PatentDe  


Dokumentenidentifikation DE102004061846A1 13.07.2006
Titel Mehrfachpromotoren
Anmelder BASF AG, 67063 Ludwigshafen, DE
Erfinder Haefner, Stefan, 67063 Ludwigshafen, DE;
Schröder, Hartwig, Dr., 69226 Nußloch, DE;
Zelder, Oskar, Dr., 67346 Speyer, DE;
Klopprogge, Corinna, Dr., 68239 Mannheim, DE;
Herold, Andrea, Dr., 69124 Heidelberg, DE
Vertreter Reitstötter, Kinzebach & Partner (GbR), 81679 München
DE-Anmeldedatum 22.12.2004
DE-Aktenzeichen 102004061846
Offenlegungstag 13.07.2006
Veröffentlichungstag im Patentblatt 13.07.2006
IPC-Hauptklasse C12N 15/11(2006.01)A, F, I, 20051017, B, H, DE
IPC-Nebenklasse C12N 1/21(2006.01)A, L, I, 20051017, B, H, DE   
Zusammenfassung Die vorliegende Erfindung betrifft Mehrfachpromotoren und diese enthaltende Expressionseinheiten; deren Verwendung zur Regulation der Transkription und Expression von Genen; Expressionskassetten, die solche Mehrfachpromotoren oder Expressionseinheiten umfassen; Vektoren, welche solche Expressionskassetten enthalten; genetisch veränderte Mikroorganismen, welche solche Vektoren und/oder Expressionseinheiten enthalten; sowie Verfahren zur Herstellung von biosynthetischen Produkten durch Kultivierung der genetisch veränderten Mikroorganismen.

Beschreibung[de]

Die vorliegende Erfindung betrifft Mehrfachpromotoren und diese enthaltende Expressionseinheiten; deren Verwendung zur Regulation der Transkription und Expression von Genen; Expressionskassetten, die solche Mehrfachpromotoren oder Expressionseinheiten umfassen; Vektoren, welche solche Expressionskassetten enthalten; genetisch veränderte Mikroorganismen, welche solche Vektoren und/oder Expressionseinheiten enthalten; sowie Verfahren zur Herstellung von biosynthetischen Produkten durch Kultivierung der genetisch veränderten Mikroorganismen.

HINTERGRUND DER ERFINDUNG

Verschiedene biosynthetische Produkte werden über natürliche Stoffwechselprozesse in Zellen hergestellt und werden in vielen Industriezweigen verwendet, einschließlich der Nahrungsmittel-, Futtermittel-, Kosmetik-, Feed-, Food- und pharmazeutischen Industrie. Diese Substanzen, die zusammen als Feinchemikalien/Proteine bezeichnet werden, umfassen unter anderem organische Säuren, sowohl proteinogene als auch nicht-proteinogene Aminosäuren, Nukleotide und Nukleoside, Lipide und Fettsäuren, Diole, Kohlenhydrate, aromatische Verbindungen, Vitamine und Cofaktoren, sowie Proteine und Enzyme. Ihre Produktion erfolgt am zweckmäßigsten im Großmaßstab mittels Anzucht von Bakterienstämmen oder anderen Mikroorganismen, die entwickelt wurden, um große Mengen der jeweils gewünschten Substanz zu produzieren und zu sezernieren. Für diesen Zweck besonders geeignete Organismen sind coryneforme Bakterien, gram-positive nicht-pathogene Bakterien.

Es ist bekannt, dass Aminosäuren durch Fermentation von Stämmen coryneformer Bakterien, insbesondere Corynebacterium glutamicum, hergestellt werden können. Wegen der großen Bedeutung wird ständig an der Verbesserung der Herstellverfahren gearbeitet. Verfahrensverbesserungen können fermentationstechnische Maßnahmen, wie zum Beispiel Rührung und Versorgung mit Sauerstoff, oder die Zusammensetzung der Nährmedien, wie zum Beispiel die Zuckerkonzentration während der Fermentation, oder die Aufarbeitung zum Produkt, beispielsweise durch Ionenaustauschchromatographie aber auch Sprühtrocknung, oder die intrinsischen Leistungseigenschaften des Mikroorganismus selbst betreffen.

Seit einigen Jahren werden ebenfalls Methoden der rekombinanten DNA-Technik zur Stammverbesserung von Feinchemikalien/Proteine produzierender Stämme von Corynebacterium eingesetzt, indem man einzelne Gene amplifiziert und die Auswirkung auf die Produktion von Feinchemikalien/Proteine untersucht.

Andere Wege, um ein Verfahren für die Herstellung von Feinchemikalien oder Proteinen zu entwickeln, oder die Produktivität eines bereits existierenden Verfahrens für die Herstellung von Feinchemikalien oder Proteinen zu erhöhen bzw. zu verbessern, umfassen die Erhöhung bzw. die Veränderung der Expression eines oder mehrerer Gene und/oder die Beeinflussung der Translation einer mRNA durch geeignete Polynukleotidsequenzen. Beeinflussung kann in diesem Zusammenhang die Erhöhung, Verringerung oder auch andere Parameter der Expression von Genen, wie zeitliche Expressionsmuster, umfassen.

Dem Fachmann sind unterschiedliche Bestandteile von bakteriellen Regulationssequenzen bekannt. Man unterscheidet die Bindungsstellen von Regulatoren, auch Operatoren genannt, die Bindungsstellen von RNA-Polymerase-Holoenzymen, auch –35 und –10 Regionen genannt, und die Bindungsstelle von ribosomaler 16S-RNA, auch ribosomale Bindungsstelle (RBS) oder auch Shine-Dalgarno-Sequenz genannt.

In der Literatur (E. coli und S. typhimurium, Neidhardt F.C. 1995 ASM Press) wird beschrieben, dass sowohl die Zusammensetzung der Polynukleotidsequenz der Shine-Dalgarno-Sequenz, die Sequenzabfolge der Basen, aber auch der Abstand einer in der Shine-Dalgarno-Sequenz enthaltenen Polynukleotidsequenz zum Start-Codon einen wesentlichen Einfluss auf die Initiationstionsrate der Translation hat.

Nukleinsäuresequenzen mit Promotoraktivität können die Bildung von mRNA auf unterschiedliche Weise beeinflussen. Promotoren, deren Aktivität unabhängig von der physiologischen Wachstumsphase des Organismus sind, nennt man konstitutiv. Wiederum andere Promotoren reagieren auf externe chemische, wie physikalische Stimuli wie Sauerstoff, Metabolite, Hitze, pH, etc.. Wiederum andere zeigen in unterschiedlichen Wachstumsphasen eine starke Abhängigkeit ihrer Aktivität. Beispielsweise sind in der Literatur Promotoren beschrieben, die während der exponentiellen Wachstumsphase von Mikroorganismen eine besonders ausgeprägte Aktivität zeigen, oder aber auch genau in der stationären Phase des mikrobiellen Wachstums. Beide Charakteristika von Promotoren können für eine Produktion von Feinchemikalien und Proteine je nach Stoffwechselweg einen günstigen Einfluss auf die Produktivität haben.

In Corynebacterium-Spezies konnten bereits solche Nukleotidsequenzen isoliert werden, die für eine Erhöhung bzw. eine Abschwächung der Genexpression genutzt werden können. Diese regulierten Promotoren können die Rate, mit der ein Gen transkribiert wird, abhängig von den internen und/oder externen Bedingungen der Zelle erhöhen oder erniedrigen. Zum Teil kann die Anwesenheit eines bestimmten Faktors, bekannt als Induktor, die Rate der Transkription vom Promotor stimulieren. Induktoren können direkt oder aber indirekt die Transkription vom Promotor beeinflussen. Eine andere Klasse von Faktoren, bekannt als Suppressoren ist in der Lage, die Transkription vom Promotor zu reduzieren oder aber zu inhibieren. Wie auch die Induktoren, können auch die Suppressoren direkt oder indirekt wirken. Es sind jedoch auch Promotoren bekannt, die über die Temperatur reguliert werden. So kann der Level der Transkription solcher Promotoren zum Beispiel durch eine Erhöhung der Wachstumstemperatur über die normale Wachstumstemperatur der Zelle erhöht oder aber abgeschwächt werden.

Eine geringe Anzahl von Promotoren aus C. glutamicum wurde bis zum heutigen Tag beschrieben. Der Promotor des Malatsynthase-Gens aus C. glutamicum wurde in DE-A-44 40 118 beschrieben. Dieser Promotor wurde einem für ein Protein kodierendes Strukturgen vorgeschaltet. Nach Transformation eines solchen Konstrukts in ein coryneformes Bakterium wird die Expression des dem Promotor nachgeschalteten Strukturgens reguliert. Die Expression des Strukturgens wird induziert, sobald dem Medium ein entsprechender Induktor zugesetzt wird.

Reinscheid et al., Microbiology 145:503 (1999) haben eine transkriptionelle Fusion zwischen dem pta-ack Promotor aus C. glutamicum und einem Reportergen (Chloramphenicol Acetyltransferase) beschrieben. Zellen von C. glutamicum, die eine solche transkriptionelle Fusion enthalten, wiesen eine erhöhte Expression des Reportergens bei Wachstum auf Acetat-haltigem Medium auf. Im Vergleich dazu zeigten transformierte Zellen, die auf Glucose wuchsen, keine erhöhte Expression dieses Reportergens.

In Patek et al., Microbiology 142:1297 (1996) wurden einige DNA Sequenzen aus C. glutamicum beschrieben, die die Expression eines Reportergens in C. glutamicum Zellen verstärken können, beschrieben. Diese Sequenzen wurden miteinander verglichen, um Consensus-Sequenzen für C. glutamicum Promotoren zu definieren.

Weitere DNA-Sequenzen aus C. glutamicum, die zur Regulation der Genexpression genutzt werden können, sind in der WO 02/40679 beschrieben worden. Diese isolierten Polynukleotide stellen Expressionseinheiten aus Corynebacterium glutamicum dar, die entweder zur Erhöhung oder aber zur Verringerung einer Genexpression genutzt werden können. Weiterhin sind in dieser Druckschrift rekombinante Plasmide beschrieben, auf denen die Expressionseinheiten aus Corynebacterium glutamicum mit heterologen Genen assoziiert sind. Die hier beschrieben Methode, Fusion von einem Promotor aus Corynebacterium glutamicum mit einem hererlogen Gen, kann unter anderem zur Regulation der Gene der Aminosäurebiosynthese eingesetzt werden.

Aus den älteren, nicht vorveröffentlichten Patentanmeldungen DE-A-103 59 594, DE-A-103 59 595, DE-A-103 59 660 und DE-A-10 2004 035 065 sind spezielle Einzelpromotoren aus C. glutamicum bekannt.

KURZBESCHREINUNG DER ERFINDUNG

Der Erfindung lag die Aufgabe zugrunde weitere regulatorische Nukleinsäuresequenzen, insbesondere Promotorkonstrukte und/oder Expressionseinheiten mit vorteilhaften Eigenschaften, beispielsweise mit im Vergleich zum Ausgangspromotor erhöhter oder veränderter Transkriptionsaktivität und/oder Translationsaktivität, zur Verfügung zu stellen.

Die Aufgabe wurde erfindungsgemäß gelöst durch Bereitstellung einer Mehrfachpromotor-enthaltenden Expressionseinheit, umfassend in 5'-3'-Richtung ein Sequenzmodul der folgenden allgemeinen Formel (I) 5'-P1-(-Ax-Px-)n-Ay-Py-3'(I) worin

n für einen ganzzahligen Wert von 0 bis 10 steht;

Ax und Ay gleich oder verschieden sind und für eine chemische Bindung oder eine Linker-Nukleinsäuresequenz stehen;

P1, Px und Py für gleiche oder verschiedene Promotorsequenzen kodieren, welche wenigstens einen RNA-Polymerase-bindenden Bereich, wie z.B. die Kernregion, umfassen; und wenigstens Py einen, die Ribosomenbindung vermittelnden, 3'-terminalen Sequenzabschnitt umfasst. Einen derartigen, die Ribosomenbindung vermittelnden Sequenzabschnitt, können unabhängig voneinander auch P1 und einzelne oder alle Px aufweisen.

Gemäß einer Ausführungsform sind P1, Px und Py von gleichen oder verschiedenen eukaryotischen oder insbesondere prokaryotischen Organismen abgeleitet. Auch künstliche Promotoren sind brauchbar.

Gemäß einer bevorzugten Ausführungsform sind P1, Px und Py jeweils abgeleitet von einer zusammenhängenden Sequenz von 35 bis 500 Nukleotidresten, bevorzugt 35 bis 300 Nukleotidresten, noch bevorzugter 35 bis 210 Nukleotidresten und ganz besonders bevorzugt 35 bis 100 Nukleotidresten, die im Genom des Organismus 5'-stromaufwärts von der kodierenden Sequenz für ein Protein, z.B für ein an einem Biosyntheseweg des Organismus beteiligtes Protein, liegt.

Gemäß einer weiteren Ausführungsform sind P1, Px und Py der Expressionseinheit aus einem coryneformen Bakterium abgeleitet.

Gemäß einer bevorzugten Ausführungsform sind P1, Px und Py der Expressionseinheit unabhängig voneinander ausgewählt unter Promotorsequenzen für die kodierende Sequenz eines Proteins mit hoher Abundanz in einem eukaryotischen odder prokaryotischen Organismus, insbesondere in einem oryneformen Bakterium, wie z.B. in einem der Gattung Corynebacterium oder Brevibacterium, wie z.B. einer Spezies oder einem Stamm gemäß der Aufstellung in Tabelle 3.

Zusätzlich können einzelne oder alle dieser Promotorsequenzen ausgewählt sein unter Promotorsequenzen für die kodierende Sequenz eines in der Tabelle 1 aufgelisteten und an der Aminosäurebiosynthese eines Organismus beteiligten Proteins. Wenigstens einer der Promotoren der erfindungsgemäßen Expressionseinheit sollte dabei aber hohe Abundanz wie hierin definiert aufweisen.

Gemäß einer weiteren bevorzugten Ausführungsform sind P1, Px und Py der Expressionseinheit unabhängig voneinander ausgewählt unter den in 1 dargestellten Nukleotidsequenzen, beziehungsweise, wie später noch näher erläutert, abgeleitet von SEQ ID NO:1 (pGRO), SEQ ID NO:2 (pEFTs), SEQ ID NO:3 (pEFTu) und SEQ ID NO:4 (pSOD).

Gemäß einer weiteren Ausführungsform sind P1, Px und Py der Expressionseinheit unabhängig voneinander ausgewählt unter starken, konstitutiven oder regulierbaren Promotoren.

Die vorliegende Erfindung betrifft in einem weiteren Aspekt eine Expressionskassette, umfassend in 5'-3'-Richtung ein Sequenzmodul der folgenden allgemeinen Formel II: 5'-P1-(-Ax-Px-)n-Ay-Py-G-3'(II) worin

n, Ax, Ay, P1, Px und Py wie oben definiert sind und G für wenigstens eine kodierende Nukleinsäuresequenz steht, welche mit der 5'-stromaufwärts gelegenen regulatorischen Sequenz funktionell oder operativ verknüpft ist.

Gemäß einer bevorzugten Ausführungsform der Expressionskassette ist G ausgewählt unter

  • a) Nukleinsäuren kodierend ein Protein aus den Biosyntheseweg von proteinogenen und nicht-proteinogenen Aminosäuren,
  • b) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Nukleotiden und Nukleosiden,
  • c) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von organischen Säuren,
  • d) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Lipiden und Fettsäuren,
  • e) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Diolen,
  • f) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Kohlenhydraten,
  • g) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von aromatischen Verbindungen,
  • h) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Vitaminen,
  • i) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Cofaktoren,
  • j) Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Enzymen, und
  • k) Nukleinsäuren kodierend ein Protein aus dem Zentralstoffwechsel.

Gemäß einer besonders bevorzugten Ausführungsform der Expressionskassette ist G ausgewählt unter Nukleinsäuren für Proteine aus dem Biosyntheseweg von Aminosäuren, ausgewählt unter Aspartatkinase, Aspartat-Semialdehyd-Dehydrogenase, Diaminopimelat-Dehydrogenase, Diaminopimelat-Decarboxylase, Dihydrodipicolinate-Synthetase, Dihydrodipicolinate-Reduktase, Glycerinaldehyd-3-Phosphat-Dehydrogenase, 3-Phosphoglycerat-Kinase, Pyruvat-Carboxylase, Triosephosphat-Isomerase, Transkriptioneller Regulator LuxR, Transkriptioneller Regulator LysR1, Transkriptioneller Regulator LysR2, Malat-Quinon-Oxidoreduktase, Glucose-6-Phosphat-Deydrogenase, 6-Phosphogluconat-Dehydrognease, Transketolase, Transaldolase, Homoserin-O-Acetyltransferase, Cystahionin-gamma-Synthase, Cystathionin-beta-Lyase, Serin-Hydroxymethyltransferase, O-Acetylhomoserin-Sulfhydrylase, Methylen-Tetrahydrofolat-Reduktase, Phosphoserin-Aminotransferase, Phosphoserin-Phosphatase, Serin-Acetyl-Transferase, Homoserin-Dehydrogenase, Homoserin-Kinase, Threonin-Synthase, Threonin-Exporter-Carrier, Threonin-Dehydratase, Pyruvat-Oxidase, Lysin-Exporter, Biotin-Ligase, Cystein-Synthasel, Cystein-Synthase II, Coenzym B12-abhängige Methionin-Synthase, Coenzym B12-unabhängige Methionin-Synthase-Aktivität, Sulfatadenyltransferase Untereinheit 1 und 2, Phosphoadenosin Phosphosulfat Reduktase, Ferredoxin-sulfit-reductase, Ferredoxin NADP Reduktase, 3-Phosphoglycerat Dehydrogenase, RXA00655 Regulator, RXN2910-Regulator, Arginyl-t-RNA-Synthetase, Phosphoenolpyruvat-Carboxylase, Threonin Efflux-Protein, Serinhydroxymethyltransferase, Fruktose-1,6-bisphosphatase, Protein der Sulfat-Reduktion RXA077, Protein der Sulfat-Reduktion RXA248, Protein der Sulfat-Reduktion RXA247, Protein OpcA, 1-Phosphofruktokinase und 6-Phosphofruktokinase, Tetrahydropicolinat-Succinylase, Succinyl-aminoketopimelat-Aminotransferase, Succinyl-Diaminopimelat-Desuccinylase, Diaminopimelat-Epimerase, 6-Phosphogluconat-Dehydrogenase, Glucosephosphat-Isomerase, Phosphoglycerat-Mutase, Enolase, Pyruvat-Kinase, Aspartat-Transaminase, Malat-Enzym kodieren.

Die vorliegende Erfindung betrifft in einem weiteren Aspekt einen Vektor, der wenigstens eine der vorstehend genannten Expressionskassetten umfasst.

Gemäß einem noch weiteren Aspekt betrifft die vorliegende Erfindung einen genetisch veränderten Mikroorganismus, der mit wenigstens einem der vorstehend genannten Vektoren transformiert ist, oder wenigstens eine der vorstehend genannten Expressionskassetten, vorzugsweise in integrierter Form, enthält.

Gemäß einer Ausführungsform ist der genetisch veränderte Organismus von coryneformen Bakterien abgeleitet.

Gemäß einer bevorzugten Ausführungsform ist der genetisch veränderte Organismus von Bakterien der Gattung Corynebacterium oder Brevibacterium abgeleitet.

Gemäß einem weiteren Aspekt betrifft die vorliegende Erfindung ein Verfahren zur Herstellung eines biosynthetischen Produkts, wobei man einen der vorstehend genannten, genetisch veränderten Mikroorganismen kultiviert und das gewünschte Produkt aus der Kultur isoliert.

Gemäß einer Ausführungsform des Verfahrens ist das biosynthetische Produkt ausgewählt unter organischen Säuren, Proteinen, Nukleotiden und Nukleosiden, sowohl proteinogenen als auch nicht-proteinogenen Aminosäuren, Lipiden und Fettsäuren, Diolen, Kohlehydraten, aromatischen Verbindungen, Vitaminen und Cofaktoren, Enzymen und Proteinen. Ganz besonders bevorzugte Biosyntheseprodukte sind Lysin, Methionin, Threonin und Trehalose.

Gemäß einem weiteren Aspekt betrifft die vorliegende Erfindung die Verwendung einer erfindungsgemäßen Expressionseinheit zur Regulation einer Produkt-Biosynthese.

FIGURENBESCHREIBUNG

1 zeigt spezifische Sequenzen für vier Promotoren, welche zur Herstellung der in den Ausführungsbeispielen beschriebenen Mehrfachpromotoren verwendet wurden. Dargestellt sind die Promotorsequenzen für pEFTu (1A); für Promotor pGRO (1B), für Promotor pEFTs (1C) und für Promotor pSOD (1D). Für jeden Promotor sind zwei Sequenzen angegeben, die längere (obere Sequenz) gibt jeweils die vollständige Promotorsequenz einschließlich Ribosomenbindungsstelle (RBS), fett und kursiv gedruckt, an. Im Falle einer 3'-terminalen Anordnung des jeweiligen Promotors im erfindungsgemäßen Mehrfach-Promotorkonstrukt wird bevorzugt jeweils die längere Nukleotidsequenz (einschließlich RBS) verwendet. Promotorsequenzen, 5'-stromaufwärts zur 3'-terminalen Promotoreinheit umfassen keine RBS und wurden in der jeweils in zweiter Position angegebenen, verkürzten Nukleinsäuresequenz verwendet (ohne RBS). 3'-terminale, in Großbuchstaben und Fettschrift angegebene Teilsequenzen der kürzeren Promotorsequenzen können gegebenenfalls zusätzlich fehlen. Potenzielle „-10-Regionen" sind unterstrichen dargestellt.

DETAILLIERTE BESCHREIBUNG DER ERFINDUNG I. Allgemeine Definitionen:

Ein „biosynthetisches Produkt" im Sinne der Erfindung werden solche verstanden, die über natürliche Stoffwechselprozesse (Biosynthesewege) in Zellen produziert werden. Sie finden vielfältige Verwendung, insbesondere der Nahrungsmittel-, Futtermittel-, Kosmetik-, Feed-, Food- und pharmazeutischen Industrie. Diese Substanzen, die zusammen als Feinchemikalien/Proteine bezeichnet werden, umfassen unter anderem organische Säuren, sowohl proteinogene als auch nicht-proteinogene Aminosäuren, Nukleotide und Nukleoside, Lipide und Fettsäuren, Diole, Kohlenhydrate, aromatische Verbindungen, Vitamine und Cofaktoren, sowie Proteine und Enzyme.

Unter einem „Promotor", einer „Nukleinsäure mit Promotoraktivität" oder einer „Promotorsequenz" wird erfindungsgemäß eine Nukleinsäure verstanden, die in funktioneller Verknüpfung mit einer zu transkribierenden Nukleinsäure die Transkription dieser Nukleinsäure reguliert.

Sofern nicht ausdrücklich auf „Einzelpromotoren" Bezug genommen wird, umfasst der Begriff „Promotor" erfindungsgemäß je nach Zusammenhang auch die sequentielle Anordnung von mehr als einer Nukleinsäuresequenz (also „Mehrfachpromotoren"), von denen jede einzelne bei funktioneller Verknüpfung mit einer zu transkribierenden Nukleinsäure zur Regulation von deren Transkription befähigt wäre.

Der Begriff „Einzelpromotor" bezieht sich entsprechend auf eine einzige, zur Regulation der Transkription einer zu transkribierenden Nukleinsäure befähigte Nukleinsäuresequenz, die bei funktioneller Verknüpfung mit einer zu transkribierenden Nukleinsäuresequenz diese transkribieren kann.

Bei „Mehrfachpromotoren" sind mindestens zwei gleiche oder unterschiedliche Nukleinsäuresequenzen, von denen jede einzelne bei funktioneller Verknüpfung mit einer zu transkribierenden Nukleinsäure zur Regulation von deren Transkription befähigt wäre (Einzelpromotoren), sequentiell so verknüpft, dass ein Transkriptionsstart von wahlweise einer der Nukleinsäuresequenzen ein die zu transkribierende Nukleinsäure enthaltendes Transkript hervorbringen könnte. Zwischen jeweils zwei Einzelpromotoren können dabei weitere Sequenzen ohne Promotorfunktion eingefügt werden, beispielsweise ein Linker, der beispielsweise eine oder mehrere Restriktionsschnittstellen aufweist. Wahlweise können jeweils zwei Einzelpromotoren auch direkt miteinander verknüpft werden. Vorzugsweise enthalten die Mehrfachpromotoren nur eine Ribosomenbindungsstelle (RBS), insbesondere im Bereich des 3'-terminalen Endes des Promotors.

Unter Promotorsequenzen für die kodierende Sequenz eines Proteins mit „hoher Abundanz" versteht man insbesondere „starke Promotoren". Wenn man Mehrfachpromotoren zur Verstärkung von Genen einsetzen möchte, werden in geeigneter Weise bevorzugt solche starken Promotoren kombiniert. Starke Promotoren regulieren die Transkription von Genen derart, dass die Ablesehäufigkeit durch die RNA-Polymerase größer ist als bei der Mehrzahl der Gene des Organismus. In den meisten Fällen resultiert das Vorhandensein eines starken Promoters darin, dass auch eine große Menge an Transkript in der Zelle vorliegt. Wenn das Transkript in Relation zu den anderen zellulären Transkripten einen prozentual größeren Anteil einnimmt, spricht man von einem „abundanten Transkript". In Bakterien korreliert die Menge an Transkript und dem entsprechenden davon kodierten Protein in der Regel, d.h. „abundante Transkripte" führen meist auch zu „abundanten Proteinen". Im Folgenden ist beispielhaft eine Methode beschrieben, die die Identifizierung von „starken Promotoren" über die Abundanz von Proteinen erlaubt. Details zum methodischen Vorgehen sowie weitere Referenzen können z.B. aus Proteomics in Practice – A Laboratory Manual of Proteome Analysis (Autoren: R. Westermeier, T. Naven; Verlag: Wiley-VCH Verlag GmbH, 2002) entnommen werden. Die Bakterienzellen werden aufgeschlossen und die Proteine des Zellextraktes werden mittels 2D-Gelelektrophorese aufgetrennt. Anschließend werden die Proteine durch gängige Methoden, wie z.B. Coomassie-, Silber- oder Fluoreszenzfarbstofffärbung angefärbt. Dabei ist eine Überfärbung der Proteine zu vermeiden, um eine spätere Quantifizierung der einzelnen Proteinspots zu ermöglichen. Im Anschluss daran wird das Gel gescannt und das erhaltenen Bild mit Hilfe einer geeigneten Software (z.B. Melanie, Amersham Biosciences) ausgewertet. Dazu werden zunächst alle detektierbanen Spots identifiziert und das Spotvolumen bestimmt. Die Summe aller Spotvolumina entspricht in erster Annäherung dem Gesamtprotein. Mit Hilfe der Bildanalysesoftwane können dann die Spots mit besonders großen Spotvolumina ausgewählt werden. Beispielsweise können Spots mit Volumina, die mehr als 0.1 % des Gesamtspotvolumens einnehmen, als abundant bezeichnet werden. Anschließend werden Spots mit besonders abundanten Proteinen aus dem Gel ausgestochen. Normalerweise wird dann das im Gelstück vorhandene Protein proteolytisch verdaut (z.B. mit Trypsin) und die Molmasse der entstehenden Peptide, z.B. mit Hilfe von MALDI-ToF MS (Matrix assisted laser desonption ionization- Time of Flight Mass Spectrometry) bestimmt. Auf Basis der Molmasse von einigen der tryptischen Peptide des Proteins kann dann in Datenbankrecherchen das zugehörige Protein identifziert werden. Dies ist insbesondere dann möglich, wenn das Genom des zu untersuchenden Organismus sequenziert ist, wie das für C. glutamicum, E. coli und viele andere Bakterien der Fall ist. Auf Basis der Identität des Proteins kann dann das dieses Protein kodierende ORF (offenes Leseraster) bestimmt werden. In Bakterien liegen die dieses Gen regulierenden Promotoren meist direkt stromaufwärts vom Start-Codon. Daher befinden sich auch die „starken" Promoteren häufig in einem Bereich von ca. 200 Nukleotiden stromaufwärts des Start-Codons „abundanter" Proteine.

„Künstliche" Promotoren im Sinne der Erfindung umfassen insbesondere solche Sequenzen, die in situ keine Transkriptionsaktivität aufweisen, in einem anderen Sequenzkontext, wie insbesondere im Kontext einer erfindungsgemäßen Expressionseinheit oder Expressionskassette, transkriptionell aktiv sind.

Unter „Promotoraktivität" wird erfindungsgemäß die in einer bestimmten Zeit durch den Promotor gebildete Menge RNA, also die Transkriptionsrate verstanden.

Unter „spezifischer" Promotoraktivität wird erfindungsgemäß die in einer bestimmten Zeit durch den Promotor gebildete Menge RNA pro Promotor verstanden.

Bei einer „verursachten" Promotoraktivität oder Transkriptionsrate im Bezug auf ein Gen im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp die Bildung einer RNA verursacht, die im Wildtyp so nicht vorhanden war.

Bei einer „veränderten" Promotoraktivität oder Transkriptionsrate im Bezug auf ein Gen im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit die gebildete Menge der RNA verändert.

Unter „verändert" wird in diesem Zusammenhang bevorzugt erhöht oder erniedrigt verstanden.

Unter einer „funktionellen" oder „operativen" Verknüpfung versteht man in diesem Zusammenhang beispielsweise die sequentielle Anordnung einer der erfindungsgemäßen Nukleinsäuren mit Promotoraktivität und einer zu transkribierenden Nukleinsäuresequenz und ggf. weiterer regulativer Elemente, wie zum Beispiel Nukleinsäuresequenzen, die die Transkription von Nukleinsäuren gewährleisten, sowie zum Beispiel einen Terminator derart, dass jedes der regulativen Elemente seine Funktion bei der Transkription der Nukleinsäuresequenz erfüllen kann. Dazu ist nicht unbedingt eine direkte Verknüpfung im chemischen Sinne erforderlich. Genetische Kontrollsequenzen, wie zum Beispiel Enhancer-Sequenzen, können ihre Funktion auch von weiter entfernten Positionen oder gar von anderen DNA-Molekülen aus auf die Zielsequenz ausüben. Bevorzugt sind Anordnungen, in denen die zu transkribierende Nukleinsäuresequenz hinter (d.h. am 3'-Ende) der erfindungsgemäßen Promotorsequenz positioniert wird, so dass beide Sequenzen kovalent miteinander verbunden sind. Bevorzugt ist dabei der Abstand zwischen der Promotorsequenz und der transgen zu exprimierende Nukleinsäuresequenz geringer als 200 Basenpaare, besonders bevorzugt kleiner als 100 Basenpaare, ganz besonders bevorzugt kleiner als 50 Basenpaare.

Als Sequenz einer „ribosomalen Bindungsstelle" oder „Ribosomenbindungsstelle" (RBS) (oder als Shine-Dalgarno-Sequenz bezeichnet) im Sinne dieser Erfindung werden A/G-reiche Polynukleotidsequenzen verstanden, die sich bis zu 30 Basen stromauf des Initiationscodon der Translation befinden.

Unter „Transkription" wird erfindungsgemäß der Prozess verstanden, durch den ausgehend von einer DNA-Matrize ein komplementäres RNA-Molekül hergestellt wird. An diesem Prozess sind Proteine, wie die RNA-Polymerase, sogenannte Sigma-Faktoren und transkriptionelle Regulatorproteine beteiligt. Die synthetisierte RNA dient dann als Matrize im Prozess der Translation, der dann zum biosynthetisch aktiven Protein führt.

Unter einer „Kernregion" eines Promotors versteht man erfindungsgemäß eine zusammenhängende Nukleinsäuresequenz von etwa 20 bis 80, oder 30 bis 60 Nukleotiden, die wenigstens eine potentielle sogenannte „-10-Region" umfasst. Beispiele für potentielle -10-Regionen sind für einzelne bevorzugte Promotorsequenzen hierin beschrieben; vergleiche insbesondere 1. „-10-Regionen" werden auch als TATA-Boxen oder Pribnow-Schaller-Sequenzen bezeichnet. Jeder eingesetzte Promotor sollte mindestens eine dieser potentiellen -10-Regionen, wie z. B. 1, 2, 3, 4 oder 5, enthalten. Die Kernregion liegt 5'-stromaufwärts zur RBS und kann von dieser 1 bis 200 oder 10 bis 150 oder 20 bis 100 Nukleotidreste entfernt sein .

Unter einer „Expressionseinheit" wird erfindungsgemäß eine Nukleinsäure mit Expressionsaktivität verstanden, die einen Mehrfachpromotor, wie hierein definiert umfasst, und nach funktioneller Verknüpfung mit einer zu exprimierenden Nukleinsäure oder einem Gen, die Expression, also die Transkription und die Translation dieser Nukleinsäure oder dieses Gens reguliert. Man spricht deshalb auch in diesem Zusammenhang von einer „regulativen Nukleinsäuresequenz". Zusätzlich zum Mehrfachpromotor-Konstrukt können weitere, regulative Elemente, wie z.B. Enhancer, enthalten sein.

Unter einer „Expressionskassette" wird erfindungsgemäß eine Expressionseinheit verstanden, die mit der zu exprimierenden Nukleinsäure oder dem zu exprimierenden Gen funktionell verknüpft ist. Im Gegensatz zu einer Expressionseinheit umfasst eine Expressionskassette somit nicht nur Nukleinsäuresequenzen, welche Transkription und Translation regulieren, sondern auch die Nukleinsäuresequenzen, welche als Folge der Transkription und Translation als Protein exprimiert werden sollen.

Unter „Expressionsaktivität" wird erfindungsgemäß die in einer bestimmten Zeit durch die Expressionskassette bzw. deren Expressionseinheit gebildete Menge Protein, also die Expressionsrate verstanden.

Unter „spezifischer Expressionsaktivität" wird erfindungsgemäß die in einer bestimmten Zeit durch die Expressionskassette bzw. deren Expressionseinheit gebildete Menge Protein pro Expressionseinheit verstanden.

Bei einer „verursachten Expressionsaktivität" oder Expressionsrate im Bezug auf ein Gen im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp die Bildung eines Proteins verursacht, das im Wildtyp so nicht vorhanden war.

Bei einer „veränderten Expressionsaktivität" oder Expressionsrate im Bezug auf ein Gen im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit die gebildete Menge des Proteins verändert. Unter „verändert" wird in diesem Zusammenhang bevorzugt erhöht oder erniedrigt verstanden. Dies kann beispielsweise durch Erhöhung oder Reduzierung der spezifischen Aktivität der endogenen Expressionseinheit, beispielsweise durch Mutation, oder durch Stimulierung oder Hemmung erfolgen. Weiterhin kann die veränderte Expressionsaktivität oder Expressionsrate beispielsweise durch Regulation der Expression von Genen im Mikroorganismus durch erfindungsgemäße Expressionseinheiten erreicht werden, wobei die Gene im Bezug auf die Expressionseinheiten heterolog sind.

Die „Bildungsrate", mit der ein biosynthetisch aktives Protein hergestellt wird, ist ein Produkt aus der Rate der Transkription und der Translation. Beide Raten können erfindungsgemäß beeinflusst werden und damit die Rate der Bildung von Produkten/Feinchemikalien in einem Mikroorganismus beeinflussen.

Unter dem Begriff "Wildtyp" wird erfindungsgemäß der entsprechende Ausgangsmikroorganismus verstanden und muss nicht zwingend einem natürlich vorkommenden Organismus entsprechen.

Je nach Zusammenhang kann unter dem Begriff „Mikroorganismus" der Ausgangsmikroorganismus (Wildtyp) oder ein erfindungsgemäßer, genetisch veränderter Mikroorganismus oder beides verstanden werden.

Vorzugsweise und insbesondere in Fällen, in denen der Mikroorganismus oder der Wildtyp nicht eindeutig zugeordnet werden kann, wird unter "Wildtyp" für die Veränderung oder Verursachung der Promotoraktivität oder Transkriptionsrate, für die Veränderung oder Verursachung der Expressionsaktivität oder Expressionsrate und für die Erhöhung des Gehalts an biosynthetischen Produkten jeweils ein „Referenzorganismus" verstanden. In einer bevorzugten Ausführungsform ist dieser „Referenzorganismus" Corynebacterium glutamicum ATCC 13032 oder ein Mikroorganismus, der durch gezielte oder ungerichtete Mutation von ATCC 13032 abgeleitet ist.

Insbesondere werden „Ausgangsmikroorganismen" verwendet, die bereits in der Lage sind, das gewünschte Produkt (Feinchemikalie/Protein) herzustellen.

Unter einer „abgeleiteten" Sequenz, z.B. einer abgeleiteten Promotorsequenz, wird erfindungsgemäß, wenn keine anderen Angaben gemacht werden, eine Sequenz verstanden, die mit der Ausgangssequenz eine Identität von mindestens 80% oder mindestens 90%, insbesondere 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% und 99% aufweist.

Unter „Identität" zwischen zwei Nukleinsäuren wird die Identität der Nukleotide über die jeweils gesamte Nukleinsäurelänge verstanden, insbesondere die Identität, die durch Vergleich mit Hilfe der Vector NTI Suite 7.1 Software der Firma Informax (USA) unter Anwendung der Clustal Methode (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5(2):151-1) unter Einstellung folgender Parameter berechnet wird:

Multiple alignment parameter:

Gap opening penalty 10

Gap extension penalty 10

Gap separation penalty range 8

Gap separation penalty off

% identity for alignment delay 40

Residue specific gaps off

Hydrophilic residue gap off

Transition weighing 0

Pairwise alignment parameter:

FAST algorithm on

K-tuplesize 1

Gap penalty 3

Window size 5

Number of best diagonals 5

Unter "hybridisieren" versteht man die Fähigkeit eines Poly- oder Oligonukleotids unter stringenten Bedingungen an eine nahezu komplementäre Sequenz zu binden, während unter diesen Bedingungen unspezifische Bindungen zwischen nicht-komplementären Partnern unterbleiben. Dazu sollten die Sequenzen vorzugsweise zu 90–100%, komplementär sein. Die Eigenschaft komplementärer Sequenzen, spezifisch aneinander binden zu können, macht man sich beispielsweise in der Northern- oder Southern-Blot-Technik oder bei der Primerbindung in PCR oder RT-PCR zunutze.

Die „Hybridisierung" erfolgt erfindungsgemäß unter stringenten Bedingungen. Solche Hybridisierungsbedingungen sind beispielsweise bei Sambrook, J., Fritsch, E.F., Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2. Auflage, Cold Spring Harbor Laboratory Press, 1989, Seiten 9.31–9.57 oder in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1–6.3.6 beschrieben. Unter stringenten Hybridisierungs-Bedingungen werden insbesondere verstanden:

Die Inkubation bei 42°C über Nacht in einer Lösung bestehend aus 50 % Formamid, 5 × SSC (750 mM NaCl, 75 mM Tri-Natrium Citrat), 50 mM Natrium Phosphat (pH7,6), 5 × Denhardt Lösung, 10% Dextransulfat und 20 g/ml denaturierte, gescheerte Lachsspermien-DNA, gefolgt von einem Waschschritt der Filter mit 0,1 × SSC bei 65°C.

Unter einem „funktionell äquivalenten Fragment" werden für Nukleinsäuresequenzen mit Promotoraktivität Fragmente verstanden, die im wesentlichen die gleiche oder eine veränderte, niedrigere oder höhere spezifische Promotoraktivität aufweisen wie die Ausgangssequenz.

Unter „im wesentlichen gleich" wird eine spezifische Promotoraktivität verstanden die mindestens 50%, wie z.B. mindestens 60%, 70%, 80%, 90%, oder mindestens 95% der spezifischen Promotoraktivität der Ausgangssequenz aufweist.

II. Expressionseinheiten, Expressionskassetten und deren Komponenten a) Expressionseinheiten

Die vorliegende Erfindung betrifft unter anderem die Bereitstellung einer Mehrfachpromotor-enthaltenden Expressionseinheit, umfassend in 5'-3'-Richtung ein Sequenzmodul der folgenden allgemeinen Formel (I) 5'-P1-(-Ax-Px-)n-Ay-Py-3' worin

n für einen ganzzahligen Wert von 0 bis 10, wie z. B. 1, 2, 3, 4, 5 oder 6 steht;

Ax und Ay gleich oder verschieden sind und für eine chemische, insbesondere kovalente, Bindung oder eine chemisch, insbesondere kovalent eingebundene, Linker-Nukleinsäuresequenz stehen;

P1, Px und Py für gleiche oder verschiedene Promotorsequenzen kodieren, welche wenigstens einen RNA-Polymerase-bindenden Bereich, wie z.B. eine Kernregion, umfassen; und wenigstens, wie z.B. nur, Py einen, die Ribosomenbindung vermittelnden, 3'-terminalen Sequenzabschnitt umfasst.

Die Promotorsequenzen P1, Px und Py können von Genen aus Organismen abgeleitet, die für Proteine kodieren, welche an einem Biosyntheseweg des Organismus beteiligt sind. Die Promotorsequenzen liegen dabei im Genom des Organismus 20 bis 500 Nukleotidreste, oder 20 bis 300 Nukleotidreste, beispielsweise 20 bis 210 Nukleotidreste und insbesondere 20 bis 100 oder 35 bis 100 Nukleotidreste 5'-stromaufwärts von der kodierenden Sequenz des jeweiligen Proteins.

Beispiele für Sequenzen, von denen Promotorsequenzen P1, Px und Py abgeleitet werden können, sind die in folgender Tabelle 1 angeführten Gene.

Nichtlimitierende Beispiele für spezielle Promotorsequenzen sind abgeleitet von den Nukleinsäuresequenzen nach SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 und SEQ ID NO:4, sowie 1, ohne jedoch darauf beschränkt zu sein.

Dabei entspricht SEQ ID NO:1 der Sequenz, die stromauf gelegen ist von der kodierenden Region des GroES Chaperonins (pGRO), SEQ ID NO:2 der Sequenz, die stromauf gelegen ist von der kodierenden Region des Protein Elongations Faktor TS (pEFTs), SEQ ID NO:3 der Sequenz, die stromauf gelegen ist von der kodierenden Region des Protein Elongationsfaktor TU (pEFTu) und SEQ ID NO:4 der Sequenz, die stromauf gelegen ist von der kodierenden Region der Superoxiddismutase (pSOD), jeweils aus Corynebacterium glutamicum. SEQ. ID.NO. 1, SEQ ID NO:2, SEQ ID NO:3 und SEQ ID NO:4 entsprechen den Promotorsequenzen des Wildtyps.

Unter einer „abgeleiteten" Sequenz wird erfindungsgemäß eine Sequenz verstanden, die mit der Ausgangssequenz eine Identität von mindestens 80% oder mindestens 90%, wie 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% und insbesondere 99% aufweist. Dieser Identitätsgrad gilt insbesondere für die oben definierte „Kernregion" des jeweiligen Promotors. Außerhalb der jeweiligen Kernregion kann dabei der Identitätsgrad geringer sein, und im Bereich von 0 bis 80%, wie z.B. 10 bis 80%, 20 bis 70% , 30 bis 60% oder 40 bis 50% betragen.

Brauchbare Kernregionen liegen z.B.

für pGRO im Bereich von Position 50 bis 80 von SEQ ID NO:1;

für pEFTs im Bereich von Position 130 bis 170 von SEQ ID NO:2;

Für pEFTu im Bereich von Position 30 bis 110 von SEQ ID NO:3;

für pSOD im Bereich von Position 50 bis 100 von SEQ ID NO:4.

Die erfindungsgemäßen Expressionseinheiten enthalten insbesondere zwei oder mehr Nukleinsäuresequenzen mit Promotoraktivität,

  • a) vorzugsweise abgeleitet von gleichen oder verschiedenen Sequenzen, ausgewählt unter SEQ. ID. NO. 1, SEQ ID NO:2, SEQ ID NO:3 und SEQ ID NO:4; oder anderen Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz;
  • b) wobei gegebenenfalls eine oder mehrere dieser Sequenzen eine durch Substitution, Insertion, Inversion oder Deletion oder Addition von Nukleotiden abgeleitete Sequenz darstellen, die insbesondere im Kernbereich, eine Identität von mindestens 80 % auf Nukleinsäureebene mit einer vorzugsweise unter Sequenz SEQ ID NO: 1, 2, 3 oder 4 oder anderen Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz ausgewählten Sequenz aufweist,
  • c) oder wobei gegebenenfalls eine oder mehrere dieser enthaltenen Nukleinsäuresequenzen mit einer Sequenz unter stringenten Bedigungen hybridisiert, die zu einer der Nukleinsäuresequenzen gemäß SEQ ID NO: 1, 2, 3 oder 4 und oder zu anderen Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz komplementär ist,
  • d) oder wobei gegebenenfalls eine oder mehrere dieser enthaltenen Nukleinsäuresequenzen als „funktionell äquivalente Fragmente" der Sequenzen unter a), b) oder c) vorliegen.

Weitere natürliche Promotoren, die als Bestandteil eines erfindungsgemäßen Mehrfachpromotors brauchbar sind, lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, durch Identitätsvergleiche der Nukleinsäuresequenzen aus Datenbanken mit den vorstehend beschriebenen Sequenzen SEQ ID NO: 1, 2, 3 oder 4 oder gemäß 1 oder anderen Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz leicht auffinden.

Weitere geeignete natürliche Promotoren lassen sich ausgehend von den vorstehend beschriebenen Nukleinsäuresequenzen, insbesondere ausgehend von Sequenz SEQ ID NO: 1, 2, 3 oder 4 und/oder Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz aus verschiedenen Organismen, deren genomische Sequenz nicht bekannt ist, unter Anwendung von Hybridisierungstechniken in an sich bekannter Weise leicht auffinden.

Weitere geeignete natürliche Promotoren lassen sich auch nach dem Fachmann bekannten Methoden isolieren, wie sie z.B. in Cadenas et al (1991) Gene 98, 117–121; Eikmanns et al, (1991) Gene 102, 93–98.; Patek et al (1996) Microbiology 142, 1297–1309 oder Santamaria et al (1987) Gene 56, 199–208 beschrieben sind. Üblicherweise werden dazu sogenannte „Promoter probe" Vektoren verwendet, in die genomische Fragmente aus dem betreffenden Genom inseriert werden. Die Promoteraktivität eines einzelnen Fragmentes kann in dem genannten experimentellen Setup dann durch Messen der Aktivität eines nachgeschalteten Reportergens, z.B. Chloramphenicol-Acetyltransferase, bestimmt werden.

Die Erfindung umfasst daher auch die Kombination von solchen Promotoren, die hier nicht namentlich aufgeführt sind. Dies trifft auch zu für die Kombination von schon bekannten Einzelpromotoren, wie sie z.B. in (Patek et al (2003). J of Biotechnology 104, 311–323; Vasicova et al. (1999) J. Bacteriol 181, 6188–6191) beschrieben sind.

Ein weiterer Gegenstand der Erfindung betrifft daher Nukleinsäuren mit Promotoraktivität zum Einbau in eine erfindungsgemäße, Mehrfachpromotoren-enthaltende Expressionseinheit, wobei die Nukleinsäuren mit Promotoraktivität eine Nukleinsäuresequenz umfassen, die mit der Nukleinsäuresequenz SEQ ID NO: 1, 2, 3 oder 4 oder Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz unter stringenten Bedingungen hybridisiert. Diese Nukleinsäuresequenz umfasst mindestens 10, bevorzugt mehr als 12, 15, 30, 50 oder mehr als 150 Nukleotide.

Künstliche Promotorsequenzen zum Einbau in eine erfindungsgemäße, Mehrfachpromotor-enthaltende Expressionseinheit lassen sich ausgehend von der Sequenz SEQ ID NO: 1, 2, 3 oder 4 oder gemäß 1 und/oder Promotorsequenzen für Gene mit vergleichbarer oder höherer Abundanz durch künstliche Variation und Mutation, beispielsweise durch Addition, Substitution, Insertion, Inversion oder Deletion von einem oder mehreren, einzelnen oder zusammenhängenden Nukleotidresten leicht herstellen. (Patek et al (2003). J of Biotechnology 104, 311–323; Vasicova et al. (1999) J. bacteriol 181, 6188–6191) und darin genannte Referenzen).

Geeignete Ribosomenbindung vermittelnde 3'-terminale Sequenzabschnitte einer Promotorsequenz Py sind beispielsweise die RBS von pGRO: GGAGGGA; die RBS von pEFTs: AGGAGGA; die RBS von pEFTu: AGGAGGA; sowie die RBS von pSOD GGAGGGA (vgl. auch beiliegenden 1). Die theoretisch optimale RBS, d.h. die Sequenz die 100% komplementär ist zur Anti-Shine-Dalgarno-Sequenz auf der 16S rRNA von C. glutamicum lautet: 5' GAAAGGAGG 3'. Weitere geeignete RBS Sequenzabschnitte lassen sich beispielsweise durch künstliche Variation und Mutation, beispielsweise durch Substitution, Insertion, Inversion, Addition oder Deletion von Nukleotiden herstellen, oder über Homologievergleiche mit Promotorsequenzen in Datenbanken leicht auffinden.

Nichtlimitierende Beispiele für erfindungsgemäße, Mehrfachpromotoren-enthaltende Expressionseinheiten sind ausgewählt unter:

  • e) Sequenzen, kodierend für

    PeftuPsod, von Position 18 bis 390 in SEQ ID NO: 45;

    PsodPeftu, von Position 18 bis 395 in SEQ ID NO: 52;

    PgroPsod, von Position 18 bis 369 in SEQ ID NO: 55;

    PgroPsodPefts, von Position 11 bis 538 in SEQ ID NO: 59;

    PeftuPsodPefts; von Position 11 bis 559 in SEQ ID NO: 60; oder
  • f) von Sequenzen gemäß e) durch Substitution, Insertion, Inversion, Addition oder Deletion von Nukleotiden abgeleitete Sequenzen, die im Vergleich mit dieser Ausgangssequenz eine Identität von mindestens 80 % oder mindestens 90% auf Nukleinsäureebene aufweist; oder
  • g) Nukleinsäuresequenzen, die mit einer zu e) komplementären Sequenz unter stringenten Bedingungen hybridisiert; oder
  • h) „funktionell äquivalenten Fragmente" der vorstehend genannten Sequenzen e), f) und g).

Unter einem „funktionell äquivalenten Fragment", insbesondere gemäß den Ausführungsformen d) und h), werden für Expressionseinheiten, Fragmente verstanden, die im wesentlichen die gleiche oder eine höhere spezifische Expressionsaktivität aufweisen wie die Ausgangssequenz.

Unter „im wesentlichen gleich" wird eine spezifische Expressionsaktivität verstanden die mindestens 50%, vorzugsweise 60%, bevorzugter 70%, bevorzugter 80%, bevorzugter 90%, besonders bevorzugt 95% der spezifischen Expressionsaktivität der Ausgangssequenz aufweist.

Unter „Fragmente" werden Teilsequenzen der durch Ausführungsform a) bis h) beschriebenen Sequenzen verstanden. Vorzugsweise weisen diese Fragmente mehr als 10, bevorzugter aber mehr als 12,15, 30, 50 oder besonders bevorzugt mehr als 150 zusammenhängende Nukleotide der Ausgangssequenz auf.

Die erfindungsgemäßen Expressionseinheiten können vorzugsweise eines oder mehrere der folgenden genetischen Elemente umfassen: eine -10-Region; einen Transkriptionsstart, eine Enhancer Region; und eine Operator Region.

Vorzugsweise sind diese genetischen Elemente spezifisch für die Spezies Corynebacterien, speziell für Corynebacterium glutamicum.

Bakterielle Promotoren bestehen normalerweise aus drei RNA-Polymerase Erkennungsstellen, nämlich der -10-Region, der -35-Region und dem UP-Element. Diese Promotorelemente sind in E. coli stark konserviert, nicht jedoch in C. glutamicum. Dies trifft in besonderem Maße für die -35-Region zu. Diese kann daher oft gar nicht oder nur unzuverlässig von der Sequenz abgeleitet werden. Auch die -10-Region ist weniger stark konserviert als in Organismen mit AT-reichen Genomen. Als Konsensus-Sequenzen sind hier TGNGNTA(C/T)AATGG oder GNTANAATNG vorbeschrieben (Patek et al (2003), J. of Biotechnology 104, 311–323; Vasicova et al. (1999) J. Bacteriol 181, 6188–6191).

Es ist allgemein bekannt, dass bei Bakterien mit moderatem oder hohem GC-Gehalt (wie z.B. C. glutamicum) im allgemeinen eine hohe Variabilität in den Konsensus-Sequenzen auftritt (Bourn and Babb, 1995., Bashyam et al, 1996). Dies gilt besonders für die -35-Region, die daher oft nicht vorhergesagt werden kann. Dies ist z.B. in Patek et al (2003). J of Biotechnology 104, 325–334 beschrieben.

b) Expressionskassetten

Die Erfindung betrifft ferner die erfindungsgemäßen, Mehrfachpromotorenenthaltenden Expressionseinheiten, funktionell verknüpft mit einer translatierbaren Nukleinsäuresequenz. Diese zur Expression von Genen befähigten Konstrukte werden und im Rahmen der Erfindung auch als Expressionskassetten bezeichnet.

Unter einer „funktionellen Verknüpfung" versteht man in diesem Zusammenhang beispielsweise die sequentielle Anordnung einer der erfindungsgemäßen Expressionseinheiten und einer transgen zu exprimierenden Nukleinsäuresequenz und ggf. weiterer regulativer Elemente, wie zum Beispiel einem Terminator, derart, dass jedes der regulativen Elemente eine Funktion bei der transgenen Expression der Nukleinsäuresequenz erfüllen kann. Dazu ist nicht unbedingt eine direkte Verknüpfung im chemischen Sinne erforderlich. Genetische Kontrollsequenzen, wie zum Beispiel Enhancer- Sequenzen, können ihre Funktion auch von weiter entfernten Positionen oder gar von anderen DNA-Molekülen aus auf die Zielsequenz ausüben. Bevorzugt sind Anordnungen, in denen die transgen zu exprimierende Nukleinsäuresequenz hinter (d.h. am 3'-Ende) der erfindungsgemäßen Expressionseinheitssequenz positioniert wird, so dass beide Sequenzen kovalent miteinander verbunden sind. Bevorzugt ist dabei der Ab stand zwischen der Expressionseinheitssequenz und der transgen zu exprimierende Nukleinsäuresequenz geringer als 200 Basenpaare, besonders bevorzugt kleiner als 100 Basenpaare, ganz besonders bevorzugt kleiner als 50 Basenpaare.

Durch die erfindungsgemäßen, Mehrfachpromotoren enthaltenden Expressionskassetten wird die Möglichkeit geschaffen, eine im Vergleich zur ursprünglichen Expressionsaktivität unterschiedliche Expressionsaktivität zu erreichen und somit eine Feinregulierung der Expression des gewünschten Gens vorzunehmen.

Vorzugsweise wird die Regulation der Expression von Genen im Mikroorganismus durch erfindungsgemäße Expressionseinheiten dadurch erreicht, dass man

  • – eine oder mehrere erfindungsgemäße Expressionseinheiten, gegebenenfalls mit veränderter spezifischer Expressionsaktivität, in das Genom des Mikroorganismus einbringt, so dass die Expression eines oder mehrerer endogener Gene unter der Kontrolle der eingebrachten erfindungsgemäßen Expressionseinheiten erfolgt; oder
  • – ein oder mehrere Nukleinsäurekonstrukte, enthaltend eine erfindungsgemäße Expressionseinheit, gegebenenfalls mit veränderter spezifischer Expressionsaktivität, und funktionell verknüpft eine oder mehrere, zu exprimierende Nukleinsäuren, d.h. eine Expressionskassette; in den Mikroorganismus einbringt.

In den erfindungsgemäßen Expressionskassetten ist die physikalische Lage der Expressionseinheit relativ zum zu exprimierenden Gen so gewählt, dass die Expressionseinheit die Transkription und vorzugsweise auch die Translation des zu exprimierenden Gens reguliert und damit die Bildung eines oder mehrerer Proteine ermöglicht. Die "Bildung ermöglichen" beinhaltet dabei die konstitutive Steigerung der Bildung, Abschwächung bzw. Blockierung der Bildung unter spezifischen Bedingungen und/oder die Steigerung der Bildung unter spezifischen Bedingungen. Die "Bedingungen" umfassen dabei: (1) Zugabe einer Komponente zum Kulturmedium, (2) Entfernen einer Komponente vom Kulturmedium, (3) Austausch einer Komponente im Kulturmedium durch eine zweite Komponente, (4) Erhöhung der Temperatur des Kulturmediums, (5) Erniedrigung der Temperatur des Kulturmediums, und (6) Regulierung der atmosphärischen Bedingungen, wie z.B. die Sauerstoff- oder Stickstoffkonzentration, in der das Kulturmedium gehalten wird.

Allgemeine Angaben:

Alle vorstehend erwähnten Nukleinsäuren mit Promotoraktivität sowie Expressionseinheiten und Expressionskassetten sind weiterhin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen, wie beispielsweise durch Fragmentkondensation, einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die chemische Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, Voet, 2. Auflage, Wiley Press New York, S. 896–897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mithilfe des Klenow-Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine Klonierungsverfahren werden in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.

Für die vorliegende Erfindungen wurden Methoden und Techniken genutzt, die dem Fachmann, der in mikrobiologischen und rekombinanten DNA-Techniken geübt ist, bekannt sind. Methoden und Techniken für das Wachstum von Bakterienzellen, das Einschleusen von isolierten DNA-Molekülen in die Wirtszelle, und die Isolierung, Klonierung und Sequenzierung von isolierten Nukleinsäuremolekülen usw. sind Beispiele für solche Techniken und Methoden. Diese Methoden sind in vielen Standardliteraturstellen beschrieben: Davis et al., Basic Methods In Molecular Biology (1986); J. H. Miller, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1972); J.H. Miller, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1992); M. Singer and P. Berg, Genes & Genomes, University Science Books, Mill Valley, Carlifornia (1991); J. Sambrook, E.F. Fritsch and T. Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989); P.B. Kaufmann et al., Handbook of Molcular and Cellular Methods in Biology and Medicine, CRC Press, Boca Raton, Florida (1995); Methods in Plant Molecular Biology and Biotechnology, B.R. Glick and J.E. Thompson, eds., CRC Press, Boca Raton, Florida (1993); and P.F. Smith-Keary, Molecular Genetics of Escherichia coli, The Guilford Press, New York, NY (1989).

Alle Nukleinsäuremoleküle der vorliegenden Erfindung liegen bevorzugt in Form eines isolierten Nukleinsäuremoleküls vor. Ein "isoliertes" Nukleinsäuremolekül wird von anderen Nukleinsäuremolekülen abgetrennt, die in der natürlichen Quelle der Nukleinsäure zugegen sind und kann überdies im wesentlichen frei von anderem zellulären Material oder Kulturmedium sein, wenn es durch rekombinante Techniken hergestellt wird, oder frei von chemischen Vorstufen oder anderen Chemikalien sein, wenn es chemisch synthetisiert wird.

Die Erfindung umfasst weiterhin die zu den konkret beschriebenen Nukleotidsequenzen komplementären Nukleinsäuremoleküle oder einen Abschnitt davon.

Die erfindungsgemäßen Nukleotidsequenzen ermöglichen ferner die Erzeugung von Sonden und Primern, die zur Identifizierung und/oder Klonierung von homologer Sequenzen in anderen Zelltypen und Mikroorganismen verwendbar sind. Solche Sonden bzw. Primer umfassen gewöhnlich einen Nukleotidsequenzbereich, der unter stringenten Bedingungen an mindestens etwa 12, vorzugsweise mindestens etwa 25, wie z.B. etwa 40, 50 oder 75 aufeinanderfolgende Nukleotide eines Sense-Stranges einer erfindungsgemäßen Nukleinsäuresequenz oder eines entsprechenden Antisense-Stranges hybridisiert.

Erfindungsgemäß umfasst sind auch solche Nukleinsäuresequenzen, die sogenannte stumme Mutationen umfassen oder entsprechend der Codon-Nutzung eins speziellen Ursprungs- oder Wirtsorganismus, im Vergleich zu einer konkret genannten Sequenz verändert sind, ebenso wie natürlich vorkommende Varianten, wie z.B. Spleißvarianten oder Allelvarianten, davon.

III. Expressionsvektoren

Die Erfindung betrifft ferner Expressionsvektoren, enthaltend eine vorstehend beschriebene, erfindungsgemäße Expressionskassette.

Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen werden. Unter Vektoren sind außer Plasmiden auch alle anderen dem Fachmann bekannten Vektoren, wie beispielsweise Phagen, Transposons, IS-Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA zu verstehen. Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden.

Als Plasmide eignen sich solche besonders bevorzugt, die in coryneformen Bakterien repliziert werden. Zahlreiche bekannte Plasmidvektoren, wie z. B. pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549–554), pEKEx1 (Eikmanns et al., Gene 102: 93–98 (1991)) oder pHS2-1 (Sonnen et al., Gene 107: 69–74 (1991)) beruhen auf den kryptischen Plasmiden pHM1519, pBL1 oder pGA1. Andere Plasmidvektoren, wie z. B. pCLiK5MCS (siehe Beispiel 1), oder solche, die auf pCG4 (US-A 4,489,160) oder pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119–124 (1990)) oder pAG1 (US-A 5,158,891) beruhen, können in gleicher Weise verwendet werden.

Weiterhin eignen sich auch solche Plasmidvektoren mit Hilfe derer man das Verfahren der Genamplifikation durch Integration in das Chromosom anwenden kann, so wie es beispielsweise von Remscheid et al. (Applied and Environmental Microbiology 60,126–132 (1994)) zur Duplikation bzw. Amplifikation des hom-thrB-Operons beschrieben wurde. Bei dieser Methode wird das vollständige Gen in einen Plasmidvektor kloniert, der in einem Wirt (typischerweise E. coli), nicht aber in C. glutamicum replizieren kann. Als Vektoren kommen beispielsweise pSUP301 (Sirnon et al., Bio/Technology 1,784–791 (1983)), pK18mob oder pK19mob (Schäfer et al., Gene 145,69–73 (1994)), Bernard et al., Journal of Molecular Biology, 234: 534–541 (1993)), pEM1 (Schrumpf et al. 1991, Journal of Bacteriology 173: 4510–4516) oder pBGS8 (Spratt et al., 1986, Gene 41: 337–342) in Frage. Der Plasmidvektor, der das zu amplifizierende Gen enthält, wird anschließend durch Transformation in den gewünschten Stamm von C. glutamicum überführt. Methoden zur Transformation sind beispielsweise bei Thierbach et al. (Applied Microbiology and Biotechnology 29, 356–362 (1988)), Dunican und Shivnan (Biotechnology 7, 1067–1070 (1989)) und Tauch et al. (FEMS Microbiological Letters 123,343–347 (1994)) beschrieben.

IV. Gene und davon kodierte Proteine

Die Veränderung oder Verursachung der Transkriptionsrate und/oder der Translationsrate von Genen in Mikroorganismen im Vergleich zum Wildtyp kann dadurch erfolgen, dass man die Transkription von Genen im Mikroorganismus durch erfindungsgemäße Expressionseinheiten reguliert, wobei die Gene in Bezug auf die Expressionseinheiten heterolog sind.

Dies wird bevorzugt dadurch erreicht, dass man

  • – eine oder mehrere erfindungsgemäße Nukleinsäuren mit Promotoraktivität in das Genom des Mikroorganismus einbringt, so dass die Transkription eines oder mehrerer endogenen Gene unter der Kontrolle der eingebrachten Nukleinsäure mit Promotoraktivität, gegebenenfalls mit veränderter spezifischer Promotoraktivität, erfolgt oder
  • – ein oder mehrere Nukleinsäurekonstrukte, enthaltend eine erfindungsgemäße Nukleinsäure mit Promotoraktivität und funktionell verknüpft eine oder mehrere, zu transkribierende exogener oder endogener Nukleinsäuren, in den Mikroorganismus einbringt.

Werden ein oder mehrere Gene in das Genom eines Mikroorganismus eingebracht, so dass die Transkription eines oder mehrerer eingebrachter Gene unter der Kontrolle der erfindungsgemäßen Nukleinsäuren erfolgt, dann kann die Insertion so erfolgen, dass das Gen bzw. die Gene in kodierende oder nicht kodierende Bereiche integriert wird/werden. Vorzugsweise erfolgt die Insertion in nicht kodierende Bereiche.

Die Insertion von Nukleinsäurekonstrukten kann dabei chromosomal oder extrachromosomal erfolgen. Vorzugsweise erfolgt die Insertion der Nukleinsäurekonstrukte chromosomal. Eine „chromosomale" Integration ist die Insertion eines DNA-Fragmentes in das Chromosom einer Wirtszelle.

Unter „endogen" werden genetische Informationen, wie beispielsweise Gene, verstanden, die bereits im Wildtypgenom (wie oben definiert) enthalten sind.

Unter „exogen" werden genetische Informationen, wie beispielsweise Gene, verstanden, die im Wildtypgenom nicht enthalten sind. Werden exogene genetische Informationen, beispielsweise die erfindungsgemäßen Mehrfachpromotoren-enthaltenden Expressionseinheiten, in das Genom eines Wildtypstammes eingebracht und dadurch ein genetisch veränderter Stamm erzeugt, so sind diese genetischen Informationen im Vergleich des erstmals erzeugten genetischen Stammes mit seinen Nachkommen endogen, dagegen exogen im Vergleich mit dem ursprünglichen Wildtypstamm, der diese genetischen Informationen nicht enthielt.

Unter dem Begriff „Gene" in Bezug auf Regulation der Transkription durch die erfindungsgemäßen Nukleinsäuren mit Promotoraktivität werden vorzugsweise Nukleinsäuren verstanden, die einen zu transkribierenden Bereich, also beispielsweise einen Bereich der die Translation reguliert, einen kodierenden Bereich, sowie gegebenenfalls weitere Regulationselemente, wie beispielsweise einen Terminator, enthalten.

Unter dem Begriff „Gene" in Bezug auf die Regulation der Expression durch die erfindungsgemäßen Expressionseinheiten werden vorzugsweise Nukleinsäuren verstanden, die einen kodierenden Bereich, sowie gegebenenfalls weitere Regulationselemente, wie beispielsweise einen Terminator, enthalten.

Unter einem „kodierenden Bereich" wird eine Nukleinsäuresequenz verstanden, die ein Protein kodiert.

Unter „heterolog" in Bezug auf Nukleinsäuren mit Promotoraktivität und Gene wird verstanden, dass die verwendeten Gene im Wildtyp nicht unter Regulation der erfindungsgemäßen Nukleinsäuren mit Promotoraktivität transkribiert werden, sondern das eine neue, im Wildtyp nicht vorkommende funktionelle Verknüpfung entsteht und die funktionelle Kombination aus erfindungsgemäßer Nukleinsäure mit Promotoraktivität und spezifischem Gen im Wildtyp nicht vorkommt.

Unter „heterolog" in Bezug auf Expressionseinheiten und Gene wird verstanden, dass die verwendeten Gene im Wildtyp nicht unter Regulation der erfindungsgemäßen Expressionseinheiten exprimiert werden, sondern das eine neue, im Wildtyp nicht vorkommende funktionelle Verknüpfung entsteht und die funktionelle Kombination aus erfindungsgemäßer Expressionseinheit und spezifisches Gen im Wildtyp nicht vorkommt.

In einer bevorzugten Ausführungsform der vorstehend beschriebenen erfindungsgemäßen Verfahren zur Veränderung oder Verursachung der Transkriptionsrate und/oder Expressionsrate von Genen in Mikroorganismen sind die Gene ausgewählt aus der Gruppe Nukleinsäuren kodierend ein Protein aus den Biosyntheseweg von Feinchemikalien, wobei die Gene gegebenenfalls weitere Regulationselemente enthalten können.

In einer besonders bevorzugten Ausführungsform der vorstehend beschriebenen erfindungsgemäßen Verfahren zur Veränderung oder Verursachung der Transkriptionsrate und/oder Expressionsrate von Genen in Mikroorganismen sind die Gene ausgewählt unter:

Nukleinsäuren, kodierend ein Protein aus den Biosyntheseweg von proteinogenen und nicht-proteinogenen Aminosäuren, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Nukleotiden und Nukleosiden, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von organischen Säuren, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Lipiden und Fettsäuren, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Diolen, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Kohlenhydraten, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von aromatischen Verbindung, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Vitaminen, Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Cofaktoren und Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Enzymen, Nukleinsäuren kodierend ein Protein aus dem Zentralstoffwechsel, wobei die Gene gegebenenfalls weitere Regulationselemente enthalten können.

In einer besondere bevorzugten Ausführungsform sind die Proteine aus dem Biosyntheseweg von Aminosäuren ausgewählt, nämlich:

Aspartatkinase, Aspartat-Semialdehyd-Dehydrogenase, Diaminopimelat-Dehydrogenase, Diaminopimelat-Decarboxylase, Dihydrodipicolinate-Synthetase, Dihydrodipicolinate-Reduktase, Glycerinaldehyd-3-Phosphat-Dehydrogenase, 3-Phosphoglycerat-Kinase, Pyruvat-Carboxylase, Triosephosphat-Isomerase, Transkriptioneller Regulator LuxR, Transkriptioneller Regulator LysR1, Transkriptioneller Regulator LysR2, Malat-Quinon-Oxidoreduktase, Glucose-6-Phosphat-Deydrogenase, 6-Phosphogluconat-Dehydrognease, Transketolase, Transaldolase, Homoserin-O-Acetyltransferase, Cystahionin-gamma-Synthase, Cystahionin-beta-Lyase, Serin-Hydroxymethyltransferase, O-Acetylhomoserin-Sulfhydrylase, Methylen-Tetrahydrofolat-Reduktase, Phosphoserin-Aminotransferase, Phosphoserin-Phosphatase, Serin-Acetyl-Transferase, Homoserin-Dehydrogenase, Homoserin-Kinase, Threonin-Synthase, Threonin-Exporter-Carrier, Threonin-Dehydratase, Pyruvat-Oxidase, Lysin-Exporter, Biotin-Ligase, Cystein-Synthasel, Cystein-Synthase II, Coenzym B12-abhängige Methionin-Synthase, Coenzym B12-unabhängige Methionin-Synthase-Aktivität, Sulfatadenyltransferase Untereinheit 1 und 2, Phosphoadenosin Phosphosulfat Reduktase, Ferredoxin-sulfit-reductase, Ferredoxin NADP Reduktase, 3-Phosphoglycerat Dehydrogenase, RXA00655 Regulator, RXN2910-Regulator, Arginyl-t-RNA-Synthetase, Phosphoenolpyruvat-Carboxylase, Threonin Efflux-Protein, Serinhydroxymethyltransferase, Fruktose-1,6-bisphosphatase, Protein der Sulfat-Reduktion RXA077, Protein der Sulfat-Reduktion RXA248, Protein der Sulfat-Reduktion RXA247, Protein OpcA, 1-Phosphofruktokinase, 6-Phosphofruktokinase, Tetrahydropicolinat-Succinylase, Succinyl-aminoketopimelat-Aminotransferase, Succinyl-Diaminopimelat-Desuccinylase, Diaminopimelat-Epimerase, 6-Phosphogluconat-Dehydrogenase, Glucosephosphat-Isomerase, Phosphoglycerat-Mutase, Enolase, Pyruvat-Kinase, Aspartat-Transaminase, Malat-Enzym.

Bevorzugte Proteine und Nukleinsäuren, kodierend diese Proteine sind Proteinsequenzen bzw. Nukleinsäuresequenzen mikrobiellen Ursprungs, vorzugsweise aus Bakterien der Gattung Corynebacterium oder Brevibacterium, bevorzugt aus coryneformen Bakterien, besonders bevorzugt aus Corynebacterium glutamicum.

Beispiele für besonders bevorzugte Proteinsequenzen und die entsprechenden Nuk leinsäuresequenzen, kodierend diese Proteine aus dem Biosyntheseweg von Aminosäuren, deren Bezugsdokument, sowie deren Bezeichnung im Bezugsdokument sind in Tabelle 1 aufgelistet:

Tabelle 1

Aus den oben aufgelisteten Genen ist bevorzugt das erfindungsgemäß zu regulierende Target-Gen G ausgewählt.

Weitere besonders bevorzugte Proteinsequenzen aus dem Biosyntheseweg von Aminosäuren, weisen jeweils die in Tabelle 1 für dieses Protein angegebene Aminosäuresequenz auf, wobei das jeweilige Protein jeweils an mindestens einer der in Tabelle 2, Spalte 2 für diese Aminosäuresequenz angegebenen Aminosäurepositionen eine andere proteinogene Aminosäure aufweist als die jeweilige, in Tabelle 2, Spalte 3 in der gleichen Zeile angegebene Aminosäure. In einer weiter bevorzugten Ausführungsform, weisen die Proteine an mindestens einer der in Tabelle 2, Spalte 2 für die Aminosäuresequenz angegebenen Aminosäureposition die in Tabelle 2, Spalte 4 in der gleichen Zeile angegebene Aminosäure auf. Es handelt sich bei den in Tabelle 2 angegebenen Proteinen um mutierte Proteine des Biosyntheseweges von Aminosäuren, die besonders vorteilhafte Eigenschaften aufweisen und sich deshalb insbesondere zur Expression der entsprechenden Nukleinsäuren durch ein erfindungsgemäßes Promotorkonstrukt und zur Herstellung von Aminosäuren eignen. Beispielsweise führt die Mutation T311I zu einem Ausschalten der feedback-Inhibierung von ask.

Die entsprechenden Nukleinsäuren, die ein vorstehend beschriebenes mutiertes Protein aus Tabelle 2 kodieren, lassen sich durch übliche Verfahren herstellen.

Als Ausgangspunkt zur Herstellung der Nukleinsäuresequenzen, kodierend ein mutiertes Protein, eignet sich beispielsweise das Genom eines Corynebacterium glutamicum-Stammes, der von der American Type Culture Collection unter der Bezeichnung ATCC 13032 erhältlich ist oder die in Tabelle 1 in Bezug genommenen Nukleinsäuresequenzen. Für die Rückübersetzung der Aminosäuresequenz der mutierten Proteine in die Nukleinsäuresequenzen, kodierend diese Proteine ist es vorteilhaft, die codon usage desjenigen Organismus zu verwenden, in den die Nukleinsäuresequenz eingebracht werden soll oder in der die Nukleinsäuresequenz vorliegt. Beispielsweise ist es vorteihaft für Corynebacterium glutamicum die codon usage von Corynebacterium glutamicum zu verwenden. Die codon usage des jeweiligen Organismus lässt sich in an sich bekannter Weise aus Datenbanken oder Patentanmeldungen ermitteln, die zumindest ein Protein und ein Gen, das dieses Protein kodiert, aus dem gewünschten Organismus beschreiben.

Die Angaben in Tabelle 2 sind folgendermaßen zu verstehen:

In Spalte 1 "Identifikation" wird eine eindeutige Bezeichnung für jede Sequenz in Bezug auf Tabelle 1 aufgeführt.

In Spalte 2 "AS-POS" bezieht sich die jeweilige Zahl auf die Aminosäureposition der entsprechenden Polypeptidsequenz aus Tabelle 1. Eine "26" in der Spalte "AS-POS" bedeutet demzufolge die Aminosäureposition 26 der entsprechend angegebenen Polypeptidsequenz. Die Zählung der Position beginnt N-Terminal bei +1.

In Spalte 3 "AS-Wildtyp" bezeichnet der jeweilige Buchstabe die Aminosäure – dargestellt im Ein-Buchstaben-Code- an der in Spalte 2 angegebenen Position beim entsprechenden Wildtyp-Stamm der Sequenz aus Tabelle 1.

In Spalte 4 "AS-Mutante" bezeichnet der jeweilige Buchstabe die Aminosäure – dargestellt im Ein-Buchstaben-Code- an der in Spalte 2 angegebenen Position beim entsprechenden Mutanten-Stamm.

In Spalte 5 "Funktion" wird die physiologische Funktion der entsprechenden Polypeptidsequenz aufgeführt.

Für ein mutiertes Protein mit einer bestimmten Funktion (Spalte 5) und einer bestimmten Ausgangsaminosäuresequenz (Tabelle 1) werden in den Spalten 2,3 und 4 mindestens eine Mutation, bei einigen Sequenzen auch mehrere Mutationen beschrieben. Diese mehreren Mutationen beziehen sich immer auf die jeweils obenstehende, nächstliegendste Ausgangsaminosäuresequenz (Tabelle 1). Unter dem Begriff „mindestens eine der Aminsäurepositionen" einer bestimmten Aminosäuresequenz wird vorzugsweise mindestens eine der für diese Aminosäuresequenz in Spalte 2, 3 und 4 beschriebenen Mutationen verstanden.

Ein-Buchstaben-Code der proteinogenen Aminosäuren:
Tabelle 2
Genetisch veränderte Mikroorganismen

Das Einbringen der erfindungsgemäßen Expressionseinheiten, der vorstehend beschriebenen Gene und der vorstehend beschriebenen Nukleinsäurekonstrukte oder Expressionskassetten in den Mikroorganismus, insbesondere in coryneforme Bakterien, erfolgt nach dem Fachmann bekannten Methoden, wie Konjugation oder Elektroporation (wie z.B. Liebl et al (1989) FEMS Microbiology Letters 53, 299–303).

Die Selektion von integrierten Expressionskassetten erfolgt vorzugsweise durch die SacB-Methode. Die SacB-Methode ist dem Fachmann bekannt und beispielsweise in Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A.; Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum, Gene. 1994 Jul 22;145(1):69–73 und Blomfield IC, Vaughn V, Rest RF, Eisenstein Bl.; Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC101 replicon; Mol Microbiol. 1991 Jun;5(6):1447–57 beschrieben.

Bevorzugt werden erfindungsgemäß als Ausgangsmikroorganismen solche verwendet, welche das gewünschte Wertprodukt (Feinchemikalie/Protein) bereits produzieren.

Die Erfindung betrifft daher auch einen genetisch veränderten Mikroorganismus, der eine erfindungsgemäße Expressionskassette oder einen die erfindungsgemäße Expressionskassette umfassenden Vektor enthält.

Besonders bevorzugt betrifft die vorliegende Erfindung genetisch veränderte Mikroorganismen, insbesondere coryneforme Bakterien, die einen Vektor, insbesondere Pendelvektor oder Plasmidvektor, der wenigstens eine erfindungsgemäße Expressionskassette trägt, enthalten.

Bevorzugte Mikroorganismen oder genetisch veränderte Mikroorganismen sind Bakterien, Algen, Pilze oder Hefen.

Besonders bevorzugte Mikroorganismen sind insbesondere coryneforme Bakterien.

Bevorzugte coryneforme Bakterien sind Bakterien der Gattung Corynebacterium, insbesondere der Arten Coerynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola und Corynebacterium efficiens oder der Gattung Brevibacterium, insbesondere der Arten Brevibacterium flavum, Brevibacterium lactofermentum und Brevibacterium divaricatum.

Besonders bevorzugte Bakterien der Gattungen Corynebacterium und Brevibacterium sind ausgewählt aus der Gruppe Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Corynebacterium melassecola ATCC 17965, Corynebacterium efficiens DSM 44547, Corynebacterium efficiens DSM 44548. Corynebacterium efficiens DSM 44549, Brevibacterium flavum ATCC 14067, Brevibacterium lactofermentum ATCC 13869, Brevibacterium divaricatum ATCC 14020, Corynebacterium glutamicum KFCC10065 und Corynebacterium glutamicum ATCC 21608 sowie Stämme, die davon abgeleitet sind, z.B. durch klassische Mutation und Selektion oder durch gerichtete Mutation.

Mit der Abkürzung KFCC ist die Korean Federation of Culture Collection gemeint, mit der Abkürzung ATCC die American type strain culture collection, mit der Abkürzung DSM (bzw. DSMZ) die Deutsche Sammlung von Mikroorganismen (Deutsche Sammlung von Mikroorganismen und Zellkulturen).

Weitere besonders bevorzugte Bakterien der Gattungen Corynebacterium und Brevibacterium sind in Tabelle 3 aufgelistet:

Tabelle 3

Die Abkürzungen haben folgende Bedeutung:

ATCC:
American Type Culture Collection, Rockville, MD, USA
FERM:
Fermentation Research Institute, Chiba, Japan
NRRL:
ARS Culture Collection, Northern Regional Research Laboratory, Peoria, IL, USA
CECT:
Coleccion Espanola de Cultivos Tipo, Valencia, Spain
NCIMB:
National Collection of Industrial and Marine Bacteria Ltd., Aberdeen, UK
CBS:
Centraalbureau voor Schimmelcultures, Baarn, NL
NCTC:
National Collection of Type Cultures, London, UK
DSMZ:
Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany

Besonders bevorzugt sind dabei Mikroorganismen der Bakterien der Gattung Corynebacterium, insbesondere diejenigen, die bereits in der Lage sind, L-Lysin, L-Methionin und/oder L-Threonin herzustellen. Dies sind insbesondere Corynebakterien bei denen beispielsweise das Gen kodierend für eine Aspartatkinase (ask-Gen) dereguliert ist oder die feed-back-Inhibierung aufgehoben oder reduziert ist. Beispielsweise weisen solche Bakterien im ask-Gen eine Mutation auf, die zu einer Reduzierung oder Aufhebung der feed-back-Inhibierung führen, wie beispielsweise die Mutation T311I.

Durch die erfindungsgemäßen Expressionseinheiten ist es möglich, in den vorstehend beschriebenen, erfindungsgemäßen genetisch veränderten Mikroorganismen die Stoffwechselwege zu spezifischen biosynthetischen Produkten zu regulieren.

Dazu werden beispielsweise Stoffwechselwege, die zu einem spezifischen biosynthetischen Produkt führen, durch Verursachung oder Erhöhung der Transkriptionsrate bzw. Expressionsrate von Genen dieses Biosyntheseweges verstärkt in dem die erhöhte Proteinmenge zu einer erhöhten Gesamtaktivität dieser Proteine des gewünschten Biosyntheseweges und damit zu einem verstärkten Stoffwechselfluss zu dem gewünschten biosynthetischen Produkt führt.

Weiterhin können Stoffwechselwege, die von einem spezifischen biosynthetischen Produkt wegführen, durch Reduzierung der Transkriptionsrate bzw. Expressionsrate von Genen dieses wegführenden Biosyntheseweges abgeschwächt werden in dem die reduzierte Proteinmenge zu einer reduzierten Gesamtaktivität dieser Proteine des unerwünschten Biosyntheseweges und damit zusätzlich zu einem verstärkten Stoffwechselfluss zu dem gewünschten biosynthetischen Produkt führt.

Die erfindungsgemäßen genetisch veränderten Mikroorganismen sind beispielsweise in der Lage aus Glucose, Saccharose, Lactose, Fructose, Maltose, Melasse, Stärke, Cellulose oder aus Glycerin und Ethanol biosynthetische Produkte herzustellen.

Die Erfindung betrifft daher ein Verfahren zur Herstellung von biosynthetischen Produkten durch Kultivierung von erfindungsgemäßen, genetisch veränderten Mikroorganismen.

Je nach gewünschtem biosynthetischen Produkt muss die Transkriptionsrate bzw. Expressionsrate verschiedener Gene erhöht bzw. reduziert werden. In der Regel ist es vorteilhaft die Transkriptionsrate bzw. Expressionsrate mehrere Gene zu verändern, d.h. die Transkriptionsrate bzw. Expressionsrate einer Kombination von Gene zu Erhöhen und/oder die Transkriptionsrate bzw. Expressionsrate einer Kombination von Gene zu reduzieren.

In den erfindungsgemäßen genetisch veränderten Mikroorganismen ist mindestens eine veränderte, das heißt erhöhte oder reduzierte Transkriptionsrate bzw. Expressionsrate eines Gens auf eine erfindungsgemäße Nukleinsäure mit Promotoraktivität bzw. erfindungsgemäße Expressionseinheit zurückzuführen.

Weitere, zusätzliche veränderte, d.h. zusätzlich erhöhte oder zusätzlich reduzierte Transkriptionsraten bzw. Expressionsraten von weiteren Genen im genetisch veränderten Mikroorganismus können, müssen aber nicht auf die erfindungsgemäßen Nukleinsäuren mit Promotoraktivität bzw. die erfindungsgemäßen Expressionseinheiten zurück gehen.

Die Erfindung betrifft deshalb weiterhin ein Verfahren zur Herstellung von biosynthetischen Produkten durch Kultivierung von erfindungsgemäßen, genetisch veränderten Mikroorganismen.

V. Anwendungsgebiete der Erfindung

Die erfindungsgemäßen Mehrfachpromotoren-enthaltenden Expressionseinheiten, Expressionskassetten und Vektoren lassen sich beispielsweise besonders vorteilhaft in verbesserten Verfahren zur fermentativen Herstellung von biosynthetischen Produkten wie nachstehend beschrieben verwenden.

Die erfindungsgemäßen Mehrfachpromotoren-enthaltenden Expressionseinheiten oder diese umfassende Expressionskassetten weisen insbesondere den Vorteil auf, dass sie eine Modulation der Expression des funktionell verknüpften Strukturgens erlauben.

Die erfindungsgemäßen Expressionseinheiten oder diese umfassende Expressionskassetten können zur Veränderung, also zur Erhöhung oder Reduzierung, oder zur Verursachung der Expressionsrate von Genen in Mikroorganismen im Vergleich zum Wildtyp verwendet werden. Dadurch wird die Möglichkeit bereitgestellt, im Falle einer Erhöhung der Expressionsrate die Expression des betreffenden Gens zu maximieren. Durch Wahl einer geeigneten Expressionseinheit kann die Expression aber auch in einer Stärke erfolgen, die unter dem durch eine andere Expressionseinheit erhältlichen Maximalwert liegt, gleichzeitig aber das Expressionsprodukt in einer für den exprimierenden Mikroorganismus verträglicheren Menge liefert. Dies ist insbesondere dann vorteilhaft, wenn zu hohe Konzentrationen an Expressionsprodukt für den exprimierenden Mikroorganismus toxisch sind. Die erfindungsgemäßen Expressionseinheiten ermöglichen somit durch Auswahl unter Expressionseinheiten mit jeweils unterschiedlicher Expressionsstärke die Feinregulierung der Expression auf einen – insbesondere bei Langzeitexpression – optimierten Wert.

Ferner können die erfindungsgemäßen Expressionseinheiten bzw. diese Expressionseinheiten umfassende Expressionskassetten zur Regulation und Verstärkung der Bildung von verschiedenen biosynthetischen Produkten, wie beispielsweise Feinchemikalien, Proteinen, insbesondere Aminosäuren, in Mikroorganismen, insbesondere in Corynebacterium Species dienen.

Die Erfindung betrifft daher die Verwendung einer erfindungsgemäßen, Mehrfachpromotoren-enthaltenden Expressionseinheit zur Regulation einer Produkt-Biosynthese. Dabei wird das Gen eines an der Regulation einer Produkt-Biosynthese beteiligten Proteins unter die Kontrolle einer solchen Expressionseinheit gestellt. Die Produkt-Biosynthese wird in Abhängigkeit der Transkriptionsrate der ausgewählten, Mehrfachpromotoren-enthaltenden Expressionseinheit beeinflusst. Alternativ kann das Gen eines an der Regulation einer Produkt-Biosynthese beteiligten Proteins als Bestandteil einer erfindungsgemäßen Expressionskassette in einem Mikroorganismus exprimiert werden und die Regulation der Produkt-Biosynthese durch das dadurch exprimierte Protein erfolgen. Wenn die Aktivität eines Mehrfachpromotors schwächer ist als die des endogenen Promotors, kann ein Mehrfachpromotor auch dazu eingesetzt werden, gezielt ungewollte Biosynthesewege abzuschwächen.

Weiterhin kann die Regulation der Transkriptionsrate einer erfindungsgemäßen, Mehrfachpromotoren enthaltenden Expressionseinheit durch gezielte Mutation eines oder mehrerer Einzelpromotoren erfolgen, aus denen der Mehrfachpromotor zusammengesetzt ist. Eine erhöhte bzw. erniedrigte Promotoraktivität kann dadurch erreicht werden, dass Nukleotide in der Bindungsstelle des RNA-Polymerase-Holoenzym-Bindungsstellen (dem Fachmann auch als -10-Region und -35 Region bekannt) ausgetauscht werden. Weiterhin kann eine Beeinflussung dadurch erfolgen, dass der Abstand der beschriebenen RNA-Polymerase-Holoenzym-Bindungsstellen zueinander durch Deletionen von Nukleotiden oder Insertionen von Nukleotiden verkleinert oder vergrößert werden. Weiterhin dadurch dass Bindungsstellen (dem Fachmann auch als -Operatoren bekannt) für Regulationsproteine (dem Fachmann bekannt als Repressoren und Aktivatoren) in räumliche Nähe an die Bindungsstellen des RNA-Polymerase-Holoenzyms gebracht werden, dass diese Regulatoren nach Bindung an eine Promotor-Sequenz die Bindung des und Transkriptionsaktivität des RNA-Polymerase-Holoenzyms abschwächen oder verstärken, oder auch unter einen neuen regulatorischen Einfluss stellen. Die Translationsaktivität kann auch durch Mutation des Ribosomenbindung vermittelnden, 3'-terminalen Sequenzabschnitts eines Einzelpromotors Py innerhalb der erfindungsgemäßen, Mehrfachpromotoren-enthaltenden Expressionseinheit beeinflusst werden.

VI. Biosynthetische Produkte und bevorzugte Herstellungsverfahren

Bevorzugte erfindungsgemäß hergestellte biosynthetische Produkte sind Feinchemikalien.

Der Begriff "Feinchemikalie" ist dem Fachmann geläufig und beinhaltet Verbindungen, die von einem Organismus produziert werden und in verschiedenen Industriezweigen Anwendungen finden, wie beispielsweise, jedoch nicht beschränkt auf die pharmazeutische Industrie, die Landwirtschafts-, Kosmetik , Food und Feed-Industrie. Diese Verbindungen umfassen organische Säuren, wie beispielsweise Milchsäure, Bernsteinsäure, Weinsäure, Itaconsäure und Diaminopimelinsäure, sowohl proteinogene als auch nicht-proteinogene Aminosäuren, Purin- und Pyrimidinbasen, Nukleoside und Nukleotide (wie bspw. beschrieben in Kuninaka, A. (1996) Nucleotides and related compounds, S. 561–612, in Biotechnology Bd. 6, Rehm et al., Hrsg. VCH: Weinheim und den darin enthaltenen Zitaten), Lipide, gesättigte und ungesättigte Fettsäuren (bspw. Arachidonsäure), Diole (bspw. Propandiol und Butandiol), Kohlenhydrate (bspw. Hyaluronsäure und Trehalose), aromatische Verbindungen (bspw. aromatische Amine, Vanillin und Indigo), Vitamine und Cofaktoren (wie beschrieben in Ullmann's Encyclopedia of Industrial Chemistry, Bd. A27, "Vitamins", S. 443–613 (1996) VCH: Weinheim und den darin enthaltenen Zitaten; und Ong, A.S., Niki, E. und Packer, L. (1995) "Nutrition, Lipids, Health and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia and the Society for Free Radical Research – Asien, abgehalten am 1.–3. Sept. 1994 in Penang, Malysia, AOCS Press (1995)), Enzyme und sämtliche anderen von Gutcho (1983) in Chemicals by Fermentation, Noyes Data Corporation, ISBN: 0818805086 und den darin angegebenen Literaturstellen, beschriebenen Chemikalien.

Besonders bevorzugte biosynthetische Produkte sind ausgewählt aus der Gruppe organische Säuren, Proteine, Nukleotide und Nukleoside, sowohl proteinogene als auch nicht-proteinogene Aminosäuren, Lipide und Fettsäuren, Diole, Kohlehydrate, aromatische Verbindungen, Vitamine und Cofaktoren, Enzyme und Proteine.

Bevorzugte organische Säuren sind Milchsäure, Bernsteinsäure, Weinsäure, Itaconsäure und Diaminopimelinsäure.

Bevorzugte Nukleoside und Nukleotide sind beispielsweise beschrieben in Kuninaka, A. (1996) Nucleotides and related compounds, S. 561–612, in Biotechnology Bd. 6, Rehm et al., Hrsg. VCH: Weinheim und den darin enthaltenen Zitaten.

Bevorzugte biosynthetische Produkte sind weiterhin Lipide, gesättigte und ungesättigte Fettsäuren, wie beispielsweise Arachidonsäure, Diole wie beispielsweise Propandiol und Butandiol, Kohlenhydrate, wie beispielsweise Hyaluronsäure und Trehalose, aromatische Verbindungen, wie beispielsweise aromatische Amine, Vanillin und Indigo, Vitamine und Cofaktoren, wie beispielsweise beschrieben in Ullmann's Encyclopedia of Industrial Chemistry, Bd. A27, "Vitamins", S. 443–613 (1996) VCH: Weinheim und den darin enthaltenen Zitaten; und Ong, A.S., Niki, E. und Packer, L. (1995) "Nutrition, Lipids, Health and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia and the Society for Free Radical Research – Asien, abgehalten am 1.–3. Sept. 1994 in Penang, Malysia, AOCS Press (1995)), Enzyme Polyketide (Cane et al. (1998) Science 282: 63–68), und sämtliche anderen von Gutcho (1983) in Chemicals by Fermentation, Noyes Data Corporation, ISBN: 0818805086 und den darin angegebenen Literaturstellen, beschriebenen Chemikalien.

Besonders bevorzugte biosynthetische Produkte sind Aminosäuren, besonders bevorzugt essentielle Aminosäuren, insbesondere L-Glycin, L-Alanin, L-Leucin, L-Methionin, L-Phenylalanin, L-Tryptophan, L-Lysin, L-Glutamin, L-Glutaminsäure, L-Serin, L-Prolin, L-Valin, L-Isoleucin, L-Cystein, L-Tyrosin, L-Histidin, L-Arginin, L-Asparagin, L-Asparaginsäure und L-Threonin, L-Homoserin, insbesondere L-Lysin, L-Methionin und L-Threonin. Im folgenden wird unter einer Aminosäure, wie beispielsweise Lysin, Methionin und Threonin, sowohl jeweils die L- und die D-Form der Aminosäure, vorzugsweise die L-Form, also beispielsweise L-Lysin, L-Methionin und L-Threonin verstanden.

In den folgenden Abschnitten werden die Lysin-, Methionin- und Threoninherstellung, welche besonders bevorzugt sind, genauer beschrieben.

a) Lysinherstellung

Die Erfindung betrifft insbesondere ein Verfahren zur Herstellung von Lysin durch Kultivierung von genetisch veränderten Mikroorganismen mit erhöhter oder verursachter Expressionsrate mindestens eines Gens im Vergleich zum Wildtyp, wobei man

  • – die Expressionsaktivität im Mikroorganismus von mindestens einem endogenen Gen durch eine erfindungsgemäße Expressionseinheit reguliert oder
  • – die Expression mindestens eines Gens im Mikroorganismus durch Einbringen einer – das Gen umfassenden erfindungsgemäßen Expressionskassette in den Mikroorganismus verursacht oder verändert.

Dabei sind die Gene insbesondere ausgewählt unter Nukleinsäuren kodierend eine Aspartatkinase, Nukleinsäuren kodierend eine Aspartat-Semialdehyd-Dehydrogenase, Nukleinsäuren kodierend eine Diaminopimelat- Dehydrogenase, Nukleinsäuren kodierend eine Diaminopimelat- Decarboxylase, Nukleinsäuren kodierend eine Dihydrodipicolinate-Synthetase, Nukleinsäuren kodierend eine Dihydridipicolinate-Reduktase, Nukleinsäuren kodierend eine Glycerinaldehyd-3-Phosphat Dehydrogenase, Nukleinsäuren kodierend eine 3-Phosphoglycerat-Kinase, Nukleinsäuren kodierend eine Pyruvat Carboxylase, Nukleinsäuren kodierend eine Triosephosphat-Isomerase, Nukleinsäuren kodierend einen Transkriptionellen Regulator LuxR, Nukleinsäuren kodierend einen Transkriptionellen Regulator LysR1, Nukleinsäuren kodierend einen Transkriptionellen Regulator LysR2, Nukleinsäuren kodierend eine Malat-Quinon-Oxodoreduktase, Nukleinsäuren kodierend eine Glucose-6-Phosphat-Deydrognease, Nukleinsäuren kodierend eine 6-Phosphogluconat-Dehydrognease, Nukleinsäuren kodierend eine Transketolase, Nukleinsäuren kodierend eine Transaldolase, Nukleinsäuren kodierend einen Lysin Exporter, Nukleinsäuren kodierend eine Biotin-Ligase, Nukleinsäuren kodierend eine Arginyl-t-RNA-Synthetase, Nukleinsäuren kodierend eine Phosphoenolpyruvat-Carboxylase, Nukleinsäuren kodierend eine Fruktose-1,6-bisphosphatase, Nukleinsäuren kodierend ein Protein OPCA, Nukleinsäuren kodierend eine 1-Phosphofructokinase, Nukleinsäuren kodierend eine 6-Phosphofructokinase Nukleinsäuren kodierend eine Tetrahydropicolinat-Succinylase, Nukleinsäuren kodierend eine Succinyl-aminoketopimelat-Aminotransferase, Nukleinsäuren kodierend eine Succinyl-Diaminopimelat-Desuccinylase, Nukleinsäuren kodierend eine Diaminopimelat-Epimerase, Nukleinsäuren kodierend eine 6-Phosphogluconat-Dehydrogenase, Nukleinsäuren kodierend eine Glucosephosphat-Isomerase, Nukleinsäuren kodierend eine Phosphoglycerat-Mutase, Nukleinsäuren kodierend eine Enolase, Nukleinsäuren kodierend eine Pyruvat-Kinase, Nukleinsäuren kodierend eine Aspartat-Transaminase und Nukleinsäuren kodierend eine Malat-Enzym.

Eine weiter bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Lysin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine erhöhte Aktivität, mindestens einer der Aktivitäten, ausgewählt unter:

Aspartatkinase-Aktivität, Aspartat-Semialdehyd-Dehydrogenase-Aktivität, Diaminopimelat- Dehydrogenase-Aktivität, Diaminopimelat-Decarboxylase-Aktivität, Dihydrodipicolinate-Synthetase-Aktivität, Dihydridipicolinate-Reduktase-Aktivität, Glycerinaldehyd-3-Phosphat Dehydrogenase-Aktivität, 3-Phosphoglycerat-Kinase-Aktivität, Pyruvat Carboxylase-Aktivität, Triosephosphat-Isomerase-Aktivität, Aktivität des Transkriptionellen Regulators LuxR, Aktivität des Transkriptionellen Regulators LysR1, Aktivität des Transkriptionellen Regulators LysR2, Malat-Quinon-Oxodoreduktase-Aktivität, Glucose-6-Phosphat-Deydrognease-Aktivität, 6-Phosphogluconat-Dehydrognease-Aktivität, Transketolase-Aktivität, Transaldolase-Aktivität, Lysin-Exporter-Aktivität, Arginyl-t-RNA-Synthetase-Aktivität, Phosphoenolpyruvat-Carboxylase-Aktivität, Fruktose-1,6-bisphosphatase-Aktivität, Protein OpcA-Aktivität, 1-Phosphofructokinase-Aktivität, 6-Phosphofructokinase-Aktivität, Biotin-Ligase-Aktivität und Tetrahydropicolinat-Succinylase-Aktivität, Succinyl-aminoketopimelat-Aminotransferase-Aktivität, Succinyl-Diaminopimelat-Desuccinylase-Aktivität, Diaminopimelat-Epimerase-Aktivität, 6-Phosphogluconat-Dehydrogenase-Aktivität, Glucosephosphat-Isomerase-Aktivität, Phosphoglycerat-Mutase-Aktivität, Enolase-Aktivität, Pyruvat-Kinase-Aktivität, Aspartat-Transaminase-Aktivität und Malat-Enzym-Aktivität aufweisen.

Eine weiter besonders bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Lysin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine reduzierte Aktivität, mindestens einer der Aktivitäten, ausgewählt aus der Gruppe Threonin Dehydratase-Aktivität, Homoserin O-Acetyltransferase-Aktivität, O-Acetylhomoserin-Sulfhydrylase-Aktivität, Phosphoenolpyruvat-Carboxykinase-Aktivität, Pyruvat-Oxidase-Aktivität, Homoserine-Kinase-Aktivität, Homoserin-Dehydrogenase-Aktivität, Threonin-Exporter-Aktivität, Threonin-Efflux-Protein-Aktivität, Asparaginase-Aktivität, Aspartat-Decarboxylase-Aktivität und Threonin-Synthase-Aktivität aufweisen.

b) Methioninherstellung

Die Erfindung betrifft ferner ein Verfahren zur Herstellung von Methionin durch Kultivierung von genetisch veränderten Mikroorganismen mit erhöhter oder verursachter Expressionsrate mindestens eines Gens im Vergleich zum Wildtyp, wobei man

  • – die Expressionsaktivität im Mikroorganismus von mindestens einem endogenen Gen durch eine erfindungsgemäße Expressionseinheit reguliert oder
  • – die Expression mindestens eines Gens im Mikroorganismus durch Einbringen einer das Gen umfassenden erfindungsgemäßen Expressionskassette in den Mikroorganismus verursacht oder verändert.

Dabei sind die Gene insbesondere ausgewählt unter Nukleinsäuren kodierend eine Aspartatkinase, Nukleinsäuren kodierend eine Aspartat-Semialdehyd-Dehydrogenase, Nukleinsäuren kodierend eine Homoserin Dehydrogenase, Nukleinsäuren kodierend eine Glycerinaldehyd-3-Phosphat Dehydrogenase, Nukleinsäuren kodierend eine 3-Phosphoglycerat Kinase, Nukleinsäuren kodierend eine Pyruvat Carboxylase, Nukleinsäuren kodierend eine Triosephosphat Isomerase, Nukleinsäuren kodierend eine Homoserin O-Acetyltransferase, Nukleinsäuren kodierend eine Cystahionin-gamma-Synthase, Nukleinsäuren kodierend eine Cystahionin-beta-Lyase, Nukleinsäuren kodierend eine Serin-Hydroxymethyltransferase, Nukleinsäuren kodierend eine O-Acetylhomoserin-Sulfhydrylase, Nukleinsäuren kodierend eine Methylen-Tetrahydrofolat-Reduktase, Nukleinsäuren kodierend eine Phosphoserin-Aminotransferase, Nukleinsäuren kodierend eine Phosphoserin-Phosphatase, Nukleinsäuren kodierend eine Serine Acetyl-Transferase, Nukleinsäuren kodierend eine Cystein-Synthase Aktivität I, Nukleinsäuren kodierend eine Cystein-Synthase Aktivität II , Nukleinsäuren kodierend eine Coenzym B12-abhängige Methionin-Synthase-Aktivität, Nukleinsäuren kodierend eine Coenzym B12-unabhängige Methionin-Synthase-Aktivität, Nukleinsäuren kodierend eine Sulfat-Adenylyltransferase-Aktivität, Nukleinsäuren kodierend eine Phosphoadenosin-Phosphosulfat-Reductase-Aktivität, Nukleinsäuren kodierend eine Ferredoxin-Sulfit-Reduktase-Aktivität, Nukleinsäuren kodierend eine Ferredoxin NADPH-Reduktase Aktivität, Nukleinsäuren kodierend eine Ferredoxin-Aktivität, Nukleinsäuren kodierend ein Protein der Sulfat-Reduktion RXA077, Nukleinsäuren kodierend ein Protein der Sulfat-Reduktion RXA248, Nukleinsäuren kodierend ein Protein der Sulfat-Reduktion RXA247, Nukleinsäuren kodierend eine, RXA0655 Regulator und Nukleinsäuren kodierend einen RXN2910 Regulator. Nukleinsäuren kodierend eine 6-Phosphogluconat-Dehydrogenase, Glucosephosphat-Isomerase, Phosphoglycerat-Mutase, Enolase, Pyruvat-Kinase, Aspartat-Transaminase oder Malat-Enzym.

Eine weiter bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Methionin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine erhöhte Aktivität, mindestens einer der Aktivitäten, ausgewählt aus der Gruppe Aspartatkinase-Aktivität, Aspartat-Semialdehyd-Dehydrogenase-Aktivität, Homoserin Dehydrogenase-Aktivität, Glycerinaldehyd-3-Phosphat Dehydrogenase-Aktivität, 3-Phosphoglycerat Kinase-Aktivität, Pyruvat Carboxylase-Aktivität, Triosephosphat Isomerase-Aktivität, Homoserin O-Acetyltransferase-Aktivität, Cystahionin-gamma-Synthase-Aktivität, Cystahioninbeta-Lyase-Aktivität Serin-Hydroxymethyltransferase-Aktivität, O-Acetylhomoserin-Sulfhydrylase-Aktivität, Methylen-Tetrahydrofolat-Reduktase-Aktivität, Phosphoserin-Aminotransferase-Aktivität, Phosphoserin-Phosphatase-Aktivität, Serine Acetyl-Transferase-Aktivität, Cystein-Synthase-Aktivität, Cystein-Synthase II-Aktivität, Coenzym B12-abhängige Methionin-Synthase-Aktivität, Coenzym B12-unabhängige Methionin-Synthase-Aktivität, Sulfat-Adenylyltransferase-Aktivität, Phosphoadenosin-Phosphosulfat-Reduktase-Aktivität, Ferredoxin-Sulfit-Reduktase-Aktivität, Ferredoxin NADPH-Reduktase Aktivität, Ferredoxin-Aktivität Aktivität Proteins der Sulfat-Reduktion RXA077, Aktivität eines Proteins der Sulfat-Reduktion RXA248, Aktivität eines Proteins der Sulfat-Reduktion RXA247, Aktivität eines RXA655-Regulators und Aktivität eines RXN2910-Regulators, Aktivität einer 6-Phosphogluconat-Dehydrogenase, Aktivität einer Glucosephosphat-Isomerase, Aktivität einer Phosphoglycerat-Mutase, Aktivität einer Enolase, Aktivität einer Pyruvat-Kinase, Aktivität einer Aspartat-Transaminase und Aktivität des Malat-Enzyms aufweisen.

Eine weiter besonders bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Methionin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine reduzierte Aktivität, mindestens einer der Aktivitäten, ausgewählt aus der Homoserine-Kinase-Aktivität, Threonin-Dehydratase-Aktivität, Threonin Synthase-Aktivität, Meso-Diaminopimelat D-Dehydrogenase-Aktivität, Phosphoenolpyruvat-Carboxykinase-Aktivität, Pyruvat-Oxidase-Aktivität, Dihydrodipicolinat Synthase-Aktivität, Dihydrodipicolinat Reduktase-Aktivität, und Diaminopicolinat Decarboxylase-Aktivität aufweisen.

c) Threoninherstellung

Die Erfindung betrifft ferner ein Verfahren zur Herstellung von Threonin durch Kultivierung von genetisch veränderten Mikroorganismen mit erhöhter oder verursachter Expressionsrate mindestens eines Gens im Vergleich zum Wildtyp, wobei man

  • – die Expressionsaktivität im Mikroorganismus von mindestens einem endogenen Gen durch eine erfindungsgemäße Expressionseinheit reguliert oder
  • – die Expression mindestens eines Gens im Mikroorganismus durch Einbringen einer das Gen umfassenden erfindungsgemäßen Expressionskassette in den Mikroorganismus verursacht oder verändert.

Dabei sind die Gene insbesondere ausgewählt unter Nukleinsäuren kodierend eine Aspartatkinase, Nukleinsäuren kodierend eine Aspartat-Semialdehyd-Dehydrogenase, Nukleinsäuren kodierend eine Glycerinaldehyd-3-Phosphat Dehydrogenase, Nukleinsäuren kodierend eine 3-Phosphoglycerat Kinase, Nukleinsäuren kodierend eine Pyruvat Carboxylase, Nukleinsäuren kodierend eine Triosephosphat Isomerase, Nukleinsäuren kodierend eine Homoserin-Kinase, Nukleinsäuren kodierend eine Threonin Synthase, Nukleinsäuren kodierend einen Threonin Exporter Carrier, Nukleinsäuren kodierend eine Glucose-6-Phosphat-Dehydrogenase, Nukleinsäuren kodierend eine Transaldolase, Nukleinsäuren kodierend eine Transketolase, Nukleinsäuren kodierend einer Malat-Quinon-Oxidoreductase, Nukleinsäuren kodierend eine 6-Phosphogluconat-Dehydrogenase, Nukleinsäuren kodierend einen Lysin-Exporter, Nukleinsäuren kodierend eine Biotin-Ligase, Nukleinsäuren kodierend eine Phosphoenolpyruvat-Carboxylase, Nukleinsäuren kodierend ein Threonin Efflux-Protein, Nukleinsäuren kodierend eine Fruktose-1,6-bisphosphatase, Nukleinsäuren kodierend ein OpcA Protein, Nukleinsäuren kodierend eine 1-Phosphofructokinase, Nukleinsäuren kodierend eine 6-Phosphofructokinase, und Nukleinsäuren kodierend eine Homoserin-Dehydrogenase und Kukleinsäuren kodierend eine 6-Phosphogluconat-Dehydrogenase, Glucosephosphat-Isomerase, Phosphoglycerat-Mutase, Enolase, Pyruvat-Kinase, Aspartat-Transaminase und Malat-Enzym.

Eine weiter bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Threonin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine erhöhte Aktivität, mindestens einer der Aktivitäten, ausgewählt aus der Gruppe Aspartatkinase-Aktivität, Aspartat-Semialdehyd-Dehydrogenase-Aktivität, Glycerinaldehyd-3-Phosphat Dehydrogenase-Aktivität, 3-Phosphoglycerat Kinase-Aktivität, Pyruvat Carboxylase-Aktivität, Triosephosphat Isomerase-Aktivität, Threonin Synthase-Aktivität, Aktivität eines Threonin Export-Carriers, Transaldolase-Aktivität, Transketolase-Aktivität, Glucose-6-Phosphat-dehydrogenase-Aktivität, Malat-Qinon-Oxidoreductase-Aktivität, Homoserin-Kinase-Aktivität, Biotin-Ligase-Aktivität, Phosphoenolpyruvat-Carboxylase-Aktivität, Threonin-Efflux-Protein-Aktivität, Protein OpcA-Aktivität, 1-Phosphofructokinase-Aktivität, 6-Phosphofructokinase-Aktivität, Fruktose 1,6 bisphosphatase-Aktivität, 6-Phosphogluconat-Dehydrogenase, Homoserin-Dehydrogenase-Aktivität und Aktivität einer 6-Phosphogluconat-Dehydrogenase, Aktivität einer Glucosephosphat-Isomerase, Aktivität einer Phosphoglycerat-Mutase, Aktivität einer Enolase, Aktivität einer Pyruvat-Kinase, Aktivität einer Aspartat-Transaminase und Aktivität des Malat-Enzyms aufweisen.

Eine weiter besonders bevorzugte Ausführungsform des vorstehend beschriebenen Verfahrens zur Herstellung von Threonin ist dadurch gekennzeichnet, dass die genetisch veränderten Mikroorganismen im Vergleich zum Wildtyp zusätzlich eine reduzierte Aktivität, mindestens einer der Aktivitäten, ausgewählt aus der Gruppe Threonin Dehydratase-Aktivität, Homoserin O-Acetyltransferase-Aktivität, Serin-Hydroxymethyltransferase-Aktivität, O-Acetylhomoserin-Sulfhydrylase-Aktivität, Meso-Diaminopimelat D-Dehydrogenase-Aktivität, Phosphoenolpyruvat-Carboxykinase-Aktivität, Pyruvat-Oxidase-Aktivität, Dihydrodipicolinat Synthetase-Aktivität, Dihydrodipicolinat Reduktase-Aktivität, Asparaginase-Aktivität, Aspartat-Decarboxylase-Aktivität, Lysin-Exporter-Aktivität, Acetolactat-Synthase-Aktivität, Ketol-Aid-Reductoisomerase-Aktivität, Branched chain aminotransferase- Aktivität, Coenzym B12-abhängige Methionin Synthase- Aktivität, Coenzym B12-unabhängige Methion Synthase- Aktivität, Dihydroxy-acid Dehydratase- Aktivität und Diaminopicolinat Decarboxylase-Aktivität aufweisen.

d) Weitere Angaben zur erfindungsgemäßen Herstellung von Bioprodukten

Diese zusätzlichen, erhöhten oder reduzierten Aktivitäten mindestens einer der vorstehend beschriebenen Aktivitäten können, müssen aber nicht durch eine erfindungsgemäße Expressionseinheit oder eine erfindungsgemäße Expressionskassette verursacht sein.

Unter dem Begriff der „Aktivität" eines Proteins wird bei Enzymen die Enzymaktivität des entsprechenden Proteins, bei anderen Proteinen, wie beispielsweise Struktur oder Transport-Proteinen, die physiologische Aktivität der Proteine verstanden.

Die Enzyme sind in der Regel in der Lage ein Substrat in ein Produkt umzuwandeln bzw. diesen Umwandlungsschritt zu katalysieren. Dementsprechend wird unter der „Aktivität" eines Enzyms die in einer bestimmten Zeit durch das Enzym umgesetzte Menge Substrat bzw. gebildete Menge Produkt verstanden.

Bei einer erhöhten Aktivität im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Enzym die umgesetzte Menge Substrat bzw. die gebildete Menge Produkt erhöht.

Beispielsweise beträgt diese Erhöhung der „Aktivität" bei allen vorstehend und nachstehend beschriebenen Aktivitäten mindestens 1 bis 5 %, wie z.B. mindestens 20 %, mindestens 50 %, mindestens 100 %, mindestens 300 %, oder mindestens 500 %, oder mindestens 600 % der „Aktivität des Wildtyps".

Bei einer reduzierten Aktivität im Vergleich zum Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Enzym die umgesetzte Menge Substrat bzw. die gebildete Menge Produkt reduziert.

Unter einer reduzierten Aktivität wird vorzugsweise die teilweise oder im wesentlichen vollständige, auf unterschiedliche zellbiologische Mechanismen beruhende Unterbindung oder Blockierung der Funktionalität dieses Enzyms in einem Mikroorganismus verstanden.

Eine Reduzierung der Aktivität umfasst eine mengenmäßige Verringerung eines Enzyms bis hin zu einem im wesentlichen vollständigen Fehlen des Enzyms (d.h. fehlende Nachweisbarkeit der entsprechenden Aktivität oder fehlende immunologische Nachweisbarkeit des Enzyms). Vorzugsweise wird die Aktivität im Mikroorganismus im Vergleich zum Wildtyp um mindestens 5 %, wie mindestens 20 %, mindestens 50 %, oder um etwa 100 % reduziert. Insbesondere meint "Reduzierung" auch das vollständige Fehlen der entsprechenden Aktivität.

Die Aktivität bestimmter Enzyme in genetisch veränderten Mikroorganismen sowie im Wildtyp und damit die Erhöhung oder Reduzierung der Enzymaktivität lassen sich nach bekannten Verfahren, wie beispielsweise Enzymassays ermitteln.

Eine zusätzliche Erhöhung von Aktivitäten kann auf verschiedenen Wegen erfolgen, beispielsweise durch Ausschalten von hemmenden Regulationsmechanismen auf Expressions- und Proteinebene oder durch Erhöhung der Genexpression von Nukleinsäuren kodierend die vorstehend beschriebenen Proteine im Vergleich zum Wildtyp.

Die Erhöhung der Genexpression der Nukleinsäuren kodierend die vorstehend beschriebenen Proteine gegenüber dem Wildtyp kann ebenfalls auf verschiedenen Wegen erfolgen, beispielsweise durch Induzierung des Gens durch Aktivatoren oder wie vorstehend beschrieben durch Erhöhung der Promotoraktivität oder Erhöhung der Expressionsaktivität oder durch Einbringen von einer oder mehrerer Genkopien in den Mikroorganismus.

Unter Erhöhung der Genexpression einer Nukleinsäure kodierend ein Protein wird erfindungsgemäß auch die Manipulation der Expression der dem Mikroorganismus eigenen, endogenen Proteine verstanden. Dies kann beispielsweise, wie vorstehend beschrieben durch Veränderung der Promotorsequenzen der Gene, Einbringen von erfindungsgemäßen Expressionseinheit zur regulatorischen Kontrolle der Gene und Veränderung der eingebrachten erfindungsgemäßen Expressionseinheiten erreicht werden. Eine solche Veränderung, die eine erhöhte Expressionsrate des Gens zur Folge hat, kann beispielsweise durch Deletion oder Insertion von DNA Sequenzen erfolgen.

Es ist, wie vorstehend beschrieben, möglich, die Expression der endogenen Proteine durch die Applikation exogener Stimuli zu verändern. Dies kann durch besondere physiologische Bedingungen, also durch die Applikation von Fremdsubstanzen erfolgen.

Zur Erzielung einer Erhöhung der Genexpression kann der Fachmann weitere unterschiedliche Maßnahmen einzeln oder in Kombination ergreifen. So kann beispielsweise die Kopienzahl der entsprechenden Gene erhöht werden, oder es kann die Promotor- und Regulationsregion oder die Ribosomenbindungsstelle, die sich stromaufwärts des Strukturgens befindet, mutiert werden. Durch induzierbare Promotoren ist es zusätzlich möglich, die Expression im Verlaufe der fermentativen Produktion zu steigern. Durch Maßnahmen zur Verlängerung der Lebensdauer der mRNA wird ebenfalls die Expression verbessert. Weiterhin wird durch Verhinderung des Abbaus des Enzymproteins ebenfalls die Enzymaktivität verstärkt. Die Gene oder Genkonstrukte können entweder in Plasmiden mit unterschiedlicher Kopienzahl vorliegen oder im Chromosom integriert und amplifiziert sein. Alternativ kann weiterhin eine Überexpression der betreffenden Gene durch Veränderung der Medienzusammensetzung und Kulturführung erreicht werden.

Anleitungen hierzu findet der Fachmann unter anderem bei Martin et al. (Biontechnology 5, 137–146 (1987)), bei Guerrero et al. (Gene 138, 35–41 (1994)), Tsuchiya und Morinaga (Bio/Technology 6, 428–430 (1988)), bei Eikmanns et al. (Gene 102, 93–98 (1991)), in der EP-A-0472869, im US -A-4,601,893, bei Schwarzer und Pühler (Biotechnology 9, 84–87 (1991), bei Remscheid et al. (Applied and Environmental Microbiology 60,126–132 (1994), bei LaBarre et al. (Journal of Bacteriology 175, 1001–1007 (1993)), in der WO 96/15246, bei Malumbres et al. (Gene 134, 15–24 (1993)), in der JP-A-10-229891, bei Jensen und Hammer (Biotechnology and Bioengineering 58,.191–195 (1998)), bei Makrides (Microbiological Reviews 60: 512–538 (1996) und in bekannten Lehrbüchern der Genetik und Molekularbiologie.

Weiterhin kann es für die Produktion von biosynthetischen Produkten, insbesondere L-Lysin, L-Methionin und L-Threonin, vorteilhaft sein, neben der Expression bzw. Verstärkung eines Gens unerwünschte Nebenreaktionen auszuschalten (Nakayama: "Breeding of Amino Acid Producing Microorganisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982).

In einer bevorzugten Ausführungsform erfolgt die Erhöhung der Genexpression einer Nukleinsäure, kodierend eines der vorstehend beschriebenen Proteine, durch Einbringen von mindestens einer Nukleinsäure kodierend ein entsprechendes Protein in den Mikroorganismus. Das Einbringen der Nukleinsäure kann chromosomal oder extrachromosomal erfolgen, also durch Erhöhung der Kopienzahl auf dem Chromosom und oder eine Kopie des Gens auf einem sich replizierenden Plasmid in dem Wirtsmikroorganismus.

Vorzugsweise erfolgt das Einbringen der Nukleinsäure, beispielsweise in Form einer erfindungsgemäßen Expressionskassette, enthaltend die Nukleinsäure, chromosomal, insbesondere durch die vorstehend beschriebene SacB-Methode. Dazu kann prinzipiell jedes Gen, das eines der vorstehend beschriebenen Proteine kodiert, verwendet werden.

Bei genomischen Nukleinsäure-Sequenzen aus eukaryontischen Quellen, die Introns enthalten, sind für den Fall, dass der Wirtsmikroorganismus nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechenden Proteine zu exprimieren, bevorzugt bereits prozessierte Nukleinsäuresequenzen, wie die entsprechenden cDNAs zu verwenden.

Beispiele für die entsprechenden Gene sind in Tabelle 1 und 2 aufgelistet.

Vorzugsweise erfolgt die Reduzierung der vorstehend beschriebenen Aktivitäten in Mikroorganismen durch mindestens eines der nachfolgenden Verfahren:

  • • Einbringen mindestens einer sense-Ribonukleinsäuresequenz zur Induktion einer Cosuppression oder einer deren Expression gewährleistenden Expressionskassette
  • • Einbringen mindestens eines DNA- oder Protein-bindenden Faktors für ein entsprechedes Gen, eine RNA oder ein Protein, oder einer dessen Expression gewährleistenden Expressionskassette
  • • Einbringen mindestens einer den RNA-Abbau bewirkenden viralen Nukleinsäuresequenz oder einer deren Expression gewährleistenden Expressionskassette
  • • Einbringen mindestens eines Konstruktes zur Erzeugung eines Funktionsverlustes, wie beispielsweise die Generierung von Stop-Codons oder von Verschiebungen im Leseraster, an einem Gen, beispielsweise durch Erzeugung einer Insertion, Deletion, Inversion oder Mutation in einem Gen. Bevorzugt können Knockout-Mutanten mittels gezielter Insertion in das gewünschte Zielgen durch homologe Rekombination oder Einbringen von sequenzspezifischen Nukleasen gegen das Zielgen generiert werden.
  • • Einbringen eines Promotors mit reduzierter Promotoraktivität oder einer Expressionseinheit mit reduzierter Expressionsaktivität.
  • • Einbringen einer antisense-RNA, die die Translation der sense RNA (mRNA) vermindert.

Dem Fachmann ist bekannt, dass auch weitere Verfahren im Rahmen der vorliegenden Erfindung zur Reduzierung seiner Aktivität oder Funktion eingesetzt werden können. Beispielsweise kann auch das Einbringen einer dominant-negativen Variante eines Proteins oder einer deren Expression gewährleistenden Expressionskassette vorteilhaft sein.

Dabei kann jedes einzelne dieser Verfahren eine Verminderung der Proteinmenge, mRNA-Menge und/oder Aktivität eines Proteins bewirken. Auch eine kombinierte Anwendung ist denkbar. Weitere Methoden sind dem Fachmann bekannt und können die Behinderung oder Unterbindung der Prozessierung des Proteins, des Transports des Proteins oder dessen mRNA, Hemmung der Ribosomenanlagerung, Hemmung des RNA-Spleißens, Induktion eines RNA-abbauenden Enzyms und/oder Hemmung der Translationselongation oder -termination umfassen.

VII. Kultivierung von Mikroorganismen und Produktisolierung

Im erfindungsgemäßen Verfahren zur Herstellung von biosynthetischen Produkten wird vorzugsweise dem Kultivierungsschritt der genetisch veränderten Mikroorganismen ein Isolieren von biosynthetischen Produkten aus den Mikroorganismen oder/oder aus der Fermentationsbrühe angeschlossen. Diese Schritte können gleichzeitig und/oder vorzugsweise nach dem Kultivierungsschritt stattfinden.

Die erfindungsgemäßen genetisch veränderten Mikroorganismen können kontinuierlich oder diskontinuierlich im batch-Verfahren (Satzkultivierung) oder im fed batch (Zulaufverfahren) oder repeated fed batch Verfahren (repetitives Zulaufverfahren) zur Produktion von biosynthetischen Produkten, insbesondere L-Lysin, L-Methionin und L-Threonin, kultiviert werden. Eine Zusammenfassung über bekannte Kultivierungsmethoden ist im Lehrbuch von Chemiel (Bioprozeßtechnik 1. Einführung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991)) oder im Lehrbuch von Storhas (Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)) zu finden.

Das zu verwendende Kulturmedium hat in geeigneter Weise den Ansprüchen der jeweiligen Stämme zu genügen. Beschreibungen von Kulturmedien verschiedener Mikroorganismen sind im Handbuch "Manual of Methods für General Bacteriology" der American Society für Bacteriology (Washington D. C., USA, 1981) enthalten.

Diese erfindungsgemäß einsetzbaren Medien umfassen gewöhnlich eine oder mehrere Kohlenstoffquellen, Stickstoffquellen, anorganische Salze, Vitamine und/oder Spurenelemente.

Bevorzugte Kohlenstoffquellen sind Zucker, wie Mono-, Di- oder Polysaccharide. Sehr gute Kohlenstoffquellen sind beispielsweise Glucose, Fructose, Mannose, Galactose, Ribose, Sorbose, Ribulose, Lactose, Maltose, Saccharose, Raffinose, Stärke oder Cellulose. Man kann Zucker auch über komplexe Verbindungen, wie Melassen, oder andere Nebenprodukte der Zucker-Raffinierung zu den Medien geben. Es kann auch vorteilhaft sein, Gemische verschiedener Kohlenstoffquellen zuzugeben. Andere mögliche Kohlenstoffquellen sind Öle und Fette wie z. B. Sojaöl. Sonnenblumenöl. Erdnußöl und Kokosfett, Fettsäuren wie z. B. Palmitinsäure, Stearinsäure oder Linolsäure, Alkohole wie z. B. Glycerin, Methanol oder Ethanol und organische Säuren wie z. B. Essigsäure oder Milchsäure.

Stickstoffquellen sind gewöhnlich organische oder anorganische Stickstoffverbindungen oder Materialien, die diese Verbindungen enthalten. Beispielhafte Stickstoffquellen umfassen Ammoniak-Gas oder Ammoniumsalze, wie Ammoniumsulfat, Ammoniumchlorid, Ammoniumphosphat, Ammoniumcarbonat oder Ammoniumnitrat, Nitrate, Harnstoff, Aminosäuren oder komplexe Stickstoffquellen, wie Maisquellwasser, Sojamehl, Sojaprotein, Hefeextrakt, Fleischextrakt und andere. Die Stickstoffquellen können einzeln oder als Mischung verwendet werden.

Anorganische Salzverbindungen, die in den Medien enthalten sein können, umfassen die Chlorid-, Phosphor- oder Sulfatsalze von Calcium, Magnesium, Natrium, Kobalt, Molybdän, Kalium, Mangan, Zink, Kupfer und Eisen Als Schwefelquelle für die Herstellung von Feinchemikalien, insbesondere von Methionin, können anorganische Verbindungen wie beispielsweise Sulfate, Sulfite, Dithionite, Tetrathionate, Thiosulfate, Sulfide aber auch organische Schwefelverbindungen, wie Mercaptane und Thiole, verwendet werden.

Als Phosphorquelle können Phosphorsäure, Kaliumdihydrogenphosphat oder Dikaliumhydrogenphosphat oder die entsprechenden, Natrium-haltigen Salze verwendet werden.

Chelatbildner können zum Medium gegeben werden, um die Metallionen in Lösung zu halten. Besonders geeignete Chelatbildner umfassen Dihydroxyphenole, wie Catechol oder Protocatechuat, oder organische Säuren, wie Citronensäure.

Die erfindungsgemäß eingesetzten Fermentationsmedien enthalten üblicherweise auch andere Wachstumsfaktoren, wie Vitamine oder Wachstumsförderer, zu denen beispielsweise Biotin, Riboflavin, Thiamin, Folsäure, Nikotinsäure, Panthothenat und Pyridoxin gehören. Wachstumsfaktoren und Salze stammen häufig von komplexen Medienkomponenten, wie Hefeextrakt, Melassen, Maisquellwasser und dergleichen. Dem Kulturmedium können überdies geeignete Vorstufen zugesetzt werden. Die genaue Zusammensetzung der Medienverbindungen hängt stark vom jeweiligen Experiment ab und wird für jeden spezifischen Fall individuell entschieden. Information über die Medienoptimierung ist erhältlich aus dem Lehrbuch "Applied Microbiol. Physiology, A Practical Approach" (Hrsg. P.M. Rhodes, P.F. Stanbury, IRL Press (1997) S. 53–73, ISBN 0 19 963577 3). Wachstumsmedien lassen sich auch von kommerziellen Anbietern beziehen, wie Standard 1 (Merck) oder BHI (Brain heart infusion, DIFCO) und dergleichen.

Sämtliche Medienkomponenten werden entweder durch Hitze (20 min bei 1,5 bar und 121 °C) oder durch Sterilfiltration sterilisiert. Die Komponenten können entweder zusammen oder nötigenfalls getrennt sterilisiert werden. Sämtliche Medienkomponenten können zu Beginn der Anzucht zugegen sein oder wahlfrei kontinuierlich oder chargenweise hinzugegeben werden.

Die Temperatur der Kultur liegt normalerweise zwischen 15°C und 45°C, vorzugsweise bei 25°C bis 40°C und kann während des Experimentes konstant gehalten oder verändert werden. Der pH-Wert des Mediums sollte im Bereich von 5 bis 8,5, vorzugsweise um 7,0 liegen. Der pH-Wert für die Anzucht lässt sich während der Anzucht durch Zugabe von basische Verbindungen wie Natriumhydroxid, Kaliumhydroxid, Ammoniak bzw. Ammoniakwasser oder saure Verbindungen wie Phosphorsäure oder Schwefelsäure kontrollieren. Zur Kontrolle der Schaumentwicklung können Antischaummittel, wie z. B. Fettsäurepolyglykolester, eingesetzt werden. Zur Aufrechterhaltung der Stabilität von Plasmiden können dem Medium geeignete selektiv wirkende Stoffe, wie z. B.

Antibiotika, hinzugefügt werden. Um aerobe Bedingungen aufrechtzuerhalten, werden Sauerstoff oder Sauerstoff haltige Gasmischungen, wie z. B. Umgebungsluft, in die Kultur eingetragen. Die Temperatur der Kultur liegt normalerweise bei 20°C bis 45°C. Die Kultur wird solange fortgesetzt, bis sich ein Maximum des gewünschten Produktes gebildet hat. Dieses Ziel wird normalerweise innerhalb von 10 Stunden bis 160 Stunden erreicht.

Die so erhaltenen Fermentationsbrühen haben üblicherweise eine Trockenmasse von 7,5 bis 25 Gew.-%.

Vorteilhaft ist außerdem auch, wenn die Fermentation zumindest am Ende, insbesondere jedoch über mindestens 30% der Fermentationsdauer zuckerlimitiert gefahren wird. Das heißt, dass während dieser Zeit die Konzentration an verwertbarem Zucker im Fermentationsmedium auf 0 bis 3 g/l gehalten, beziehungsweise abgesenkt wird.

Die Isolierung von biosynthetischen Produkten aus der Fermentationsbrühe und/oder den Mikroorganismen erfolgt in an sich bekannter Weise entsprechend den physikalisch-chemischen Eigenschaften des biosynthetischen Wertprodukts und den biosynthetischen Nebenprodukten.

Die Fermentationsbrühe kann anschließend beispielsweise weiterverarbeitet werden. Je nach Anforderung kann die Biomasse ganz oder teilweise durch Separationsmethoden, wie z. B. Zentrifugation, Filtration, Dekantieren oder einer Kombination dieser Methoden aus der Fermentationsbrühe entfernt oder vollständig in ihr belassen werden.

Anschließend kann die Fermentationsbrühe mit bekannten Methoden, wie z. B. mit Hilfe eines Rotationsverdampfers, Dünnschichtverdampfers, Fallfilmverdampfers, durch Umkehrosmose, oder durch Nanofiltration, eingedickt beziehungsweise aufkonzentriert werden. Diese aufkonzentrierte Fermentationsbrühe kann anschließend durch Gefriertrocknung, Sprühtrocknung, Sprühgranulation oder durch anderweitige Verfahren aufgearbeitet werden.

Es ist aber auch möglich die biosynthetischen Produkte, insbesondere L-Lysin, L-Methionin und L-Threonin, weiter aufzureinigen. Hierzu wird die produkthaltige Brühe nach dem Abtrennen der Biomasse einer Chromatographie mit einem geeigneten Harz unterworfen, wobei das gewünschte Produkt oder die Verunreinigungen ganz oder teilweise auf dem Chromatographieharz zurückgehalten werden. Diese Chromatographieschritte können nötigenfalls wiederholt werden, wobei die gleichen oder andere Chromatographieharze verwendet werden. Der Fachmann ist in der Auswahl der geeigneten Chromatographieharze und ihrer wirksamsten Anwendung bewandert. Das gereinigte Produkt kann durch Filtration oder Ultrafiltration konzentriert und bei einer Temperatur aufbewahrt werden, bei der die Stabilität des Produktes maximal ist.

Die biosynthetischen Produkte können in unterschiedlichen Formen anfallen, beispielsweise in Form ihrer Salze oder Ester.

Die Identität und Reinheit der isolierten Verbindungen) kann durch Techniken des Standes der Technik bestimmt werden. Diese umfassen Hochdruckflüssigkeitschromatographie (HPLC), spektroskopische Verfahren, Färbeverfahren, Dünnschichtchromatographie, NIRS, Enzymtest oder mikrobiologische Tests. Diese Analyseverfahren sind zusammengefaßt in: Patek et al. (1994) Appl. Environ. Microbiol. 60:133–140; Malakhova et al. (1996) Biotekhnologiya 11 27–32; und Schmidt et al. (1998) Bioprocess Engineer. 19:67–70. Ulmann's Encyclopedia of Industrial Chemistry (1996) Bd. A27, VCH: Weinheim, S. 89–90, S. 521–540, S. 540–547, S. 559–566, 575–581 und S. 581–587; Michal, G (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A. et al. (1987) Applications of HPLC in Biochemistry in: Laboratory Techniques in Biochemistry and Molecular Biology, Bd. 17.

Die Erfindung wird nun anhand der folgenden nicht-limitierenden Beispiele näher beschrieben:

Beispiel 1: Herstellung des Vektors pCLiK5MCS

Zunächst wurden Ampicillinresistenz und Replikationsursprung des Vektors pBR322 mit den Oligonukleotidprimern SEQ ID NO:5 und SEQ ID NO: 6 mit Hilfe der Polymerase-Kettenreaktion (PCR) amplifiziert.

SEQ ID NO: 5:
  • 5'-CCCGGGATCCGCTAGCGGCGCGCCGGCCGGCCCGGTGTGAAATACCGCACA G-3'
SEQ ID NO: 6:
  • 5'-TCTAGACTCGAGCGGCCGCGGCCGGCCTTTAAATTGAAGACGAAAGGGCCTC G-3'

Neben den zu pBR322 komplementären Sequenzen, enthält der Oligonukleotidprimer SEQ ID NO: 5 in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen SmaI, BamHI, NheI und AscI und der Oligonukleotidprimer SEQ ID NO: 6 in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen XbaI, XhI, NotI und DraI. Die PCR Reaktion wurde nach Standardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit Pfu Turbo Polymerase (Stratagene, La Jolla, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 2,1 kb wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Die stumpfen Enden des DNA-Fragmentes wurden mit dem Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers miteinander ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Ampicillin (50&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK1.

Ausgehend vom Plasmid pWLT1 (Lieb) et al., 1992) als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimern SEQ ID NO:7 und SEQ ID NO:8 eine Kanamycin-Resistenzcassette amplifiziert.

SEQ ID NO:7:
  • 5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCGGA-3'
SEQ ID NO:8
  • 5'-GAGAGGCGCGCCGCTAGCGTGGGCGAAGAACTCCAGCA-3'

Neben den zu pWLT1 komplementären Sequenzen, enthält der Oligonukleotidprimer SEQ ID NO: 7 in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen XbaI, SmaI, BamHI, NheI und der Oligonukleotidprimer SEQ ID NO:8 in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen AscI und NheI. Die PCR Reaktion wurde nach Standardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit Pfu Turbo Polymerase (Stratagene, La Jolla, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 1,3 kb wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Das DNA-Fragment wurde mit den Restriktionsendonukleasen XbaI und AscI (New England Biolabs, Beverly, USA) geschnitten und im Anschluß daran erneut mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Der Vektor pCLiK1 wurde ebenfalls mit den Restriktionsendonukleasen XbaI und AscI geschnitten und mit alkalischer Phosphatase (I (Roche Diagnostics, Mannheim)) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 2,1 kb) mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem geschnittenen PCR Fragment ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Ampicillin (50&mgr;g/ml) und Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK2.

Der Vektor pCLiK2 wurde mit der Restriktionsendonuklease DraI (New England Biolabs, Beverly, USA) geschnitten. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde ein ca. 2,3 kb großes Vektorfragment mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers religiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK3.

Ausgehend vom Plasmid pWLQ2 (Lieb) et al., 1992) als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimern SEQ ID NO:9 und SEQ ID NO:10 der Replikationsursprung pHM1519 amplifiziert.

SEQ ID NO:9:
  • 5'-GAGAGGGCGGCCGCGCAAAGTCCCGCTTCGTGAA-3'
SEQ ID NO:10:
  • 5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-3'

Neben den zu pWLQ2 komplementären Sequenzen, enthalten die Oligonukleotidprimer SEQ ID NO:9 und SEQ ID NO:10 Schnittstellen für die Restriktionsendonuklease NotI. Die PCR Reaktion wurde nach Standardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit Pfu Turbo Polymerase (Stratagene, La Jolla, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 2,7 kb wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Das DNA-Fragment wurde mit der Restriktionsendonuklease NotI (New England Biolabs, Beverly, USA) geschnitten und im Anschluß daran erneut mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Der Vektor pCLiK3 wurde ebenfalls mit der Restriktionsendonuklease NotI geschnitten und mit alkalischer Phosphatase (I(Roche Diagnostics, Mannheim)) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 2,3kb) mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem geschnittenen PCR Fragment ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK5.

Für die Erwneiterung von pCLiK5 um eine „multiple cloning site" (MCS) wurden die beide synthetischen, weitestgehend komplementären Oligonukleotide SEQ ID NO:11 und SEQ ID NO:12, die Schnittstellen für die Restriktionsendonukleasen SwaI, XhoI, AatI, ApaI, Asp718, MluI, NdeI, SpeI, EcoRV, SalI, ClaI, BamHI, XbaI und SmaI enthalten, durch gemeinsames erhitzen auf 95°C und langsames abkühlen zu einem doppelsträngigen DNA-Fragment vereinigt.

SEQ ID NO:11:
  • 5'-TCGAATTTAAATCTCGAGAGGCCTGACGTCGGGCCCGGTACCACGCGTCATAT GACTAGTTCGGACCTAGGGATATCGTCGACATCGATGCTCTTCTGCGTTAATTAAC AATTGGGATCCTCTAGACCCGGGATTTAAAT-3'
SEQ ID NO:12:
  • 5'-GATCATTTAAATCCCGGGTCTAGAGGATCCCAATTGTTAATTAACGCAGAAGAG CATCGATGTCGACGATATCCCTAGGTCCGAACTAGTCATATGACGCGTGGTACCG GGCCCGACGTCAGGCCTCTCGAGATTTAAAT-3'

Der Vektor pCLiK5 wurde mit den Restriktionsendonuklease XhoI und BamHI (New England Biolabs, Beverly, USA) geschnitten und mit alkalischer Phosphatase (I(Roche Diagnostics, Mannheim)) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 5,0 kb) mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem synthetischen Doppelsträngigen DNA-Fragment ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK5MCS.

Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das entstandene Plasmid pCLiK5MCS ist als SEQ ID NO:13 aufgeführt.

Beispiel 2: Herstellung des Plasmids PmetA metA

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO: 14 und SEQ ID NO: 15, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein das metA Gen inklusice des nichkodierenden 5'-Bereichs amplifiziert.

SEQ ID NO: 14
  • 5'-GCGCGGTACCTAGACTCACCCCAGTGCT-3' und
SEQ ID NO: 15
  • 5'-CTCTACTAGTTTAGATGTAGAACTCGATGT-3'

Das erhaltene DNA Fragment von ca. 1,3 kb Größe wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Asp718 und SpeI (Roche Diagnostics, Mannheim) gespalten und das DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit aufgereinigt.

Der Vektor pClik5MCS SEQ ID NO: 13 wurde mit den Restriktionsenzymen Asp718 und SpeI geschnitten und ein 5 kb großes Fragment nach elektrophoretischer Auftrennung mit GFXTMPCR, DNA and Gel Band Purification Kit isoliert.

Das Vektorfragment wurde zusammen mit dem PCR-Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das entstandene Plasmid pCLiK5MCS PmetA metA ist als SEQ ID NO 16: aufgeführt.

Beispiel 3: Herstellung des Plasmids pCLiK5MCS Psod metA

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO 17 und SEQ ID NO 18, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Fragment von ca. 200 Basenpaaren aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) der Superoxiddismutase (Psod) amplifiziert.

SEQ ID NO: 17
  • 5'-GAGACTCGAGAGCTGCCAATTATTCCGGG-3'

    und
SEQ ID NO: 18
  • 5'-CCTGAAGGCGCGAGGGTGGGCATGGGTAAAAAATCCTTTCG-3'

Das erhaltene DNA Fragment wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

Ausgehend vom Plasmid PmetA metA SEQ ID NO: 16 als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimern SEQ ID NO: 19: und SEQ ID NO: 20: ein Teil von metA amplifiziert.

SEQ ID NO: 19
  • 5'-CCCACCCTCGCGCCTTCAG-3' und
SEQ ID NO: 20
  • 5'-CTGGGTACATTGCGGCCC-3'

Das erhaltene DNA Fragment von ungefähr 470 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.

In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer SEQ ID NO: 18 eingebrachten, zu metA homologen Sequenzen, kommt es im Zuge der PCR-Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidprimer SEQ ID NO: 17 und SEQ ID NO: 20 erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden.

Das amplifizierte DNA Fragment von ungefähr 675 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen XhoI und NcoI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 620 Basenpaar große DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.

Das Plasmid PmetA metA SEQ ID NO 16: wurde mit den Restriktionsenzymen NcoI und SpeI (Roche Diagnostics, Mannheim) gespalten. Nach gelelektrophoretischer Auftrennung wurde ein ca. 0,7 kb großes metA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit aus der Agarose aufgereinigt.

Der Vektor pClik5MCS SEQ ID NO: 13 wurde mit den Restriktionsenzymen XhoI und SpeI (Roche Diagnostics, Mannheim) geschnitten und ein 5 kb großes Fragment nach elektrophoretischer Auftrennung mit GFXTMPCR, DNA and Gel Band Purification Kit isoliert.

Das Vektorfragment wurde zusammen mit dem PCR-Fragment und dem metA-Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das entstandene Plasmid pCLiK5MCS PSODmetA ist als SEQ ID NO: 21: aufgeführt.

Beispiel 4: Herstellung des Plasmids pCLiK5MCS PEF-TU metA

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO 22 und SEQ ID NO 23, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Fragment von ca. 200 Basenpaaren aus dem nichtkodierenden 5'-Bereich (Promotorregion) der Superoxiddismutase (Psod) amplifiziert.

SEQ ID NO: 22
  • 5'-GAGACTCGAGGGCCGTTACCCTGCGAATG-3' und
SEQ ID NO: 23
  • 5'-CCTGAAGGCGCGAGGGTGGGCATTGTATGTCCTCCTGGAC-3'

Das erhaltene DNA Fragment wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

Ausgehend vom Plasmid PmetA metA SEQ ID NO: 16 als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimern SEQ ID NO: 24 und SEQ ID NO: 25 ein Teil von metA amplifiziert.

SEQ ID NO: 24
  • 5'-CCCACCCTCGCGCCTTCAG-3'

    und
SEQ ID NO: 25
  • 5'-CTGGGTACATTGCGGCCC-3'

Das erhaltene DNA Fragment von ungefähr 470 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.

In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer SEQ ID NO: 18 eingebrachten, zu metA homologen Sequenzen, kommt es im Zuge der PCR-Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidprimer SEQ ID NO: 22 und SEQ ID NO: 25 erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden.

Das amplifizierte DNA Fragment von ungefähr 675 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen XhoI und NcoI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 620 Basenpaar große DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.

Das Plasmid PmetA metA SEQ ID NO: 16 wurde mit den Restriktionsenzymen NcoI und SpeI (Roche Diagnostics, Mannheim) gespalten. Nach gelelektrophoretischer Auftrennung wurde ein ca. 0,7 kb großes metA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit aus der Agarose aufgereinigt.

Der Vektor pClik5MCS SEQ ID NO: 13 wurde mit den Restriktionsenzymen XhoI und SpeI (Roche Diagnostics, Mannheim) geschnitten und ein 5 kb großes Fragment nach elektrophoretischer Auftrennung mit GFXTMPCR, DNA and Gel Band Purification Kit isoliert.

Das Vektorfragment wurde zusammen mit dem PCR-Fragment und dem metA-Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das entstandene Plasmid pCLiK5MCS P_EFTUmetA ist als SEQ ID NO: 26 aufgeführt.

Beispiel 5: Herstellung des Plasmid pCLiK5MCS Pgro metA

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO 27 und SEQ ID NO 28, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Fragment von ca. 200 Basenpaaren aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) der Gens GroES (Pgro) amplifiziert.

SEQ ID NO: 27
  • 5'-GAGACTCGAGCGGCTTAAAGTTTGGCTGCC-3'
SEQ ID NO: 28
  • 5'-CCTGAAGGCGCGAGGGTGGGCATGATGAATCCCTCCATGAG-3'

Das erhaltene DNA Fragment wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

Ausgehend vom Plasmid PmetA metA als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimern SEQ ID NO:29 und SEQ ID NO: 30 ein Teil von metA amplifiziert.

SEQ ID NO: 29
  • 5'-CCCACCCTCGCGCCTTCAG-3'
SEQ ID NO: 30
  • 5'-CTGGGTACATTGCGGCCC-3'

Das erhaltene DNA Fragment von ungefähr 470 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.

In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer SEQ ID NO: 28 eingebrachten, zu metA homologen Sequenzen, kommt es im Zuge der PCR-Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidprimer SEQ ID NO: 27 und SEQ ID NO: 30 erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden.

Das amplifizierte DNA Fragment von ungefähr 675 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen XhoI und NcoI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 620 Basenpaar große DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.

Das Plasmid PmetA metA SEQ ID NO: 16 wurde mit den Restriktionsenzymen NcoI und SpeI (Roche Diagnostics, Mannheim) gespalten. Nach gelelektrophoretischer Auftrennung wurde ein ca. 0,7 kb großes metA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit aus der Agarose aufgereinigt.

Der Vektor pCIik5MCS SEQ ID NO: 13 wurde mit den Restriktionsenzymen XhoI und SpeI (Roche Diagnostics, Mannheim) geschnitten und ein 5 kb großes Fragment nach elektrophoretischer Auftrennung mit GFXTMPCR, DNA and Gel Band Purification Kit isoliert.

Das Vektorfragment wurde zusammen mit dem PCR-Fragment und dem metA-Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das entstandene Plasmid pCLiKSMCS Pgro metA ist als SEQ ID NO: 31 aufgeführt.

Beispiel 6: Herstellung des Plasmids PEF-TS metA

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer BK 1849 (SEQ ID NO: 32) und BK 1862 (SEQ ID NO: 33), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, das metA Gen, das für die Homoserin-O-Acetyltransferase kodiert, amplifiziert.

BK 1849 (SEQ ID NO: 32)
  • 5'-GTGTGTCGACTTAGATGTAGAACTCGATGTAG-3'

    und
BK 1862 (SEQ ID NO: 33)
  • 5'-ATGCCCACCCTCGCGCC-3'

Das erhaltene DNA Fragment von ca. 1134 bp Größe wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

Mit den Oligonukleotidprimer Haf 26 (SEQ ID NO: 34) und Haf 27 (SEQ ID NO: 35), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment von ca. 200 Basenpaaren aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) der Gens, das für den Elongationsfaktor TS kodiert, amplifiziert.

Haf 26 (SEQ ID NO: 34)
  • 5'-GAGAGGATCCCCCCCACGACAATGGAAC-3'

    und
Haf 27 (SEQ ID NO: 35)
  • 5'-CCTGAAGGCGCGAGGGTGGGCATTACGGGGCGATCCTCCTTATG-3'

Das erhaltene DNA Fragment von ca. 195 bp Größe wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

Die Primer Haf 27 und BK 1862enthalten eine überlappende Sequenz und sind an ihren 5'-Enden homolog zueinander.

Die oben erhaltenen PCR-Produkte wurden als Template für eine weitere PCR eigensetzt, in der die Primer BK 1849 (SEQ ID NO: 32) und Haf 26 (SEQ ID NO: 34) genutzt wurden.

Mit diesem Ansatz konnte ein DNA-Fragment amplifiziert werden, das der erwarteten Größe von 1329 bp entsprach. Diese P EF-TS/metA-Fusion wurde dann über die Restriktionschnittstellen BamHI und SalI in den Vektor pClik 5a MCS (SEQ ID NO: 13) kloniert.

Das Vektorfragment wurde zusammen mit dem PCR-Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das resultierende Plasmid wurde mit pClik 5a MCS PEF-TS metA (SEQ ID NO: 36) bezeichnet.

Beispiel 7: Herstellung des Plasmids PEF-Tu pSOD metA (H473)

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer BK 1753 (SEQ ID NO: 37) und BK 1754 (SEQ ID NO: 38) , der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, der GroEL-Terminator amplifiziert.

BK 1753 (SEQ ID NO: 37)
  • GGATCTAGAGTTCTGTGAAAAACACCGTG
BK 1754 (SEQ ID NO: 38)
  • GCGACTAGTGCCCCACAAATAAAAAACAC

Das erhaltene DNA Fragment von ca. 77 bp Größe wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt, mit den Restriktionsenzymen XbaI und BcuI geschnitten und nochmals gereinigt.

Der Vektor pClik5MCS (SEQ ID NO: 13) wurde mit dem Restriktionsenzym XbaI linearisiert und mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt, Der linearisierte Vektor wurde zusammen mit dem PCR-Fragment mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das resultierende Plasmid wurde mit H247 bezeichnet (SEQ ID NO: 39) bezeichnet.

Dieses Plasmid wurde mit den Restriktionsenzymen BcuI und SalI behandelt und mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt, Eine PCR mit den Oligonukleotiden BK 1848 (SEQ ID NO: 40) und BK 1849 (SEQ ID NO: 41), dem Plasmid pClik5MCS Psod metA (SEQ ID NO: 21) als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, durchgeführt. Das amplifizierte Fragment hatte eine erwartete Länge von ca 1350 bp und wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt, mit den Restriktionsenzymen BcuI und SalI geschnitten und nochmals gereinigt.

Dieses Fragment wurde mit dem Plasmid H247 (Schnittstellen BcuI und SalI) mit Hilfe des Rapid DNA Ligation Kits (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das resultierende Plasmid wurde als pG A4 (H344) bezeichnet und ist unter der SEQ ID NO: 42 aufgeführt.

SEQ ID NO: 40 (BK 1848)
  • GAGAACTAGTAGCTGCCAATTATTCCGGG
SEQ ID NO: 41 (BK 1849)
  • GTGTGTCGACTTAGATGTAGAACTCGATGTAG

Das Plasmid pG A4 (SEQ ID NO: 42) wurde mit den Restriktionsenzymen XhoI und BcuI geschnitten und mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

Konstruktion von H473:

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer BK 1695 (SEQ ID NO: 43) und Haf16 (SEQ ID NO: 44), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment von ca. 182 Basenpaaren aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) der Gens EF Tu (Peftu) amplifiziert.

SEQ ID NO: 43 (BK1695)
  • GAGACTCGAGGGCCGTTACCCTGCGAATG
SEQ ID NO: 44 (Haf16)
  • GAGAACTAGTGTGGCTACGACTTTCGCAGC

Das erhaltene DNA Fragment von ca. 200 bp Größe wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt, mit den Restriktionsenzymen XhoI und BcuI geschnitten und nochmals gereinigt.

Dieses Fragment wurde mit dem Plasmid Plasmid pG A4 (H344) (Schnittstellen XhoI und BcuI) mit Hilfe des Rapid DNA Ligation Kits (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Das erhaltene Plasmid wurde pClik5MCS PeftuPsod metA genannt (H473). Es ist unter SEQ ID NO: 45 aufgeführt. Es enthält (von 5' nach 3') einen Peftu-Promoter, eine Psod Expressionseinheit und direkt anschließend das metA open reading frame.

Beispiel 8: Herstellung des Plasmides PsodPeftu metA (H505)

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO: 46 (Haf64) und SEQ ID NO: 47 (Haf65), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment von ca. 200 aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) des Gens EF Tu (Peftu) amplifiziert.

SEQ ID NO: 46 (Haf64)
  • GAGAACTAGTGGCCGTTACCCTGCGAATG
SEQ ID NO: 47 (Haf65)
  • GCGCGAGGGTGGGCATTGTATGTCCTCCTGGACTTC

Das erhaltene DNA Fragment von ca. 200 bp Größe wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

In einer zweiten PCR mit den Oligonukleotidprimern BK1862 (SEQ ID NO: 48) und BK1849 (SEQ ID NO: 49) und dem Plasmid H344 (SEQ ID NO: 42) als Template wurde das metA open reading frame nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, amplifiziert. Das erhaltene Fragment von ca. 1140 bp Länge wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

SEQ ID NO: 48 (BK1862)
  • ATGCCCACCCTCGCGCC
SEQ ID NO: 49 (BK1849)
  • GTGTGTCGACTTAGATGTAGAACTCGATGTAG

In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer Haf 65 SEQ ID NO: 47 eingebrachten zu metA homologen Sequenzen, kommt es im Zuge der PCR-Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidprimer Haf 64 und BK 1849 SEQ ID NO: 46 und SEQ ID NO: 49 erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden.

Das amplifizierte DNA Fragment von ungefähr 1350 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen BcuI und SalI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 1340 Basenpaar große DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt. Dieses Fragment enthält die Peftu-Expressionseinheit fusioniert mit dem metA ORF (= Fragment Peftu-metA).

Mit den Oligonukleotidprimer BK 1697 (SEQ ID NO: 50) und Haf17 (SEQ ID NO:51), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment (Gesamtlänge: 193 bp, davon 173 pSOD) aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) des Gens SOD (Psod) amplifiziert.

SEQ ID NO: 50 (BK 1697)
  • GAGACTCGAGAGCTGCCAATTATTCCGGG
SEQ ID NO: 51 (Haf 17)
  • GAGAACTAGTTAGGTTTCCGCACCGAGC

Das amplifizierte DNA Fragment wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen XhoI und BcuI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 180 Basenpaar große DNA Fragment mit GFXTMPCR, DNA and Gel Band Puqrification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt (= Fragment Psod).

Das Plasmid (H344) pG A4 SEQ ID NO: 42 wurde mit den Restriktionsenzymen XhoI und SalI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde linearisierte Vektor mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.

Der linearisierte Vektor wurde mit den beiden Fragmenten (Fragment Peftu-metA und Fragment Psod) mit Hilfe des Rapid DNA Ligation Kits (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das entstandene Plasmid pClik5MCS PsodPeftu metA ist als SEQ ID NO: 52 aufgeführt.

Beispiel 9:

Herstellung des Plasmides pClik5MCS Pgro Psod metA (H472) Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimern SEQ ID NO: 53 (BK1701) und SEQ ID NO: 54 (Haf18), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment von ca. 175 Nt amplifiziert. Es enthält 155 Basenparre aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) des Gens GRO EL (Pgro) und je eine Restriktionsschnittstelle am 5' und 3' Ende (XhoI bzw. BcuI).

SEQ ID NO: 53 (BK1701)
  • GAGACTCGAGCGGCTTAAAGTTTGGCTGCC
SEQ ID NO: 54 (Haf018)
  • GAGAACTAGTATTTTGTGTGTGCCGGTTGTG

Das erhaltene DNA Fragment von ca. 175 bp Größe wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen XhoI und BcuI (Roche Diagnostics, Mannheim) gespalten und das DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit aufgereinigt.

Das Plasmid H344 (SEQ ID NO: 42) wurde mit den Restriktionsenzymen XhoI und BcuI geschnitten und ein ca. 6.4 kb großes Fragment nach elektrophoretischer Auftrennung mit GFXTMPCR, DNA and Gel Band Purification Kit isoliert.

Das PCR-Produkt und das aufgeschnittene Plasmid H344 wurden mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt.

Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das resultierende Plasmid enthält einen Pgro-Promoter direkt gefolgt von einer Psod-Expressionseinheit und dem metA ORF.

Es ist als pCLiK5MCS PgroPsod metA (H472) ist als SEQ ID NO: 55 aufgeführt.

Beispiel 10: Herstellung des Plasmides PgroPsod Pefts metA (H501)

Mit den Oligonukleotidprimern BK1782 (SEQ ID NO: 56) und Haf63 (SEQ ID NO: 57) und dem Plasmid pClik5MCS Pgro Psod metA (SEQ ID NO: 55 (H472)) als template wurde ein PCR nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, durchgeführt. Das amplifizierte Fragment umfasst ca. 474 Basenparre und enthält eine Pgro-Psod-Kassette mit einer Acc65I-Schnittstelle am 3'-Ende. Das erhaltene DNA Fragment wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen XhoI und Acc65I gespalten und das DNA Fragment (333 Basenpaare) mit GFXTMPCR, DNA and Gel Band Purification Kit aufgereinigt.

SEQ ID NO: 56 (BK1782)
  • TCGAGAGATTGGATTCTTAC
SEQ ID NO: 57 (Haf 63)
  • TCTCGGTACCCCGCACCGAGCATATACATC

Das Plasmid H479 (SEQ ID NO: 58) enthält die Pefts Expressionseinheit fusioniert mit dem metA ORF. Es wurde mit den Restriktionsenzymen XhoI und Acc65I (direkt upstream von Pefts) geschnitten und ein ca. 6.4 kb großes Fragment nach elektrophoretischer Auftrennung mit GFXTMPCR, DNA and Gel Band Purification Kit isoliert.

Anschließend wurde es mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem PCR-Fragment (Pgro-Psod-Kassette) ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das resultierende Plasmid enthält die 3 Promotoren Pgro Psod und PEF-Ts fusioniert mit dem metA ORF.

Es ist als pCLiK5MCS Pgro Psod Pefts metA (H501) ist als SEQ ID NO: 59 aufgeführt.

Beispiel 11: Herstellung des Plasmides Peftu Psod Pefts metA (H502)

Mit den Oligonukleotidprimern BK1782 (SEQ ID NO: 56) und Haf63 (SEQ ID NO: 57) und dem Plasmid pClik5MCS Peftu Psod (SEQ ID NO: 45 (H473)) als Template wurde ein PCR nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, durchgeführt. Das amplifizierte Fragment umfasst ca. 495 Basenparre und enthält eine Peftu-Psod-Kassette mit einer Acc65I-Schnittstelle am 3'-Ende. Das erhaltene DNA Fragment wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen XhoI und Acc65I gespalten und das DNA Fragment (354 Basenpaare) mit GFXTMPCR, DNA and Gel Band Purification Kit aufgereinigt.

SEQ ID NO: 56 (BK1782)
  • TCGAGAGATTGGATTCTTAC
SEQ ID NO: 57 (Haf 63)
  • TCTCGGTACCCCGCACCGAGCATATACATC

Das Plasmid H479 (SEQ ID NO: 58) enthält die Pefts Expressionseinheit fusioniert mit dem metA ORF. Es wurde mit den Restriktionsenzymen XhoI und Acc65I (direkt upstream von Pefts) geschnitten und ein ca. 6.4 kb großes Fragment nach elektrophoretischer Auftrennung mit GFXTMPCR, DNA and Gel Band Purification Kit isoliert.

Anschließend wurde es mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem PCR-Fragment (Peftu-Psod-Kassette) ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das resultierende Plasmid enthält die 3 regulatorischen Sequenzen Peftu Psod und P EF-Ts fusioniert mit dem metA ORF. Es ist als pCLiK5MCS Peftu Psod Pefts metA (H501) ist als SEQ ID NO: 60 aufgeführt.

Beispiel 12: Messung der metA-Aktivitäten

Der Stamm Corynebacterium glutamicum ATCC13032 wurde jeweils mit den Plasmiden pClik5 MCS, pClik MCS Psod metA, pClik MCS Peftu metA, pClik5 MCS Pefts metA, pClik5 MCS Peftu Psod metA, pClik5 MCS Psod Peftu metA, pClik5 MCS Pgro Psod meta, pClik5 MCS Pgro Psod Pefts metA, pClik5 MCS Peftu Psod Pefts metA nach der beschriebenen Methode (Liebl, et al. (1989) FEMS Microbiology Letters 53:299–303) transformiert. Die Transformationsmischung wurde auf CM-Platten plattiert, die zusätzlich 20mg/l Kanamycin enthielten, um eine Selektion auf Plasmid-haltige Zellen zu erreichen. Erhaltene Kan-resistente Klone wurden gepickt und vereinzelt.

C. glutamicum Stämme, die eines dieser Plasmidkonstrukte enthielten, wurden in MMA-Medium ((40 g/l Saccharose, 20 g/l (NH4)2SO4, 1 g/l KH2PO4, 1 g/l K2HPO4, 0,25g/l MgSO4 × 7H2O, 54 g Aces, 1 ml CaCl2 (10 g/l), 1 ml Protocatechoat (300 mg/10 ml), 1 ml Spurenelementelösung (10 g/l FeSO4 × /H2O, 10 g/l MnSO4 × H2O, 2 g/l ZnSO4 × 7 H2O, 0,2 g/l CuSO4, 0,02 g/l NiCl2 × 6 H2O), 100 &mgr;g/l Vitamin B12, 0,3 mg/l Thiamin, 1 mM Leucin, 1 mg/l Pyridoxal HCl, 1 ml Biotin (100 mg/l), pH7,0) bei 30°C über Nacht angezogen. Die Zellen wurden bei 4°C abzentrifugiert und das zweimal mit kaltem Tris-HCl-Puffer (0,1%, pH 8,0) gewaschen. Nach erneuter Zentrifugation wurden die Zellen in kalten Tris-HCl-Puffer (0,1%, pH 8,0) aufgenommen und eine OD600 von 160 eingestellt. Für den Zellaufschluß wurden 1 ml dieser Zellsuspension in 2 ml Ribolyserröhrchen der Fa. Hybaid überführt und in einem Ribolyser der Fa. Hybaid bei einer Rotationseinstellung von 6,0 dreimal für jeweils 30 sec lysiert. Das Lysat wurde durch 30minütige Zentrifugation bei 15.000 rpm bei 4°C in einer Eppendorfzentrifuge geklärt und der Überstand in ein neues Eppendororfcup überführt. Der Proteingehalt wurde nach Bradford, M.M. (1976) Anal. Biochem. 72:248–254 bestimmt.

Die enzymatische Aktivität von MetA wurde wie folgt durchgeführt. Die Reaktionsansätze von 1 ml enthielten 100 mM Kaliumphosphatpuffer (pH 7,5), 5mM MgCl2, 100 &mgr;M Acetyl CoA, 5mM L-Homoserine, 500 &mgr;M DTNB (Ellmans Reagenz) und Zellextrakt. Der Test wurde durch Zugabe von dem jeweiligen Proteinlysat gestartet und bei Raumtemperatur inkubiert. Es wurde dann eine Kinetik bei 412 nm über 10 min aufgenommen.

Die Ergebnisse sind in Tabelle 1a gezeigt.

Tabelle 1a

Die Aktivität von MetA konnte durch die Verwendung der verschiedenen Kombinationen von Promotern/Expressionseinheiten moduliert werden.

Beispiel 13: Konstruktion von Plasmid pClS lysC

Um einen Lysin-produzierenden Stamm zu generieren wurde ein allelischer Austausch des lysC Wildtypgens in Corynebakterium glutamicum ATCC13032 durchgeführt. Dabei wurde im lysC Gen ein Nukleotidaustausch durchgeführt, so daß im resultierenden Protein die Aminosäure Thr an der Position 311 durch ein Ile ausgetauscht wurde. Ausgehend von der chromosomalen DNA aus ATCC13032 als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimern SEQ ID NO:61 und SEQ ID NO:62 lysC mit Hilfe des Pfu-Turbo PCR Systems (Stratagene USA) nach Angaben des Herstellers amplifiziert.

SEQ ID NO:61
  • 5'-GAGAGAGAGACGCGTCCCAGTGGCTGAGACGCATC-3'
SEQ ID NO:62
  • 5'-CTCTCTCTGTCGACGAATTCAATCTTACGGCCTG-3'

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Das amplifizierte Fragment wird an seinem 5'-Ende von einem SalI Restriktionsschnitt und an seinem 3'-Ende von einem MluI Restriktionsschnitt flankiert. Vor der Klonierung wurde das amplifizierte Fragment durch diese beiden Restriktionsenzyme verdaut und mit GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aufgereinigt.

Das erhaltenen Polynukleotid wurde über die SalI und MluI Restriktionsschnitte in pCLIK5 MCS integrativ SacB im folgenden pClS genannt (SEQ ID NO: 63) kloniert und in E.coli XL-1 blue transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht. Das Plasmid wurdn isoliert und durch Sequenzierung die erwartete Nukleotidsequenz bestätigt. Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet. Das erhaltene Plasmid pClS lysC ist als SEQ ID NO:64 aufgeführt.

Beispiel 14: Mutagenese des lysC Gens aus C. glutamicum

Die gerichtete Mutagenese des lysC Gens aus C. glutamicum wurde mit dem Quick-Change Kit (Fa. Stratagene/USA) nach Angaben des Herstellers durchgeführt. Die Mutagenese wurde im Plasmid pClS lysC, SEQ ID NO:64 durchgeführt. Für den Austausch von thr 311 nach 311 ile mit Hilfe der Quickchange Methode (Stratagene) wurden folgende Oligonukleotidprimer synthetisiert:

SEQ ID NO:65
  • 5'-CGGCACCACCGACATCATCTTCACCTGCCCTCGTTCCG-3'
SEQ ID NO:66
  • 5'-CGGAACGAGGGCAGGTGAAGATGATGTCGGTGGTGCCG-3'

Der Einsatz dieser Oligonukleotidprimer in der Quickchange Reaktion führt in dem lysC Gen SEQ ID NO:67 zu einem Austausch des Nukleotids in Position 932 (von C nach T). Der resultierende Aminosäureaustausch Thr311 Ile im lysC Gen wurde nach Transformation in E.coli XL1-blue und Plasmidpräparation durch ein Sequenzierungsreaktionen bestätigt. Das Plasmid erhielt die Bezeichnung pClS lysC thr311 ile und ist als SEQ ID NO:68 aufgeführt.

Das Plasmid pClS lysC thr311 ile wurde in C. glutamicum ATCC13032 mittels Elektroporation wie bei Liebl, et al. (1989) FEMS Microbiology Letters 53:299–303 beschrieben, transformiert. Modifikationen des Protokolls sind in DE 10046870 beschrieben. Die chromosomale Anordnung des lysC-Lokus einzelner Transformanten wurde mit Standardmethoden durch Southernblot und Hybridisierung wie in Sambrook et al. (1989), Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben, überprüft. Dadurch wurde sichergestellt, daß es sich bei den Transformanten um solche handelt, die das transformierte Plasmid durch homologe Rekombination am lysC-Lokus integriert haben. Nach Wachstum solcher Kolonien über Nacht in Medien, die kein Antibiotikum enthalten, werden die Zellen auf ein Saccharose-CM-Agarmedium (10% Saccharose, 10 g/l Glucose; 2,5 g/l NaCl; 2 g/l Harnstoff, 10 g/l Bacto Peptone (Fa. Difco); 10 g/l Hefeextrakt, 22,0 g/L Agar (Difco)) ausplattiert und bei 30°C für 24 Stunden inkubiert.

Da das im Vektor pClS lysC thr311 ile enthaltende sacB Gen Saccharose in ein toxisches Produkt umwandelt, können nur solche Kolonien anwachsen, die das sacB Gen durch einen zweiten homologen Rekombinationsschritt zwischen dem Wildtyp lysC Gen und dem mutierten Gen lysC thr311 ile deletiert haben. Während der homologen Rekombination kann entweder das Wildtyp Gen, oder das mutierte Gen zusammen mit dem sacB Gen deletiert werden. Wenn das sacB Gen zusammen mit dem Wildtyp Gen entfernt wird, resultiert eine mutierte Transformante.

Anwachsende Kolonien wurden gepickt, und auf eine Kanamycin-sensitiven Phänotyp hin untersucht. Klone mit deletiertem SacB Gen müssen gleichzeitg Kanamycin sensitives Wachstumsverhalten zeigen. Solche Kan-sensitiven Klone wurde im einem Schüttelkolben auf ihre Lysin-Produktivivät hin untersucht (siehe Beispiel 19). Zum Vergleich wurde der nicht behandelte C. glutamicum ATCC13032 angezogen. Klone mit einer gegenüber der Kontrolle erhöhten Lysin-Produktion wurden selektiert, chromosomale DNA gewonnen und der entsprechende Bereich des lysC Gens durch eine PCR-Reaktion amplifiziert und sequenziert. Ein solcher Klon mit der Eigenschaft erhöhter Lysin-Synthese und nachgewiesener Mutation in lysC an der Stelle 932 wurde mit ATCC13032 lysCfbr bezeichnet.

Beispiel 15: Herstellung des Plasmides pClS Peftu ddh

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et alq. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimern SEQ ID NO: 69 (Old38) und SEQ ID NO: 70 (Old 39), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment von ca. 200 aus dem nichtkodierenden 5'-Bereich (Region der Expressionseinheit) des Gens EF Tu (Peftu) amplifiziert.

SEQ ID NO: 69 (Old38)
  • ACATCCATGGTGGCCGTTACCCTGCGAAT
SEQ ID NO: 70 (Old 39)
  • TGTATGTCCTCCTGGACTTC

Das erhaltene DNA Fragment von ca. 200 bp Größe wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

In einer zweiten PCR mit den Oligonukleotidprimern Old40 (SEQ ID NO: 71) und SEQ ID NO: 72 (Old 37) und chromosomaler DNA aus C. glutamicum ATCC 13032 als template wurde das ddh open reading frame nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, amplifiziert. Das erhaltene Fragment von ca. 1017 bp Länge wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.

Old40 (SEQ ID NO: 71)
  • AAGTCCAGGAGGACATACAATGACCAACATCCGCGTAGC
Old 37 (SEQ ID NO: 72)
  • GAAACCACACTGTTTCCTTGC

In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer Old40 SEQ ID NO: 71 eingebrachten zu Peftu homologen Sequenzen, kommt es im Zuge der PCR-Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidprimer Old37 und Old 38 (SEQ ID NO: 72 und SEQ ID NO: 69) erst mit Beginn des 2. Zykluses dem Reaktionsansatz zugegeben wurden.

Das amplifizierte DNA Fragment von ungefähr 1207 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen NcoI und XhoI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 1174 Basenpaar große DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt. Dieses Fragment enthält die Peftu-Expressionseinheit fusioniert mit dem ddh ORF (= Fragment Peftu-ddh).

Mit den Oligonukleotidprimer Old 32 (SEQ ID NO: 73) und Old 33 (SEQ ID NO: 74), der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden, wie in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press beschrieben, ein DNA Fragment aus dem nichtkodierenden 5'-Bereich des Gens ddh amplifiziert.

SEQ ID 73 (Old32)
  • ATCAACGCGTCGACACCACATCATCAATCAC
SEQ ID 74 (Old33)
  • ATCACCATGGGTTCTTGTAATCCTCCAAAATTG

Das amplifizierte DNA Fragment wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen MluI und NcoI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 720 Basenpaar große DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt (= Fragment 5' ddh).

Das Plasmid pClS (SEQ ID NO: 63) wurde mit den Restriktionsenzymen MluI und XhoI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde linearisierte Vektor mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.

Der linearisierte Vektor wurde mit den beiden Fragmenten (Fragment Peftu-ddh und Fragment 5' ddh) mit Hilfe des Rapid DNA Ligation Kits (Roche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.

Das entstandene Plasmid pCIS Peftu ddh ist als SEQ ID NO: 75 aufgeführt.

Beispiel 16: Herstellung von pClS PeftuPsod ddh

Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO: 76 und SEQ ID NO: 77, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Fragment von ca. 677 Basenpaaren aus dem 5'-Bereich der ddh-Gens amplifiziert (Fragment 5'ddh).

SEQ ID NO: 76 (CK461)
  • CCTGACGTCGCAATATAGGCAGCTGAATC
SEQ ID NO: 77 (CK466)
  • GCCCAATTGGTTCTTGTAATCCTCCAAAA

Das erhaltene DNA Fragment wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen AatlI und MunI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 661 Basenpaar große DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt. Das entstandene Fragment enthät den 5'-Bereich des ddh-ORFs.

Ausgehend vom Plasmid PEF-Tu pSOD metA (H473) (SEQ ID 45) als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimern SEQ ID NO:-78 und SEQ ID NO: 79 eine PeftuPsod Kassette amplifiziert.

SEQ ID NO: 78 (CK426)
  • CGCCAATTGTCGAGGGCCGTTACCCT
SEQ ID NO: 79 (CK463)
  • GCTACGCGGATGTTGGTCATGGGTAAAAAATCCTTTCGTA

Das erhaltene DNA Fragment von ungefähr 378 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.

In einer nachfolgenden PCR wurde das ddh ORF amplifiziert. Dazu wurde chromosomale DNA aus C. glutamicum ATCC 13032 nach Tauch et al. (1995) Plasmid 33:168–179 oder Eikmanns et al. (1994) Microbiology 140:1817–1828 präpariert. Mit den Oligonukleotidprimer SEQ ID NO: 80 (CK464) und SEQ ID NO: 81 (CK467=, der chromosomalen DNA als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Polymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Fragment von ca. 992 Basenpaaren (ddh-ORF) amplifiziert (Fragment ddh). Das amplifizierte DNA Fragment wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.

SEQ ID NO: 80 (CK464)
  • TACGAAAGGATTTTTTACCCATGACCAACATCCGCGTAGC
SEQ ID NO: 81 (CK467)
  • AGACCCGGGTTAGACGTCGCGTGCGATCA

In einer weiteren PCR Reaktion wurden die beiden oben erhaltenen Fragmente (PeftuPsod-Kassette und ddh-ORF) gemeinsam als Template eingesetzt. Durch die mit dem Oligonukleotidprimer SEQ ID NO: 80 (CK464) eingebrachten, zu Psod homologen Sequenzen, kommt es im Zuge der PCR-Reaktion zu einer Anlagerung beider Fragmente aneinander und einer Verlängerung zu einem durchgehenden DNA-Strang durch die eingesetzte Polymerase. Die Standardmethode wurde dahingehend modifiziert, dass die verwendeten Oligonukleotidprimer SEQ ID NO: 79 (CK426) und SEQ ID NO: 81 (CK467) erst mit Beginn des 2. Zyklus dem Reaktionsansatz zugegeben wurden.

Das amplifizierte DNA Fragment von ungefähr 1359 Basenpaaren wurde mit dem GFXTMPCR, DNA and Gel Band Purification Kit nach Angaben des Herstellers gereinigt.

Im Anschluß daran wurde es mit den Restriktionsenzymen MunI und SmaI (Roche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 1349 Basenpaar große DNA Fragment mit GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.

Das entstandene Fragment enthält (von 5' nach 3') einen Peftu-Promoter, eine Psod Expressionseinheit und direkt anschließend das ddh open reading frame (PeftuPsod ddh).

Der Vektor pCIS wurde mit den Restriktionsendonukleasen AatlI und Smal geschnitten und mit alkalischer Phosphatase (Roche Diagnostics, Mannheim) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 4.2 kb) mit dem GFXTMPCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) nach Angaben des Herstellers mit den beiden geschnittenen PCR Fragmenten (5'ddh sowie PeftuPsod ddh) ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL-1Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20&mgr;g/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.

Die Plasmid-DNA von individuellen Klonen wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. 2 korrekte Plasmide wurden sequenziert. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463–5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet. Das entstandene Plasmid pClik Peftu Psod ddh ist dazu geeignet, um mit Hilfe von 2 aufeinanderfolgenden Rekombinationsereignissen die PeftuPsod-Kassette vor das ddh-ORF chromosomal zu integrieren.

Das Plasmid pCIS PeftuPsod ddh ist als SEQ ID NO: 82 aufgeführt.

Beispiel 17: Generierung der Stämme ATCC13032 lysCfbr Peftu ddh und ATCC13032 lysCfbr PeftuPsod ddh

Zellen des E. coli-Stammes Mn522 (Firma Stratagene, Amsterdam, Nierderlande) wurde mit einem der Plasmide pCIS Peftu ddh und pCIS PeftuPsod ddh sowie mit dem Plasmid pTc15AcgIM nach Liebl, et al. (1989) FEMS Microbiology Letters 53:299–303 transformiert. Das Plasmid pTc15AcgIM ermöglicht die Methylierung von DNA nach dem Methylierungsmuster von Corynebacterium glutamicum (DE 10046870). Durch diese Methylierung wird die Stabilität der Plasmide pCIS Peftu ddh und pCIS PeftuPsod ddh in C. glutamicum-Zellen erhöht. Die Plasmid-DNA wurde anschließend aus den Mn522-Zellen nach Standardmethoden isoliert und mit Hilfe von Elektroporation den oben beschriebenen Corynebacterium glutamicum -Stamm ATCC 13032 ask (fbr) eingebracht. Aus dieser Elektroporation und der nachfolgenden Selektion auf CM-Platten mit Kanamycin (25 &mgr;g/ml) wurden mehrere Transkonjuganten erhalten. Zur Selektion auf das zweite Rekombinationsereignis, das zur Excision des Vektors führen soll, wurden diese Transkonjuganten in CM-Medium über Nacht ohne Kanamycin angezogen und anschließend zur Selektion auf CM-Platten mit 10% Saccharose ausplattiert. Das auf dem Vektor pCIS vorhandenen sacB-Gen kodiert für das Enzym Laevansucrase und führt bei Wachstum auf Saccharose zur Synthese von Laevan. Da Laevan für C. glutamicum toxisch ist, können nur C. glutamicum Zellen, die das Integrationsplasmid durch den zweiten Rekombinationsschritt verloren haben, auf Saccharosehaltigem Medium wachsen (Jäger et al., Journal of Bacteriology 174 (1992) 5462–5466). 100 Saccharose-resistente Klone wurden auf ihre Kanamycin-Sensitivität hin überprüft. Für mehrere der getesteten Klone konnte neben der Resistenz gegenüber Saccharose auch eine Sensitivität gegenüber Kanamycin nachgewiesen werden, was bei der erwünschten Excision der Vektorsequenzen erwartet wird. Ob auch die gewünschte Integration der Peftu bzw PeftuPsod-Expressionseinheit erfolgt war, wurde mittels Polymerase-Kettenreaktion (PCR) überprüft. Hierzu wurden die jeweiligen Klone mit einem Zahnstocher von der Agarplatte abgenommen und in 100 &mgr;l H2O suspendiert und 10 min bei 95°C aufgekocht. Jeweils 10 &mgr;l der erhaltenen Lösung wurden als Template in die PCR eingesetzt. Als Primer wurden Oligonukleotide verwendet, die zur einzuführenden Expressionseinheit und dem ddh-Gen homolog sind. Die PCR-Bedingungen wurden wie folgt gewählt: Vorabdenaturierung:5 min bei 95°C; Denaturierung 30 sec bei 95°C; Hybridisierung 30 sec bei 55°C; Amplifizierung 2 min bei 72°C; 30 Zyklen,; End-Extension 5 min bei 72°C. Im Ansatz mit der DNA des Ausgangsstammes konnte durch Wahl der Oligonukleotide kein PCR-Produkt entstehen. Nur bei Klonen, die durch die 2. Rekombination die Integration der Peftu oder PeftuPsod-Expressionseinheiten direkt 5' des ddh-Gens vollzogen haben, wurde ein Bande erwartet. Die erfolgreiche Integration der dabei positiv getesteten Klone wurde zudem noch per Southern blot Analyse bestätigt (nach Standardmethoden, wie z.B. in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)). Für jeden zu generierenden Stamm wurden dabei 2 unterschiedliche Hydrolysen mit Restriktionsenzymen durchgeführt, die eine eindeutige Unterscheidung von Ausgangsstamm (ATCC13032 ask (fbr)) und erwünschtem Stamm zulässen. Zudem wurde mit Hilfe einer Sonde, die homolog zum Kanamycin-Resistenz-Gen ist, bestätigt, dass die erhaltenen Stämme keine Kanamycin-Gene im Chromosom aufweisen.

So konnten folgende Stämme generiert werden:

ATCC13032 lysCfbr Peftu ddh

ATCC13032 LysCfbr PeftuPsod ddh

All diese Stämme enthalten ein feedback-dereguliertes ask-Gen und produzieren daher Lysin. Sie unterscheiden sich ausschließlich durch die Regulationseinheit, die die Transkription des ddh-Gens steuert.

Beispiel 18: Auswirkung der Verstärkung von ddh durch einen Doppelpromoter auf die Lysinproduktion

Zur Untersuchung der Auswirkung der Verstärkung des ddh-Gens mit Hilfe eines Doppelpromoters wurden folgende Stämme auf Lysin-Produktion untersucht:

ATCC13032 lysCfbr

ATCC13032 lysCfbr Peftu ddh

ATCC13032 lysCfbr Peftu Psod ddh

Dazu wurden die Stämme auf CM-Platten (10,0 g/L D-glucose, 2,5 g/L NaCl, 2,0 g/L Harnstoff, 10,0 g/L Bacto Pepton (Difco), 5,0 g/L Yeast Extract (Difco), 5,0 g/L Beef Extract (Difco), 22,0 g/L Agar (Difco), autoklaviert (20 min. 121 °C)) für 2 Tage bei 30°C angezogen. Anschließend wurden die Zellen von der Platte abgekratzt und in Saline resuspendiert. Für die Hauptkultur wurden 10 ml Medium I und 0,5 g autoklaviertes CaCO3 (Riedel de Haen) in einem 100 ml Erlenmeyerkolben mit der Zellsuspension bis zu einer OD600 von 1,5 beimpft und für 40h auf einem vom Typ Infors AJ118 (Fa. Infors, Bottmingen, Schweiz) bei 220 upm inkubiert. Anschließend wurde die Konzentration des in das Medium ausgeschiedene Lysins bestimmt. Medium I: 40g/l Saccharose 60g/l Melasse (auf 100% Zuckergehalt berechnet) 10g/l (NH4)2SO4 0.4g/l MgSO4·7H2O 0.6g/l KH2PO4 0.3mg/l Thiamin·HCl 1mg/l Biotin (aus einer 1 mg/ml steril flitrierten Stammlösung die mit NH4OH auf pH 8,0 eingestellt wurde) 2mg/l FeSO4 2mg/l MnSO4 mit NH4OH auf pH 7,8 eingestellt, autoklaviert (121°C, 20 min).
zusäztlich wird Vitamin B12 (Hydroxycobalamin Sigma Chemicals) aus einer Stammlösung (200 &mgr;g/ml, steril filtriert) bis zu einer Endkonzentration von 100 &mgr;g/l zugegeben

Die Bestimmung der Aminosäurekonzentration erfolgte mittels Hochdruckflüssigkeitschromatographie nach Agilent auf einer Agilent 1100 Series LC System HPLC. Eine Vorsäulenderivatisierung mit Ortho-Pthalaldehyd erlaubt die Quantifizierung der gebildeten Aminosäuren, die Auftrennung des Aminosäuregemisch findet auf einer Hypersil AA-Säule (Agilent) statt.

Das Ergebnis der Untersuchung ist in folgender Tabelle dargestellt



Es folgt ein Sequenzprotokoll nach WIPO St. 25.

Dieses kann von der amtlichen Veröffentlichungsplattform des DPMA heruntergeladen werden.


Anspruch[de]
  1. Mehrfachpromoter-enthaltende Expressionseinheit umfassend in 5'-3'-Richtung ein Sequenzmodul der folgenden allgemeinen Formel I: 5'-P1-(-Ax-Px-)n-Ay Py-3'(I) worin

    n für einen ganzzahligen Wert von 0 bis 10 steht,

    Ax und Ay gleich oder verschieden sind und für eine chemische Bindung oder eine Linker-Nukleinsäuresequenz stehen;

    P1, Px und Py für gleiche oder verschiedene Promotorsequenzen kodieren, welche wenigstens einen RNA-Polymerase-bindenden Abschnitt umfassen; und wenigstens Py einen die Ribosomenbindung vermittelnden, 3'-terminalen Sequenzabschnitt umfasst.
  2. Expressionseinheit nach Anspruch 1, wobei P1, Px und Py jeweils von gleichen oder verschiedenen eukaryotischen oder prokaryotischen Organismen abgeleitet sind oder künstliche Promotorsequenzen sind.
  3. Expressionseinheit nach Anspruch 2, wobei P1, Px und Py jeweils abgeleitet sind von einer zusammenhängenden Sequenz von 35 bis 500 Nukleotidresten, die im Genom des Organismus 5'-stromaufwärts von der kodierenden Sequenz für ein Protein liegt.
  4. Expressionseinheit nach Anspruch 2 oder 3, wobei der Organismus ein coryneformes Bakterium ist.
  5. Expressionseinheit nach einem der vorhergehenden Ansprüche, wobei P1, Px und Py unabhängig voneinander ausgewählt sind unter Promotorsequenzen für die kodierende Sequenz eines Proteins mit hoher Abundanz in einem Organismus.
  6. Expressionseinheit nach einem der vorhergehenden Ansprüche, wobei P1, Px und Py unabhängig voneinander ausgewählt sind unter SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 und SEQ ID NO:4.
  7. Expressionseinheit nach einem der vorhergehenden Ansprüche, wobei die Promotoren ausgewählt sind unter starken, konstitutiven oder regulierbaren Promotoren.
  8. Expressionskassette, umfassend in 5'-3'-Richtung ein Sequenzmodul der folgenden allgemeinen Formel II: 5'-P1-(-Ax-Px-)n-Ay-Py-G-3'(II) worin

    n, Ax, Ay, P1, Px und Py wie oben definiert sind und

    G für wenigstens eine kodierende Nukleinsäuresequenz steht, welche mit der 5'-stromaufwärts gelegenen regulatorischen Sequenz funktionell verknüpft ist.
  9. Expressionskassette nach Anspruch 8, wobei G ausgewählt ist unter

    a. Nukleinsäuren kodierend ein Protein aus den Biosyntheseweg von proteinogenen und nicht-proteinogenen Aminosäuren,

    b. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Nukleotiden und Nukleosiden,

    c. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von organischen Säuren,

    d. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Lipiden und Fettsäuren,

    e. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Diolen,

    f. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Kohlenhydraten,

    g. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von aromatische Verbindungen,

    h. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Vitaminen,

    i. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Cofaktoren und

    j. Nukleinsäuren kodierend ein Protein aus dem Biosyntheseweg von Enzymen.

    k. Nukleinsäuren kodierend ein Protein aus dem Zentralstoffwechsel.
  10. Expressionskassette nach Anspruch 9a), wobei die Nukleinsäuren für Proteine aus dem Biosyntheseweg von Aminosäuren, ausgewählt unter Aspartatkinase, Aspartat-Semialdehyd-Dehydrogenase, Diaminopimelat-Dehydrogenase, Diaminopimelat-Decarboxylase, Dihydrodipicolinate-Synthetase, Dihydrodipicolinate-Reduktase, Glycerinaldehyd-3-Phosphat-Dehydrogenase, 3-Phosphoglycerat-Kinase, Pyruvat-Carboxylase, Triosephosphat-Isomerase, Transkriptioneller Regulator LuxR, Transkriptioneller Regulator LysR1, Transkriptioneller Regulator LysR2, Malat-Quinon-Oxidoreduktase, Glucose-6-Phosphat-Deydrogenase, 6-Phosphogluconat-Dehydrognease, Transketolase, Transaldolase, Homoserin-O-Acetyltransferase, Cystahionin-gamma-Synthase, Cystahionin-beta-Lyase, Serin-Hydroxymethyltransferase, O-Acetylhomoserin-Sulfhydrylase, Methylen-Tetrahydrofolat-Reduktase, Phosphoserin-Aminotransferase, Phosphoserin-Phosphatase, Serin-Acetyl-Transferase, Homoserin-Dehydrogenase, Homoserin-Kinase, Threonin-Synthase, Threonin-Exporter-Carrier, Threonin-Dehydratase, Pyruvat-Oxidase, Lysin-Exporter, Biotin-Ligase, Cystein-Synthasel, Cystein-Synthase II, Coenzym B12-abhängige Methionin-Synthase, Coenzym B12-unabhängige Methionin-Synthase-Aktivität, Sulfatadenyltransferase Untereinheit 1 und 2, Phosphoadenosin Phosphosulfat Reduktase, Ferredoxin-sulfitreductase, Ferredoxin NADP Reduktase, 3-Phosphoglycerat Dehydrogenase, RXA00655 Regulator, RXN2910-Regulator, Arginyl-t-RNA-Synthetase, Phosphoenolpyruvat-Carboxylase, Threonin Efflux-Protein, Serinhydroxymethyltransferase, Fruktose-1,6-bisphosphatase, Protein der Sulfat-Reduktion RXA077, Protein der Sulfat-Reduktion RXA248, Protein der Sulfat-Reduktion RXA247, Protein OpcA, 1-Phosphofruktokinase, 6-Phosphofruktokinase, Tetrahydropicolinat-Succinylase, Succinyl-aminoketopimelat-Aminotransferase, Succinyl-Diaminopimelat-Desuccinylase, Diaminopimelat-Epimerase, 6-Phosphogluconat-Dehydrogenase, Glucosephosphat-Isomerase, Phosphoglycerat-Mutase, Enolase, Pyruvat-Kinase, Aspartat-Transaminase, und Malat-Enzym, kodieren.
  11. Vektor, umfassend wenigstens eine Expressionskassette nach einem der Ansprüche 8 bis 10.
  12. Genetisch veränderter Mikroorganismus, transformiert mit wenigstens einem Vektor nach Anspruch 11, oder enthaltend wenigstens eine Expressionskassette nach einem der Ansprüche 8 bis 10.
  13. Genetisch veränderter Mikroorganismus nach Anspruch 12, abgeleitet von coryneformen Bakterien.
  14. Genetisch veränderter Mikroorganismus nach Anspruch 13, abgeleitet von Bakterien der Gattung Corynebacterum oder Brevibacterium.
  15. Genetisch veränderter Mikroorganismus nach einem der Ansprüche 12 bis 14, enthaltend wenigstens eine Expressionskassette in integrierter Form.
  16. Verfahren zur Herstellung eines biosynthetischen Produkts, wobei man einen genetisch veränderten Mikroorganismus nach einem der Ansprüche 12 bis 15 kultiviert und das gewünschte Produkt aus der Kultur isoliert.
  17. Verfahren nach Anspruch 16, wobei das biosynthetische Produkt ausgewählt ist unter organischen Säuren, Proteinen, Nukleotiden und Nukleosiden, sowohl proteinogenen als auch nicht-proteinogenen Aminosäuren, Lipiden und Fettsäuren, Diolen, Kohlenhydraten, aromatischen Verbindungen, Vitaminen und Cofaktoren, Enzymen und Proteinen.
  18. Verwendung einer Expressionseinheit nach einem der Ansprüche 1 bis 7 zur Regulation einer Produkt-Biosynthese.
Es folgt ein Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com