strang cDNA wurde dann mit RNAse behandelt und mit Phenol/Chloroform extrahiert. 5 &mgr;l des RT-Produktes wurden unter Standardbedingungen für Taq Polymerase (Boehringer Mannheim, Indianapolis, IN) einer PCR unterworfen, wobei 50 pmol jedes Primers verwendet wurden, und ein Thermocycling wie folgt durchgeführt wurde: (94°C für 30 Sekunden, 62°C für 30 Sekunden, gefolgt von 72°C für 90 Serkunden – 25 Zyklen). Apo(a)-cDNA wurde unter Verwendung der Primer (a)Kr1F: 5'-ACCTGAGCAAAGCCATGTG-3' (SEQ ID NO: 5) und (a)Kr1R: 5'-AGTACTCCCACCTGACACCG-3' (SEQ ID NO: 6) detektiert. ApoB cDNA wurde unter Verwendung von Menschen- und Kaninchenspezifischen PCR-Primern (M49/M50human oder M49/M50rabbit, S.D. Hughes et al., Hum. Gene Ther., 7, 39–49 (1996) detektiert. PCR-Produkte wurden an 1,5% Agarosegelen analysiert. Um die Abwesenheit einer genomischen DNA-Kontamination zu zeigen, wurden RNA-Präparationen direkt denselben PCR-Bedingungen unterworfen, und es wurde kein Produkt amplifiziert.

Um die Verteilung von apo(a)- und apoB-Transgen-Expression zu bestimmen, wurden RNA-Präparationen aus verschiedenen Geweben (Leber, Hoden, Dünndarm, Niere, Gehirn und Lunge) RT-PCR-Assays als qualitative Bestimmung der Transgen-Expression unterworfen (2). Apo(a)-RNA wurde in der Leber und den Hoden detektiert, während es unter empfindlicheren Bedingungen (erhöhte Zahl der PCR-Zyklen von 25 auf 30) auch im Gehirn beobachtet wurde. Die Leber und Hoden waren auch die Hauptstellen der Expression für das humane apoB-Transgen. Ein relativ schwaches Signal (< 5% des Signals in der Leber) wurde im Dünndarm detektiert. Als Kontrolle für die Spezies-Spezifität des apoB-mRNA-Assays wie auch für die RNA-Qualität wurde der RT-PCR-Assay verwendet, um in spezifischer Weise Kaninchen-apoB zu detektieren. Wie erwartet, wurde KaninchenapoB-mRNA in allen untersuchten Geweben detektiert. Übereinstimmend mit Studien in transgenen Mäusen wurde sowohl humanes apo(a)- als auch apoB-Transgen in signifikanten Leveln und in den geeigneten Geweben in allen identifizierten "Founder"-Kaninchen exprimiert, was die hohe Wirksamkeit und Gewebespezifische Expression dieser genomischen Transgene im Vergleich zu cDNA-Transgenen beweist (Chiesa et al., J. Biol. Chem. (1992) 267, 24369–24374; Chiesa et al., J. Bio. Chem. (1993) 268, 23747–23750).

Die Gewebeverteilung der humanen apoB-Expression unterschied sich etwas von der, die in transgenen Mäusen beobachtet wurde. Der niedrige Level der humanen apo8-intestinalen Expression in den transgenen Kaninchen zeigt einen gewissen Grundlevel der Transkription, der vom humanen apoB-Promotor im Kaninchendarm erfolgt, allerdings ist die Expression weit geringer als die von endogenem apoB im Darm, was nahe legt, dass Kontrollelemente, die für eine Expression in diesem Gewebe erforderlich sind, in dem genomischen apoB-Konstrukt nicht vorhanden waren. Dieser letztgenannte Punkt stimmt mit den Schlussfolgerungen von zwei abhängigen Artikel über Mäuse, die ein identisches apoB-Transgen enthalten, überein (Callow et al., Proc. Natl. Acad. Sci. USA (1994) 91, 2130–2136; Purcell-Huynh et al., J. Clin. Invest. (1995) 95, 2246–2257). Außerdem detektieren wir ein apoB-48 im Plasma von transgenen Kaninchen. Dieses Resultat, das mit den Feststellungen von Fan et al., Arterioscler. Thromb. Basc. Biol. (1995) 15, 1998–1899 übereinstimmt, legt nahe, dass im Darm (Intestinum) der transgenen Kaninchen geringee oder keine humane apoB-Protein-Produktion auftritt.

Wegen der starken Senkung der apo(a)-Plasma-Spiegel, die mit der Geschlechtsreife in Verbindung stehen, was bereits früher bei Mäusen, die das genomische apo(a)-Transgen enthalten, festgestellt wurde, untersuchten wir den Effekt der Geschlechtsreife auf apo(a)-Plasmalevel bei transgenen Kaninchen. Plasmaproben, die von Kaninchen im Alter von 3, 6 und 9 Monaten gesammelt wurden (Kaninchen sind im Alter von 6 Monaten geschlechtsreif), wurden auf Änderungen bei den apo(a)-Leveln durch Immunblotting beurteilt (3). Diese Analyse zeigte im Verlauf der Geschlechtsreife bei den transgenen Kaninchen keine signifikante Änderung der apo(a)-Level.

Obgleich die Gewebespezifität der genomischen apo(a)-Transgenexpression bei Kaninchen und Mäusen ähnlich war, unterschied sich die Entwicklungsregulation der Expression zwischen diesen zwei Organismen deutlich. Im Gegensatz zu den Verringerungseffekten der Geschlechtsreife auf apo(a)-Plasmalevel bzw. -Plasmaspiegel bei transgenen Mäusen wurden die apo(a)-Spiegel bei Kaninchen durch die Geschlechtsreife nicht verändert. Da Plasmalevel von apo(a) in erster Linie durch die Syntheserate bestimmt werden, legt ein Fehlen einer Abnahme der apo(a)-Plasmalevel in Verbindung mit Geschlechtsreife bei Kaninchen, die das apo(a)-Transgen enthalten, nahe, dass Geschlechtshormone keinen starken Effekt auf die Transgenexpression in diesen Tieren haben. Die Effekte dieser Hormone auf die apo(a)-Transkription in Kaninchen können feiner sein wie es bei Menschen bemerkt wurde.

Beispiel 4: Apolipoprotein- und Lipoprotein-Analyse

Die gesamte Lipoproteinfraktion (r < 1,21 g/ml) wurde aus Kaninchenplasmaproben durch ein Dichtegradienten-Ultrazentrifugationsverfahren, das bereits früher beschrieben worden war, hergestellt (Callow et al., PÜroc. Natl. Acad. Sci. USA (1994) 91, 2130–2136). Konzentrationen an Lp(a) und humanem apoB wurden in Kaninchenplasma und Lipoprotein-Fraktionen durch einen Sandwich-ELISA-Assay gemessen. Für Lp(a) wurde gereinigtes IgG, das aus polyklonalem Ziegenantiserum auf humanes Apolipoprotein (a) hergestellt worden war (Internatinal Immunology Corp., Murrieta, CA) an die Mikrotiterplatte wie auch an einen Fangantikörper gebunden. Meerrettichperoxidasekonjugat desselben Antikörpers wurde zur Detektion von apo(a) nach Zusatz des chromogenen Substrats o-Phenylendiamin verwendet. Eine Standardisierung des Verfahrens basierte auf hauseigenen humanen Lipoprotein-Kalibratoren, die in unabhängiger Weise unter Verwendung eines im Handel verfügbaren standardisierten Lp(a) ELISA-Kits (Strategic Diagnostics, Newark, DE) verwendet wurden. Der Assay auf humanes apoB (B48 + B100) verwendete einen Maus-Antikörper gegen humanes apoB (Genzyme, Cambridge, MA). Standardkurven wurden mit geeigneten Blindwerten und Kontrollen unter Verwendung der Logit-Log-Daten-Transformation errechnet. Alle angegebenen Konzentrationen wurden aus einer Dreifachanalyse errechnet.

Um apo(a)- und apoB-Wechselwirkungen zu bestimmen, wurde Plasma, das aus transgenen Kaninchen isoliert worden war, durch SDS-PAGE an 4% Polyacrylamidgelen nach E.K. Laemmli, Nature (1970) 227, 680–685 getrennt und Proteine wurden auf eine Millipore-Nitrocellulosemembran durch Immunblotting nach Towbin et al., J. Proc. Natl. Acad. Sci USA (1979) 6, 4350–4354 transferiert. Wenn es angegeben ist, wurden Proben durch Zusatz eines denaturierenden Probenpuffers, der 2,5% 2-Mercaptoethanol enthielt, reduziert und 5 min bei 100°C inkubiert. apo(a) wurde mit Ziegen-anti-apo(a) (Valbiotech, Paris), gefolgt durch HRP-kunjugierten Kaninchen-anti-Ziege (Biorad, Hercules, CA) detektiert. Humanes apoB wurde unter Verwendung von HRP-konjugiertem polykonalen Kaninchen-anti-Menschen-apoB (freundlicherweise von C. Fievet zur Verfügung gestellt) detektiert. Proteinbanden wurden durch einen verstärkten Chemilumineszenzkit (Amersham, Arlington Heights, IL) sichtbar gemacht und unter Verwendung eines Höfer-GS-Durchlässigkeits-Scanningdensitometers gescannt. Die Fläche der Hauptpeaks wurde verwendet, um das relative Verhältnis von freiem und apoB-gebundenem apo(a) zu beurteilen (Gabel et al., Arterio. Thromb. Vasc. Biol. (1996) 16, 1559–1567). Die scheinbaren Molekulargewicht wurden durch Verwendung von vorgefärbten Standards (Biorad) bestimmt. Humanes Kontrollserum wurde als positive Kontrolle zur Expression der humanen Proteine verwendet.

Unter nicht reduzierenden Bedingungen wiesen Plasmaproben sowohl aus den apo(a)-transgenen Kaninchen als auch den transgenen Kaninchen mit der Kombination humanes apoB/apo(a) zwei Banden auf (4A); die Bande mit höherem Molekulargewicht entsprach dem apoB/apo(a)-Komplex und die Bande mit niedrigerem Molekulargewicht entsprach dem freien apo(a). Das Vorliegen einer Bande mit hohem Molekulargewicht (apo(a)) zeigt im Zusammenbau von Lp(a) in den kombinierten transgenen Kaninchen wie auch einen gewissen Grad der kovalenten Wechselwirkung zwischen apo(a) und Kaninchen-apoB in Kaninchen, die nur bezüglich apo(a) transgen waren. Dies wurde durch Immunblotting reduzierter Plasmaproben (4B) bestätigt, wo nur eine einzelne Bande, die apo(a) darstellt, in beiden Typen transgener Kaninchen unter Verwendung deselben humanen apo(a)-Antiserum detektiert wurde. Das scheinbare Molekulargewicht des apo(a) in den transgenen Kaninchen war etwa 200 kD. Dies ist der apo(a)-Größe ähnlich, die in den transgenen Mäusen, die dasselbe genomische apo(a)-Konstrukt enthielten, entsprechend einem apo(a)-Protein, das etwa neun Kringel 4-artige Wiederholungen enthält, beobachtet. Proben, die mit humanem spezifischem apoB-Antiserum geblottet waren (4C), gaben eine einzelne Bande mit 550 kD, die humanes apoB-100 darstellt, ausschließlich in Plasma von Kaninchen, die durch PCR auf humanes apoB positiv getestet worden waren. Die Konzentrationen an apo(a) und apoB in den transgenen Kaninchen wurden durch ELISA beurteilt. Die durchschnittliche Konzentration an humanem apoB war in den transgenen Kaninchen 17,6 mg/dl. Die durchschnittliche apo(a)-Gesamtkonzentration im Plasma war 2,5 mg/dl ohne signifikante Differenz zwischen den nur-apo(a)- und humanen apoB-apoB/apo(a)-Transgenen.

Es wurde eine Ultrazentrifugation verwendet, um die Kombination von apo(a) mit der Lipoproteinfraktion zu untersuchen. Es wurde gezeigt, dass die Disulfidverknüpfung zwischen apo(a) und humanem apoB die Bedingungen der Ultrazentrifugation, die zur Isolierung von Lipoproteinen verwendet wurde, aushielt, während nicht kovalent assoziiertes apo(a) mit dichteren Plasmaproteinen fraktionierte (G. Utermann & W. Weber, FEBS Let (1983) 154, 357–361). Lipoproteinfraktionen, die aus apo(a)-Transgenen und apoB/apo(a)-transgenen Kaninchen isoliert worden waren, wurden auf das Vorliegen von apo(a) durch ELISA getestet. Apo(a) wurde in den Lipoproteinfraktionen beider Typen transgener Kaninchen detektiert, was anzeigt, dass apo(a) eine Disulfidbindung zwischen humanem und Kaninchen-apoB bildete. Die relativen Anteile an Lp(a) und apo(a) im Plasma legen allerdings nahe, dass der Kaninchen-apoB-apo(a)-Komplex in vivo mit geringerer Effizienz als dies mit humanem apoB beobachtet wurde, gebildet wurde. Ein Vergleich der Muster von apo(a)-Immunreaktivität zwischen apo(a)-Transgenen und apoB/apo(a)-transgenen Kaninchen (4A) zeigte einen größeren Anteil an nicht-kovalent gebundenem apo(a), wenn nur Kaninchen apoB vorlag. Die relativen Verhältnisse der verschiedenen molekularen Formen von apo(a) in den transgenen Kaninchen wurde aus Immunoblot durch densitometrisches Scanning von chemilumineszenten Filmen bestimmt. In apoB/apo(a)-Transgene migrierte etwa 20% des apo(a) konsistent als freies apo(a) (n = 3), wobei die restlichen 80% entweder an humanes oder Kaninchen-apoB kovalent gebunden zurückblieben. In apo(a)-transgenen Kaninchen wurde die umgekehrte Verteilung beobachtet (80% freies Protein und 20% an Kaninchen-apoB gebunden; n = 3). Obgleich diese Verhältnisse nicht streng quantitativ sind, legen die konsistenten Differenzen zwischen zwei Gruppen transgener Kaninchen, die dasselbe apo(a)-Transgen enthalten und ähnliche apo(a)-Gesamtlevel enthalten, nahe, dass apo(a) mit humanem apoB effizienter eine Disulfidverknüpfung bildet als Kaninchen-apoB.

Die Fähigkeit von Kaninchen-apoB zur Bildung einer kovalenten Verknüpfung mit apo(a) wurde erstmals durch in vitro-Studien nahe gelegt, die humane apo(a)-Wechselwirkungen mit apoB aus einer Reihe von Tieren nahe gelegt, wobei bewiesen wurde, dass Kaninchen-apoB unter bestimmten Bedingungen mit humanem apo(a) eine kovalente Wechselwirkung bilden kann (V. Trieu & W.J. McConathy, J. Biochem. (1995) 309, 899–904). Der Beweis eine Lp(a)-Zusammenbaus in den Kaninchen, die nur das apo(a)-Transgen exprimieren, untermauert diese Wechselwirkung unter in vivo-Bedingungen. Im Vergleich dazu enthielten Kaninchen, die sowohl humanes apoB- als auch apo(a)-Transgen enthielten, einen viel höheren Anteil an apo(a) in der Lp(a)-Form. Trotz adäquater Level an humanem apoB in den transgenen Kaninchen mit der apoB/apo(a)-Kombination blieben etwa 20% des apo(a) in nicht-kovalent gebundenem Zustand. Dies steht im Gegensatz zu den Bedingungen beim Menschen, wo das gesamte apo(a) kovalent an apoB gebunden ist, und das Vorliegen von freiem apo(a) nur in seltenen Fällen von Beta-Lipoproteinämie beobachtet wude (Menzel et al., J. Bio. Chem. (1990) 265, 981–986).

Beispiel 5: Fraktionierung von Plasmaproteinen und Cholesterinmessung

Frisch isoliertes Plasma wurde durch Gelpermeationschromatographie unter Verwendung einer Superose-6-Säule (Pharmacia) fraktioniert. 100 &mgr;l Plasma wurden auf die Säue injiziert und unter isokratischen Bedingungen mit einer Durchflussgeschwindigkeit von 40 &mgr;l pro min in GF2-Puffer (20 mM Tris, pH 8,0, 0,27 mM EDTA, 150 mM NaCl) laufen gelassen. Der Ausfluss wurde auf Extinktion bei 280 nm überwacht und 50 &mgr;l-Fraktionen wurden während des Laufs gesammelt und anschließend unter Verwendung eines handelsüblichen Cholesterinassaykits (Boehriner Mannheim) analysiert. 21 &mgr;l-Aliquot von Cholesterinhaltigen Fraktionen wurde verwendet, um das Vorliegen von apo(a) und Lp(a) unter Verwendung von Elektrophorese und Immunblotting, wie oben beschrieben, zu detektieren.

Um die Assoziierung von apo(a) mit Lipoproteinen in den transgenen Kaninchen weiter zu charakterisieren, wurden Lipoproteine durch Gelfiltrationschromatographie größenfraktioniert. Im Gegensatz zu Verfahren der Dichtegradientenzentrifugation können chromatographische Verfahren Lipoproteinkomplexe, die Proteine durch schwache nicht-kovalente Wechselwirkungen assoziiert enthalten, isolieren. Ein Immunblotting von auf diese Weise fraktioniertem Plasma zeigte, dass apo(a) in erster Linie in der LDL-Fraktion sowohl in humanes apoB/apo(a)- (5A) als auch apo(a)-transgenen Kaninchen (5B) vorlag. LDL-Fraktionen von kombiniert transgenen Kaninchen enthielten zwei unterschiedliche Banden mit hohem Molekulargewicht, die dem humanen apoB/apo(a)-Komplex und dem Kaninchen-apoB/apo(a)-Komplex entsprachen, die sich auf der Basis des niedrigeren Molekulargewichts von Kaninchen-apoB-100 (320 kD) unterschieden. Nicht-kovalent assoziiertes apo(a) wurde, obgleich es im Immunoblot von Gesamtplasma vorlag, in den LDL-Fraktionen von humanes apoB/apo(a)-transgenen Kaninchen nicht detektiert. LDL-Fraktionen von apo(a)-transgenen Kaninchen enthielten eine breite Bande, die einen Kaninchen-apoB/apo(a)-Komplex, begleitet mit einer relativ größeren Menge an apo(a) enthielt, der unter Elektrophoresebedingungen von LDL dissoziierte und als freies apo(a) bezeichnet wurde (5B). Diese Analyse bestätigte die Assoziierung von apo(a) mit Lipoproteinen, die sowohl humanes als auch Kaninchen-apoB enthalten, obgleich apo(a) im Fall von Kaninchen-apoB durch eine Disulfidbindung in einem viel niedrigeren Partikelverhältnis gebunden war.

In der vorliegenden Erfindung zeigte apo(a) spezifische, nicht-kovalente Wechselwirkungen mit apoB enthaltenden Lipoproteinen, was eine in hohem Maße konservierte Affinität zwischen apo(a) und apoB nahe legt, was den Resultaten früherer Untersuchungen der apo(a)-Wechselwirkungen mit apoB verschiedener anderer Spezies entspricht (Chiesa et al., J. Bio. Chem. (1993) 268, 23747–23750; V. Trieu & W.J. McConathy, Biochem. J. (1995) 309, 899–904). Dies wird durch die Beobachtung von nicht-kovalent assoziertem apo(a) in der LDL-Fraktion von apo(a)-transgenen Kaninchen gestützt. Solche nicht-kovalenten Wechselwirkungen zwischen apo(a) und apoB wurden vorgeschlagen, um einen Lp(a) -Zusammenbau zu erleichtern, indem Cysteinreste zur Disulfidbindungsbildung in Position gebracht werden (V. Trieu & W.J. McConathy, J. Biol. Chem. (1995) 270, 15471–15474). Im Plasma der apoB/apo(a)transgenen Kaninchen kann apo(a) in dieser nicht-kovalent gebundenen Form infolge der Fähigkeit von Kaninchen-apoB, wirksam etwas apo(a) in der Anfangsbindungsstufe einzufangen, fortbestehen, während eine Disulfidbindungsbildung aus diesem Zwischenprodukt mit viel geringerer Effizienz fortschreitet, da eine kovalente Bindung zwischen Cysteinen auftreten muss, die durch nicht-kovalente Wechselwirkungen nicht optimal positioniert sind.

Beispiel 6: Sequenzvergleich einer vermeintlichen apo(a)- Bindungsstelle in humanem und Kaninchen-apoB

Infolge der überraschenden Fähigkeit von Kaninchen-apoB im Gegensatz zu murinem apoB eine kovalente Bindung mit humanem apo(a) zu bilden, stellten wir einen Vergleich seiner Aminosäuresequenz innerhalb einer Region, die zu der Stelle der apo(a)-Anknüpfung in humanem apoB homolog ist. Da der relevante Teil von Kaninchen-apoB nicht beschrieben wurde, wurde die Carboxy-terminale Region eines Kaninchen-apoB-cDNA-Klons sequenziert. Die abgeleitete Proteinsequenz für KaninchenapoB ist in 6 gezeigt, und zwar angeordnet innerhalb einer Region mit signifikanter Homologie zu vier anderen beschriebenen apoB-Sequenzen, einschließlich der des Menschen (SEQ ID NO: 7–11). Wie in Nagern und Schweinen, zwei Säuger, in denen apoB sich als unfähig zur kovalenten Bindung mit humanem apo(a) in vitro erwiesen hat, fehlt Kaninchen-apoB ein Cystein in einer Position, die zur Stellung der apo(a)-Anheftung in humanem apoB homolog ist (cys4326). Diese Resultate legen im Gegensatz zu zwei früheren Berichten nahe, dass ein Cysteinrest in dieser Position für eine kovalente Wechselwirkung mit apo(a) erforderlich ist (M.J. Callow & E.M. Rubin, J. Biol. Chem. (1995) 270, 23914–23917; S.P.A. McCormick, J.K. Ng, S. Taylor, L.M. Flynn, R.E. Hammer & S.G. Young (1995) 92, 10147–10151) zeigen, dass Cysteine anderswo im Kaninchen-apoB-Molekül zur kovalenten Wechselwirkung mit apo(a) fähig sind.

SEQUENZPROTOKOLL

Anspruch[de]
  1. Transgenes Kaninchen, das in seiner genomischen DNA Sequenzen hat, die für humane Apolipoprotein (a)- und humane Apolipoprotein B-Polypeptide, die fähig sind, unter Herstellung von humanem Lipoprotein (a) zu kombinieren, codieren.
  2. Kaninchen nach Anspruch 1, wobei das Kaninchen menschenähnliche atherosklerotische Läsionen entwickelt, wenn es mit Cholesterin-reicher Nahrung gefüttert wird.
  3. Kaninchen nach Anspruch 1 oder Anspruch 2, wobei die DNA-Sequenzen aus der Gruppe, bestehend aus genomischer DNA und cDNA, ausgewählt sind.
  4. Kaninchen nach Anspruch 1 oder Anspruch 2, das Leberzellen hat, die die Sequenzen exprimieren.
  5. Kaninchen nach Anspruch 1 oder Anspruch 2, das Testis-Zellen hat, die die Sequenzen exprimieren.
  6. Kaninchen nach Anspruch 1, das während seiner Geschlechtsreife einen stabilen Plasmaspiegel an humanem Apolipoprotein (a)-Polypeptid hat.
  7. Verfahren zur Bestimmung, ob eine Verbindung eine Krankheit oder Störung, die mit Lipoprotein (a)-Expression oder -Metabolismus verknüpft ist, inhibieren kann, umfassend Vergleichen eines ersten transgenen Kaninchens, das fähig ist, humanes Lipoprotein (a) zu produzieren, und eine Krankheit oder Störung zeigt, die mit humanem Lipoprotein (a) verbunden ist und die mit der Verbindung behandelt worden ist, mit einem zweiten transgenen Kaninchen, das fähig ist, humanes Lipoprotein (a) zu produzieren und eine Krankheit oder Störung, die mit Lipoprotein (a) verbunden ist und die nicht mit der Verbindung behandelt worden ist, zeigt.
  8. Verfahren nach Anspruch 7, wobei die Krankheit oder Störung aus der Gruppe, bestehend aus Atherosklerose, kardiovaskulärer Erkrankung, Ischämie, Schlaganfall, Restenosierung, Erkrankung der Koronararterien, peripherer arterieller Verschlußkrankheit, Myokardinfarkt, Thrombose und einem unerwünschten Lipidprofil, ausgewählt ist.
  9. Verfahren zur Bestimmung, ob eine Verbindung eine Anordnung eines Lipoprotein (a)-Partikels inhibieren kann, umfassend Vergleichen des Spiegels der humanen Lipoprotein (a)-Produktion in einem ersten transgenen Kaninchen, das mit der Verbindung behandelt worden ist und das fähig ist, humanes Lipoprotein (a) zu produzieren, mit dem Level der Produktion an humanem Lipoprotein (a) in einem zweiten transgenen Kaninchen, das nicht mit der Verbindung behandelt worden ist und das fähig ist, humanes Lipoprotein (a) zu produzieren.
  10. Verfahren nach Anspruch 9, wobei die Verbindung aus der Gruppe, bestehend aus Antisense-Nukleinsäure und intrazellulären Bindungsproteinen, ausgewählt ist.
Es folgen 6 Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com