PatentDe  


Dokumentenidentifikation DE69434520T2 27.07.2006
EP-Veröffentlichungsnummer 0000711303
Titel BIOTINYLIERUNG VON PROTEINEN
Anmelder Affymax, Inc., Palo Alto, Calif., US
Erfinder SCHATZ, J., Peter, Mountain View, US
Vertreter Meyer, L., Dipl.-Ing., Pat.-Anw., 20354 Hamburg
DE-Aktenzeichen 69434520
Vertragsstaaten CH, DE, FR, GB, IT, LI, NL
Sprache des Dokument EN
EP-Anmeldetag 28.07.1994
EP-Aktenzeichen 949251342
WO-Anmeldetag 28.07.1994
PCT-Aktenzeichen PCT/US94/08528
WO-Veröffentlichungsnummer 1995004069
WO-Veröffentlichungsdatum 09.02.1995
EP-Offenlegungsdatum 15.05.1996
EP date of grant 26.10.2005
Veröffentlichungstag im Patentblatt 27.07.2006
IPC-Hauptklasse C07H 21/04(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 15/11(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/63(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/65(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/62(2006.01)A, L, I, 20051017, B, H, EP   C07K 1/107(2006.01)A, L, I, 20051017, B, H, EP   C12N 9/00(2006.01)A, L, I, 20051017, B, H, EP   C12Q 1/25(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
HINTERGRUND DER ERFINDUNG QUERVERWEIS AUF VERWANDTE ANMELDUNG

Diese Anmeldung ist eine Continuation-In-Part-Anmeldung von U.S. Serial Number 08/099,991, eingereicht am 30. Juli 1993.

1. Gebiet der Erfindung

Die vorliegende Erfindung betrifft Verfahren zur Herstellung von biotinylierten Proteinen in vitro und in rekombinanten Wirtszellen. Die Erfindung betrifft daher das Gebiet der Molekularbiologie, aber angesichts der diversen Anwendungen für rekombinante Proteine betrifft die Erfindung auch die Gebiete der Chemie, Pharmakologie, Biotechnologie und medizinischen Diagnostik.

2. Beschreibung des technischen Hintergrunds

Die Fähigkeit, DNA chemisch zu synthetisieren, ermöglichte die Konstruktion von Peptiden und Proteinen, die ansonsten nicht in der Natur aufgefunden werden und in einer Vielzahl von Verfahren nützlich sind, welche ansonsten sehr schwierig oder gar nicht ausgeführt werden könnten. Ein veranschaulichendes Beispiel dieser Technologie betrifft die als Rezeptoren bekannte Klasse von Molekülen. Rezeptorproteine vermitteln wichtige biologische Funktionen durch Wechselwirkungen mit Liganden. Viele Jahre lang haben Forscher versucht, Liganden zu isolieren und zu identifizieren, welche mit Rezeptoren wechselwirken, auf eine Art und Weise, welche dazu beitragen kann, Humankrankheiten (und andere Krankheiten) zu lindern. Das Aufkommen der Molekularbiologie hat die Art und Weise, auf welche diese Forscher Rezeptor-Ligand-Wechselwirkungen untersuchen, revolutioniert. Beispielsweise ermöglichten molekularbiologische Standardtechniken die Klonierung und Expression auf hohem Niveau von vielen Rezeptoren in rekombinanten Wirtszellen.

Die Patentliteratur, beispielsweise, ist voll von Veröffentlichungen, welche die rekombinante Expression von Rezeptorproteinen beschreiben. Siehe beispielsweise die PCT-Anmeldung mit der Veröffentlichungsnummer 91/18982 und die US Patente Nr. 5,081,228 und 4,968,607, welche rekombinante, für den IL-1 Rezeptor kodierende DNA-Moleküle beschreiben; die US Patente Nr. 4,816,565, 4,578,335 und 4,845,198, welche rekombinante DNA und Proteine beschreiben, die den IL-2 Rezeptor betreffen; die PCT-Anmeldung mit der Veröffentlichungsnummer 91/08214, welche Nukleinsäuren beschreibt, die mit dem Gen für den EGF-Rezeptor in Zusammenhang stehen, die PCT-Anmeldung mit der Veröffentlichungsnummer 91/16431 und US Patent Nr. 4,897,264, welche den Interferon-gamma-Rezeptor und verwandte Proteine und Nukleinsäuren beschreiben; die europäische (EP) Patentanmeldung mit der Veröffentlichungsnummer 0 377 489, welche das C5a-Rezeptorprotein beschreibt; die PCT-Anmeldung mit der Veröffentlichungsnummer 90/08822, welche den EPO-Rezeptor und Nukleinsäuren in Zusammenhang damit beschreibt; und die PCT-Anmeldung mit der Veröffentlichungsnummer 92/01715, welche MHC-Rezeptoren beschreibt.

Mehrere der vorstehenden Veröffentlichungen beschreiben nicht nur, wie man ein besonderes Rezeptorprotein (oder das für das Protein kodierende Gen) isolieren kann, sondern beschreiben auch Varianten des Rezeptors, die auf eine Art und Weise nützlich sein können, auf die es der natürliche oder native Rezeptor nicht ist. Beispielsweise beschreibt die PCT-Anmeldung mit der Veröffentlichungsnummer 91/16431 lösliche Versionen des gamma-Interferon-Rezeptors, während die PCT-Anmeldung mit der Veröffentlichungsnummer 92/01715 beschreibt, wie lösliche dimere Zelloberflächenproteine hergestellt werden können. Diese letztere Technologie beinhaltet die Expression des Rezeptors mit einem Signal für eine Lipidverbindung, sobald das Lipid an den Rezeptor gebunden ist, wird der Rezeptor in der Zellmembran verankert, wo die dimere Form des Rezeptors zusammengesetzt wird. Siehe auch U.S. Serial No. 947,339, eingereicht am 18. September 1992, welche beschreibt, wie HPAP-enthaltende Rezeptoren von der Zelloberfläche abgespalten werden können, und wie die verbleibenden Verankerungssequenzen als Erkennungssequenzen für Antikörper dienen können, welch für eine Immobilisierung des Rezeptors verwendet werden.

Die hinsichtlich der Klonierung und Expression von Rezeptoren erreichten Fortschritte wurden begleitet von Technologiefortschritten, betreffend Verfahren zum Screening eines Rezeptors auf Verbindungen, welche mit dem Rezeptor in einer gewünschten Art und Weise wechselwirken könnten. Ein derartiger Fortschritt betrifft die Erzeugung großer Anzahlen von Verbindungen oder potenziellen Liganden in einer Reihe von zufälligen (random) und halbzufälligen "Peptiddiversität"-Erzeugungssystemen. Diese Systeme umfassen das "Peptide-auf-Plasmiden"-System, beschrieben in der U.S. Patentanmeldung Serial No. 963,321, eingereicht am 15. Oktober 1992, die eine Continuation-In-Part-Anmeldung der U.S. Patentanmeldung Serial No. 778,233, eingereicht am 16. Oktober 1991, ist; das "Peptide-auf-Phage"-System, beschrieben in der U.S. Patentanmeldung Serial No. 718,577, eingereicht am 20. Juni 1991, die eine Continuation-In-Part-Anmeldung von U.S. Serial No. 541,108, eingereicht am 20. Juni 1990, ist; Cwirla et al., August 1990, Proc. Natl. Acad. Sci. USA 87: 6378-6382; Barrett et al., 1992, Analyt. Biochem. 204: 357-364; und den PCT-Anmeldungen mit den Veröffentlichungsnummern 91/18980 und 91/19818; die auf Phagen basierten Antikörperdisplaysysteme, beschrieben in der U.S. Patentanmeldung Serial No. 517,659, eingereicht am 11. Mai 1990, und in der PCT-Anmeldung mit der Veröffentlichungsnummer 91/17271; die auf Beads (Kügelchen) basierten Systeme zur Erzeugung und zum Screening von Nukleinsäureliganden, beschrieben in den PCT-Anmeldungen mit den Veröffentlichungsnummern 91/19813, 92/05258 und 92/14843, das auf Beads basierte System, beschrieben in der U.S. Patentanmeldung Serial No. 946,239, eingereicht am 16. September 1992, die eine Continuation-In-Part-Anmeldung von Serial No. 762,522, eingereicht am 18. September 1991, ist; und das "immobilisierte Polymersynthese in sehr großem Maßstab"-System, beschrieben in US Patent Nr. 5,143,854; den PCT-Anmeldungen mit den Veröffentlichungsnummern 90/15070 und 92/10092; der U.S. Patentanmeldung Serial No. 624,120, eingereicht am 6. Dezember 1990; Fodor et al., 15. Februar 1991, Science 251: 767-773; Dower and Fodor, 1991, Ann. Rep. Med. Chem. 26: 271-180; und der U.S. Patentanmeldung Serial No.805,727, eingereicht am 6. Dezember 1991.

Andere Entwicklungen stehen in Zusammenhang damit, wie der Rezeptor in derartigen Screeningverfahren verwendet wird. Ein wichtiger Fortschritt betrifft die Entwicklung von Reagenzien und Verfahren zur Immobilisierung eines oder mehrerer Rezeptoren in einer räumlich definierten Anordnung, wie in der PCT-Anmeldung mit der Veröffentlichungsnummer 91/07087 beschrieben. In einer Ausführungsform dieses Verfahrens wird ein Rezeptor an Avidin gebunden und danach auf einer Oberfläche immobilisiert, die Biotingruppen hat. Die Oberfläche wird jedoch zunächst mit in Käfigen eingeschlossenen Biotingruppen hergestellt, die Avidin nicht binden bis die Käfiggruppe entfernt wird, in dieser Ausführungsform mittels Bestrahlung. Sobald der avidinylierte Rezeptor an die Biotingruppen an der Oberfläche gebunden ist, kann die Oberfläche zum Screening auf Verbindungen gegen den Rezeptor verwendet werden.

Biotin ist ein Coenzym, welches kovalent an verschiedene Enzyme gebunden ist, die am Transfer von aktivierten Carboxylgruppen beteiligt sind. Wie das vorstehende Beispiel veranschaulicht, kann eine Biotinmarkierung von Molekülen, die normalerweise nicht biotinyliert sind, zur Markierung, dem Nachweis, der Reinigung und/oder Immobilisierung derartiger Moleküle verwendet werden. Diese Verfahren beruhen auch auf den Proteinen Avidin und Streptavidin, die sehr stark und spezifisch an Biotin binden, und auf anderen Biotin-bindenden Molekülen, von denen manche mit einer unterschiedlichen Affinität wie Avidin an Biotin binden. Typischerweise werden die in derartigen Verfahren verwendeten biotinylierten Moleküle mittels eines in vitro Biotinylierungsverfahrens hergestellt. Ein in vivo Verfahren zur Biotinylierung von Proteinen, die mittels rekombinanter DNA-Techniken hergestellt werden, würde die Erfordernis beseitigen, diese Proteine nach der Reinigung chemisch zu biotinylieren, und würde das Reinigungsverfahren in hohem Maße vereinfachen, aufgrund der Möglichkeit das Biotin als einen Affinitätsmarker zu verwenden (siehe Green, 1975, Adv. Protein Res. 29: 85-133).

In vivo wird Biotin an Proteine hinzugefügt durch die Bildung einer Amidbindung zwischen der Biotin-Carboxylgruppe und der epsilon-Aminogruppe von spezifischen Lysinresten in einer Reaktion, die ATP benötigt. In normalen E. coli ist nur ein Protein biotinyliert, die Biotincarboxylcarrierprotein (BCCP) -Untereinheit von Acetyl-CoA-Carboxylase. Diese Reaktion wird katalysiert durch die Biotin-Proteinligase (BirA), das Produkt des birA-Gens (siehe Cronan, 1989, Cell 58: 427-429, durch Bezugnahme hierin aufgenommen).

Murtif et al. beschreiben die rekombinante Expression einer 1,3 S Biotinenthaltenden Untereinheit mit einer Länge von 123 Aminosäuren, wie sie in der Natur vorkommt. Sie offenbaren auch die nachfolgende Biotinylierung der Untereinheit unter Verwendung von Biotinholoenzymsynthetase aus E. coli und stellen fest, dass Biotinholoenzymsynthetasen für die Hinzufügung von Biotin zu allen Biotinenzymen verantwortlich sind. Sie erwähnen auch, dass in bekannten Fällen das Biocytin(Bct) innerhalb der Aminosäuresequenz Ala-Met-Bct-Met lokalisiert ist, und in einem Abstand von 35 Aminosäuren vom COOH-Terminus des Polypeptids. Sie stellen jedoch klar, dass es unbekannt ist ob diese Merkmale der Primärsequenz an der Erkennung durch die Synthetase beteiligt sind, oder ob sie einen allgemeinen Wirkungsmechanismus von Biotinenzymen widerspiegeln (Proc. Natl. Acad. Sci. USA, Vol. 82, Seiten 5617-5621, September 1985, Vicki L. Murtif, Chris R. Bahler and David Samols).

Andere haben ein Mittel vorgeschlagen, durch das eine Markierung mit Biotin in vivo bewirkt werden kann, durch die Hinzufügung einer Domäne von mindestens 75 Aminosäuren zu rekombinanten Proteinen (siehe Cronan, 1990, J. Biol. Chem. 265: 10327-10333). Siehe auch Cress et al., 1993, Promega Notes 42: 2-7. Die Hinzufügung dieser 75 Aminosäure-Domäne zu mehreren unterschiedlichen Proteinen führt zu der Biotinylierung der Fusionsproteine durch BirA an einem spezifischen Lysin der hinzugefügten Domäne. Die Hinzufügung kleiner Fragmente der Domäne mit 75 Resten führt nicht zu einer Biotinylierung, was nahe legt, dass eine ziemlich komplexe Erkennungsdomäne erforderlich ist. Veränderungen in der Sequenz von biotinylierten Proteinen bis hin zu 33 Resten weg von dem modifizierten Lysin stoppen die Biotinylierung (siehe Murtif and Samols, 1987, J. Biol. Chem. 262: 11813-11816). Veränderungen in der Nähe des Lysins beeinträchtigen ebenfalls die Biotinylierung (siehe Shenoy et al., FASEB J. 2: 2505-2511, und Shenoy et al., 1992, J. Biol. Chem. 267: 18407-18412). Unglücklicherweise kann jedoch die Hinzufügung einer derart großen Proteindomäne die biochemischen Eigenschaften eines biotinylierten Proteins negativ beeinflussen. Kleinere Domänen, welche eine Biotinylierung spezifizieren, wären sehr günstig, da derartige Domänen eine minimale Strukturwirkung auf eine große Vielzahl von möglichen Fusionspartnern hätten. Die Domäne mit 75 Resten führt auch nicht zu einer vollständigen Biotinylierung der Domäne, und verbesserte Domänen könnten effizienter sein. Die vorliegende Erfindung stellt derartige verbesserte Biotinylierungsdomänen bereit.

ZUSAMMENFASSUNG DER ERFINDUNG

Die vorliegende Erfindung stellt nützliche Verbindungen, Reagenzien, Verfahren und Kits für die Biotinylierung von Proteinen bereit. Gemäß einem ersten Aspekt stellt die vorliegende Erfindung ein Verfahren zum Biotinylieren eines Proteins bereit, wobei das Verfahren umfasst: (a) Konstruieren eines rekombinanten DNA-Expressionsvektors, der für ein Fusionsprotein kodiert, welches das Protein und ein Biotinylierungspeptid mit einer Länge von weniger als 50 Aminosäuren umfasst, (b) Transformieren einer rekombinanten Wirtszelle, welche ein Biotinylierungsenzym synthetisieren kann, mit dem Vektor, und (c) Kultivieren der Wirtszelle unter Bedingungen, bei denen Biotin vorhanden ist, und so, dass das Fusionsprotein und das Biotinylierungsenzym exprimiert werden, was zu der Biotinylierung des Fusionsproteins führt. Wenn die Wirtszelle nicht natürlicherweise Biotin produziert, kann man Biotin zu dem Medium zugeben. In einer bevorzugten Ausführungsform ist die Wirtszelle E. coli, und ist das Biotinylierungsenzym BirA.

In einer bevorzugten Ausführungsform kann somit ein Biotinylierungspeptid der vorliegenden Erfindung zu einem beliebigen in E. coli expimierten Protein hinzugefügt werden, mit einer ausreichenden Verweilzeit im Cytoplasma um zu ermöglichen, dass BirA wirkt. Wenn hohe Expressionsniveaus an biotinyliertem Protein gewünscht sind, kann man das BirA-Protein auf einfache Weise gleichzeitig überexprimieren (siehe Buoncristiani et al., 1988, J. Biol. Chem. 263: 1013-1016). In ähnlicher Weise können Wirtszellen, denen eine endogene Biotin-Proteinligase (als ein Biotinylierungsenzym bezeichnet) fehlt, mit einem Vektor transformiert werden, der für Expression des birA-Gens kodiert, um sie mit der Fähigkeit zu versehen, rekombinante Proteine zu biotinylieren, bzw. ihre Fähigkeit zu verstärken. In Fällen, bei denen die endogene Biotin-Proteinligase von anderen, von E. coli verschiedenen Zelltypen aufgrund der Konservierung der Erkennungsdomänen die neuen Biotinylierungssequenzen erkennen, ist keine derartige rekombinante Expression eines Biotinylierungsenzyms erforderlich. Man kann die Biotinylierungsreaktion auch in vitro durchführen, unter Verwendung eines Biotinylierungsenzyms wie etwa gereinigter BirA (siehe Buoncristiani, a.a.O.), Biotin, und Biotinylierungssequenzpeptid-markierten Proteinen, wobei die Proteine entweder in rekombinanten Wirtszellen oder durch in vitro Translation produziert werden können. Man kann auch Biotinanaloga verwenden, wie etwa 2-Iminobiotin, das eine niedrigere Affinität für Avidin hat als Biotin, und so in manchen Anwendungen anstelle von Biotin in dem Verfahren bevorzugt sein kann.

Die vorliegende Erfindung stellt auch Reagenzien bereit, welche in dem erfindungsgemäßen Verfahren nützlich sind, umfassend Peptide, Proteine, Oligonukleotide und rekombinante DNA-Expressionsvektoren. Somit stellt die vorliegende Erfindung biotinylierte Peptide mit einer Länge von weniger als 50 Aminosäuren, typischerweise einer Länge von 10 bis 20 oder mehr Aminosäuren bereit, und Oligonukleotide, die kodierende Sequenzen für derartige Peptide umfassen. Zusätzlich stellt die Erfindung rekombinante biotinylierte Proteine bereit, und Expressionsvektoren, welche für diese Proteine kodieren. In einer bevorzugten Ausführungsform ist das erfindungsgemäße Biotinylierungspeptid 13 Aminosäuren lang, und ist definiert durch LX1X2IX3X4X5X6KX7X8X9X10 (SEQ. ID NO:1), worin X1 eine beliebige Aminosäure ist, X2 eine von großen hydrophoben Aminosäuren (wie etwa L, V, I, W, F, Y) verschiedene Aminosäure ist, X3 gleich F oder L ist, X4 gleich E oder D ist, X5 gleich A, G, S oder T ist, X6 gleich Q oder M ist, X7 gleich I, M oder V ist, X8 gleich E, L, V, Y oder I ist, X9 gleich W, Y, V, F, L oder I ist, und X10 bevorzugt gleich R oder N ist, aber eine beliebige Aminosäure sein kann, außer eine saure Aminosäure wie etwa D oder E.

Zusammenfassend stellt diese Erfindung ein einfaches und effizientes Mittel bereit um rekombinante Proteine zu biotinylieren, wobei sie eien rasche Reinigung, Immobilisierung, Markierung und einen raschen Nachweis dieser Proteine bereitstellt. Das Verfahren ist nützlich für eine Reihe von Zwecken und ist in breitem Umfang kommerziell nützlich für Anwendungen in Forschung und Diagnose.

BESCHREIBUNG DER BEVORZUGTEN AUSFÜHRUNGSFORM I. Definitionen

Zum Verständnis der vorliegenden Erfindung werden die nachfolgenden Begriffe definiert.

Aminosäurereste in Peptiden werden abgekürzt wie folgt: Phenylalanin ist Phe oder F, Leucin ist Leu oder L, Isoleucin ist Ile oder I, Methionin ist Met oder M, Valin ist Val oder V, Serin ist Ser oder S, Prolin ist Pro oder P, Threonin ist Thr oder T, Alanin ist Ala oder A, Tyrosin ist Tyr oder Y, Histidin ist His oder H, Glutamin ist Gln oder Q, Asparagin ist Asn oder N, Lysin ist Lys oder K, Asparaginsäure ist Asp oder D, Glutaminsäure ist Glu oder E, Cystein ist Cys oder C, Tryptophan ist Trp oder W, Arginin ist Arg oder R, und Glycin ist Gly oder G.

Der Begriff "Antikörper" bezeichnet Antikörper und Antikörperfragmente, welche die Fähigkeit beibehalten, an das Epitop zu binden, an welches der intakte Antikörper bindet, unabhängig davon, ob der Antikörper oder das Fragment durch Hybridomzelllinien, durch Immunisierung um eine polyklonale Antikörperreaktion hervorzurufen, oder durch rekombinante Wirtszellen produziert wird, die mit einem rekombinanten DNA-Expressionsvektor transformiert worden sind, welcher für den Antikörper oder das Antikörperfragment kodiert.

Der Begriff "Antigen" ist definiert als ein Molekül, welches die Bildung eines Antikörpers induziert oder spezifisch an die Antigenbindungsstelle eines Antikörpers binden kann.

Der Begriff "wirksame Menge" bezeichnet eine Menge, welche ausreichend ist um ein gewünschtes Ergebnis zu induzieren.

Der Begriff "Epitop" bezeichnet denjenigen Teil eines Antigens, der mit einem Antikörper wechselwirkt.

Der Begriff "Wirtszelle" bezeichnet eine eukaryontische oder prokaryontische Zelle oder Gruppe von Zellen, die mit einem rekombinanten DNA-Vektor transformiert werden kann oder worden ist. Für Zwecke der vorliegenden Erfindung sind prokaryontische Wirtszellen bevorzugt.

Der Begriff "Ligand" bezeichnet ein Molekül, das von einem besonderen Rezeptor erkannt wird. Das von dem Rezeptor gebundene oder mit ihm reagierende Mittel wird als "Ligand" bezeichnet, ein Begriff, der von der Definition primär auf sein Rezeptorgegenstück bedeutsam ist. Der Begriff "Ligand" impliziert keine besondere Molekülgröße oder ein anderes Struktur- oder Zusammensetzungsmerkmal, sondern dass die fragliche Substanz an den Rezeptor binden oder anderweitig mit ihm wechselwirken kann. Ein Ligand kann entweder als der natürliche Ligand dienen, an den der Rezeptor bindet, oder als ein funktionelles Analogon, welches als ein Agonist oder Antagonist wirken kann. Beispiele von Liganden, welche mit der vorliegenden Erfindung untersucht werden können, umfassen, sind aber nicht beschränkt auf Peptide und Proteine wie etwa Agonisten und Antagonisten von Zellmembranrezeptoren, Toxine und Gifte, Epitope wie etwa virale Epitope, Antikörper, Hormone, Enzymsubstrate und Proteine.

Der Begriff "Linker" oder "Abstandhalter" bezeichnet ein Molekül oder eine Gruppe von Molekülen (wie etwa ein Monomer oder Polymer), das zwei Moleküle miteinander verbindet und oftmals dazu dient, die zwei Moleküle räumlich in eine bevorzugte Konfiguration zu bringen, z.B. so dass ein Ligand mit minimaler sterischer Hinderung an einen Rezeptor binden kann.

Der Begriff "Monomer" bezeichnet jedes Element des Satzes von Molekülen, die miteinander verknüpft werden können um ein Oligomer oder Polymer zu bilden. Der Satz an Monomeren, welcher in der vorliegenden Erfindung geeignet ist, umfasst, ist aber nicht darauf beschränkt, für das Beispiel der Peptidsynthese den Satz von L-Aminosäuren, D-Aminosäuren oder synthetischen Aminosäuren. Wie hierin verwendet bezeichnet "Monomer" jedes Element eines Basissatzes für die Synthese eines Oligomers. Beispielsweise bilden Dimere von L-Aminosäuren einen Basissatz von 400 "Monomeren" für die Synthese von Polypeptiden. In der Synthese eines Polymers können bei nacheinander folgenden Schritten unterschiedliche Basissätze von Monomeren verwendet werden. Der Begriff "Monomer" bezeichnet auch eine chemische Untereinheit, die mit einer anderen Untereinheit kombiniert werden kann um eine Verbindung zu bilden, welche größer ist als jede Untereinheit alleine.

Der Begriff "Oligomer" oder "Polymer" bezeichnet die Verbindungen, welche durch chemisches oder enzymatisches Aneinanderfügen von zwei oder mehr Monomeren gebildet werden. Derartige Monomere umfassen beispielsweise sowohl lineare als auch zyklische und verzweigte Polymere von Nukleinsäuren und Peptiden, wobei die Peptide sowohl alpha-, beta- als auch omega-Aminosäuren aufweisen können.

Der Begriff "Oligonukleotid" bezeichnet ein einzelsträngiges DNA- oder RNA-Molekül, oder Analoga von beiden. Geeignete Oligonukleotide können hergestellt werden durch das Phosphoramidit-Verfahren, beschrieben von Beaucage et al., 1981, Tetr. Lett. 22: 1859-1862, oder durch das Triester-Verfahren, gemäß Matteucci et al., 1981, J. Am. Chem. Soc. 103: 3185, oder durch andere Verfahren, wie etwa unter Verwendung kommerziell erhältlicher, automatisierter Oligonukleotidsynthesizer.

Der Begriff "operativ verknüpft" bezeichnet die Platzierung einer Nukleinsäure in eine funktionelle Beziehung mit einer anderen Nukleinsäure. Beispielsweise ist ein Promotor mit einer kodierenden Sequenz "operativ verknüpft", wenn der Promotor die Transkription der kodierenden Sequenz hervorruft. Im Allgemeinen bedeutet "operativ verknüpft", dass die miteinander zu verknüpfenden DNA-Sequenzen aneinander grenzen, und wo es notwendig ist zwei für Peptid oder Protein kodierende Regionen miteinander zu verbinden, miteinander im Leseraster.

Der Begriff "Peptid" bezeichnet ein Oligomer, bei dem die Monomere Aminosäuren (üblicherweise alpha-Aminosäuren) sind, durch Amidbindungen miteinander verbunden. Alternativ kann ein Peptid als ein "Polypeptid" bezeichnet werden. Peptide haben eine Länge von mehr als zwei Aminosäuremonomeren, aber gewöhnlich eine Länge von mehr als 5 bis 10 Aminosäuremonomeren, und können sogar eine Länge von mehr als 20 Aminosäuren aufweisen, obwohl Peptide mit einer Länge von mehr als 20 Aminosäuren eher als "Polypeptide" bezeichnet werden.

Der Begriff "Protein" ist in der Technik gut bekannt und bezeichnet üblicherweise ein sehr großes Polypeptid oder einen Satz von assoziierten Polypeptiden, der irgendeine biologische Funktion hat. Für Zwecke der vorliegenden Erfindung sind die Begriffe "Peptid", "Polypeptid" und "Protein" im Großen und Ganzen untereinander austauschbar, da Bibliotheken aller drei Typen unter Verwendung von im Wesentlichen ähnlicher Methodik hergestellt werden können.

Der Begriff "Randompeptid" bezeichnet ein Oligomer, das aus zwei oder mehr Aminosäuremonomeren zusammengesetzt ist und durch ein Mittel konstruiert wurde, mit dem man die spezifische Sequenz irgendeines besonderen Oligomers nicht vollständig vorab auswählt. Der Begriff "Randompeptidbibliothek" bezeichnet nicht nur einen Satz von rekombinanten DNA-Vektoren, der für einen Satz von Randompeptiden kodiert, sondern auch den Satz der von diesen Vektoren kodierten Randompeptiden sowie die Fusionsproteine, welche diese Randompeptide enthalten. Der Begriff "Proteinbibliothek" hat eine ähnliche Bedeutung wie "Randompeptidbibliothek", aber die verschiedenen Elemente der Bibliothek unterscheiden sich hinsichtlich der Aminosäuresequenz des interessierenden Proteins oder der dafür kodierenden Sequenz, so dass die Bibliothek als eine Sammlung verwandter, aber unterschiedlicher Versionen des gleichen Proteins dient.

Der Begriff "Rezeptor" bezeichnet ein Molekül, das eine Affinität für einen gegebenen Liganden hat. Rezeptoren können natürlich vorkommende oder synthetische Moleküle sein. Rezeptoren können verwendet werden in ihrem unveränderten natürlichen oder isolierten Zustand, in einer rekombinanten oder modifizierten Form, oder als Aggregate mit anderen Spezies. Beispiele von Rezeptoren, die im Verfahren der vorliegenden Erfindung verwendet werden können, umfassen, sind aber nicht beschränkt auf Antikörper, Zellmembranrezeptoren, monoklonale Antikörper, Antiseren, die mit spezifischen antigenen Determinanten (wie etwa auf Viren, Zellen oder anderem Material) reaktiv sind, Polynukleotide, Nukleinsäuren, Lektine, Polysaccharide, Zellen, Zellmembranen, Viren und Organellen. Rezeptoren werden in der Technik manchmal als "Antiliganden" bezeichnet. Wie der Begriff "Rezeptor" hierin verwendet wird, ist keine abweichende Bedeutung beabsichtigt. Ein "Ligand-Rezeptor-Paar" wird gebildet, wenn ein Rezeptor und Ligand durch molekulare Erkennung miteinander kombiniert haben, wobei ein Komplex gebildet wird.

Die Begriffe "rekombinanter DNA-Klonierungsvektor" und "rekombinanter DNA-Expressionsvektor" bezeichnen ein DNA- oder RNA-Molekül, das für eine nützliche Funktion kodiert und entweder verwendet werden kann um eine Wirtszelle zu transformieren oder in ein zellfreies Translationssystem eingebracht werden kann, um ein Protein zu produzieren, das von dem Vektor kodiert ist. Für Zwecke der vorliegenden Erfindung dient ein Klonierungsvektor typischerweise primär als ein Intermediat bei der Konstruktion eines Expressionsvektors; der letztere Vektor wird zur Transformation oder Transfektion einer Wirtszelle verwendet (oder wird in ein zellfreies Transkriptions- und Translationssystem eingebracht), so dass die transformierte Wirtszelle (oder das zellfreie Transkriptions- und Translationssystem) ein Protein oder ein anderes Produkt produziert, das von dem Vektor kodiert ist. Derartige Vektoren sind typischerweise "Plasmide", welche für Zwecke der vorliegenden Erfindung Vektoren sind, die in einer Wirtszelle extrachromosomal gehalten werden können, aber auch Vektoren sein können, die in das Genom einer Wirtszelle integrieren. Der Fachmann mag "Klonierungsvektoren", wie hierin definiert, als "Vektoren" bezeichnen, und "Expressionsvektoren", wie hierin definiert, als "Plasmide".

Der Begriff "fester Träger" bezeichnet ein Material mit einer steifen oder halbsteifen Oberfläche. Derartige Materialien nehmen bevorzugt die Gestalt von kleinen Beads, Pellets, Scheiben, Chips oder Wafern an, obwohl andere Formen verwendet werden können. In manchen Ausführungsformen wird mindestens eine Oberfläche des festen Trägers im Wesentlichen eben sein.

Der Begriff "Oberfläche" bezeichnet jede im Allgemeinen zweidimensionale Struktur auf einem festen Substrat und kann Stufen, Erhebungen, Knicke, Terrassen und dergleichen aufweisen, und bleibt dabei immer noch eine Oberfläche.

Der Begriff "synthetisch" bezeichnet eine Produktion durch in vitro chemische oder enzymatische Synthese.

II. Verfahren und Reagenzien der Erfindung

Das System zur Erzeugung und zum Screening von Randompeptiden, welches als das "Peptide-auf-Plasmiden"-System bekannt ist, wurde verwendet um die kleinen effizienten Peptidbiotinylierungssequenzen der vorliegenden Erfindung zu entdecken. Die Bibliothek war derart konstruiert, so dass sie Peptide der Form:

X10IVXAMKMX10 (SEC ID NO: 2) exprimiert, wobei X einen Randomrest darstellt, die anderen Buchstaben Ein-Buchstaben-Abkürzungen von Aminosäuren sind, und die Unterstreichung eine geringe Degeneriertheit im Kodon für die spezifizierten Aminosäuren anzeigt, wie nachstehend beschrieben. Diese Sequenz wurde auf Basis der bekannten Sequenzen von mehreren biotinylierten Proteinen (siehe Samols et al., J. Biol. Chem. 263: 6461-6464, durch Bezugnahme hierin aufgenommen), wie in Tabelle 1 gezeigt, ausgewählt. Wie durch die Punkte angedeutet, sind die nachstehenden Sequenzen nur Teile der großen Sequenzen, von denen vor der vorliegenden Erfindung angenommen wurde, dass sie für eine Biotinylierung erforderlich sind.

Tabelle 1

Der Lysinrest, der biotinyliert wird, ist in der Sequenz "AMKM" (SEC ID NO: 13) enthalten, welche den meisten Proteinen in Tabelle 1 gemeinsam ist, welche sind: die 1.3S Untereinheit der Transcarboxylase aus Propionibacterium shermanü (TC 1.3S), die Oxaloacetatdecarboxylase aus Klebsiella (OADC), Acetyl-CoA-Carboxylase aus Huhn (cACC), die Acetyl-CoA-Carboxylase aus E. coli (EcBCCP), die Pyruvatcarboxylase aus Hefe (yPC), die Pyruvatcarboxylase aus Mensch (hPC), die Pyruvatcarboxylase aus Schaf (sPC), die Pyruvatcarboxylase aus Ratte (aPC), die Propionyl-CoA-Carboxylase aus Mensch (hPCC), und das Biotinylpeptid aus Tomate (tbp). Die Sequenzen dieser Proteine haben mehrere konservierte Reste und/oder Regionen mit ähnlichen Eigenschaften (z.B. verzweigtkettige Aminosäuren oder amidierte Säuren) gemeinsam.

Trotz dieser Lehre, dass eine große Region für eine Biotinylierung erforderlich ist, wurde die Peptide-auf-Plasmiden-Bibliothek, welche verwendet wurde um die Biotinylierungspeptide der vorliegenden Erfindung zu entdecken, derart konstruiert, so dass sie Randompeptide mit einer Länge von nur 27 Aminosäuren darstellt, enthaltend nur einen festgesetzten Kodon (für K) und 5 konservierte Kodons (für die unterstrichenen vorstehenden Aminosäuren).

Konservierte Kodons wurden hergestellt, indem der Oligonukleotidsynthesizer derart programmiert wurde, dass er für jedes Nukleotid eines konservierten Kodons 91 des korrekten Nukleotids und 3% von jedem der drei anderen Nukleotide hinzufügte. Durch dieses Verfahren wurde eine sehr große Bibliothek von Randompeptiden hergestellt und zur Transformation von E. coli Wirtszellen verwendet. Die Peptide, welche von jedem Klon dieser Bibliotheken kodiert wurden, wurden mit dem Carboxyterminus des sequenzspezifischen DNA-Bindeproteins lac-Repressor (Lacl) fusioniert. Jeder Partikel der Bibliothek besteht aus einem Lacl-Peptid-Fusionsprotein, gebunden an die lac-Operatorstellen (lacO) auf dem gleichen Plasmid, das für es kodierte. Expression dieser Bibliotheken im Cytoplasma gestattet es den Zellen für Kompartmentalisierung zu sorgen, so dass jedes Fusionsprotein an das entsprechende Plasmid gebunden ist.

Da die Partikel der Peptide-auf-Plasmiden-Bibliothek im Cytoplasma vorliegen, ist das BirA-Enzym in E. coli Wirtszellen für die Randompeptidregion zugänglich. Alle Randompeptide, die produktiv mit BirA wechselwirken (vermutlich ein kleiner Teil der Gesamtheit), werden biotinyliert. Nach Zelllyse wurden die biotinylierten Bibliothekspartikel durch Bindung an immobilisiertes Streptavidin isoliert. Der Hintergrund an Peptidsequenzen, die ohne eine Biotinylierung an Streptavidin binden (siehe Devlin et al., 1990, Science 249: 404-406, durch Bezugnahme hierin aufgenommen) wurde eliminiert durch Zugabe von freiem Biotin-Kompetitor nachdem die Bibliothekspartikel an das immobilisierte Streptavidin binden lassen wurden. Die Affinität dieser Hintergrundpeptide für Streptavidin ist niedriger als die Affinität für Biotin, und auf diese Weise werden Hintergrundpeptide von dem freien Biotin verdrängt. Die gewünschten biotinylierten Peptide wurden durch Biotin nicht verdrängt, da die Peptide zuerst binden lassen wurden, eine Affinität ähnlich der von Biotin aufweisen, und multivalent mit dem immobilisierten Streptavidin wechselwirken.

Somit umfasste das Protokoll das Lysieren der transformierten Zellen, das Entfernen von zellulärem Material durch Zentrifugation, und das Sammeln des Rohlysats, aus dem Plasmide, welche für Biotinylierungspeptide kodieren, durch Affinitätsanreicherung an Streptavidin isoliert wurden, wie in den nachfolgenden Beispielen beschrieben. Dieses Verfahren wurde dreimal wiederholt, wobei mit den Plasmiden begonnen wurde, die am Ende des vorhergehenden Zyklus gesammelt worden waren, mit den in Tabelle 2 gezeigten Ergebnissen.

Tabelle 2

Diese Ergebnisse zeigten an, dass die Bibliothek Elemente enthielt, die Biotinylierungspeptide darstellten und daher angereichert und identifiziert werden konnten. Mehrere der Isolate aus der vierten Streptavidinbindungsrunde wurden getestet um zu bestimmen, ob die dargestellten Peptide eine Biotinylierung lenkten. Die Sequenzen der Randompeptide in den positiven Klonen sind in Tabelle 3 gezeigt, in Reihenfolge der Stärke ihrer Reaktion in einem ELISA geordnet. Die Sequenzen zeigen nicht nur Reste mit einer Tendenz, der durch die bekannten biotinylierten Proteine definierten Konsensussequenz näher zu kommen, sondern auch Reste, die sich von der bekannten Konsensussequenz unterscheiden. Die Peptide haben keine Sequenzmotive (wie etwa HPQ), welche mit einer schwachen Bindung an Streptavidin assoziiert wurden (Devlin et al., a.a.O.).

Tabelle 3

Die Sequenzen der biotinylierten Klone aus der ersten Bibliothek, gezeigt in Tabelle 3, sind an dem vermutlich modifizierten K-Rest ausgerichtet. Mehrere Klone waren in dem erhaltenen Satz von 20 Sequenzen mehr als einmal vorhanden, so dass nur 15 unabhängige Sequenzen gezeigt sind. An manchen Positionen in den Sequenzen ist ein klarer Konsensus nicht offensichtlich. An anderen Resten stellen sich jedoch klare Trends heraus. Beispielsweise war Position –4 (relativ zu dem K-Rest) entworfen worden um für V zu kodieren, in Übereinstimmung mit diesem Rest des Biotincarboxyl-Carrierproteins aus E. coli (ein Kodon GTT, synthetisiert mit jeder Base zu 97% wie angegeben, jeweils 3% von den anderen Basen). Trotz dieser sehr geringfügigen Mutagenese hatte jede Sequenz eine Mutation, welche die kodierte Aminosäure zu entweder L oder F änderte. L ist der Rest, der an dieser Position in den meisten der natürlich biotinylierten Sequenzen aus von E. coli verschiedenen Organismen gefunden wird, aber F war in den untersuchten Sequenzen nicht vorhanden. Der Rest –3, in der Bibliothek durch einen Randomkodon (NNK) kodiert, war in 9 der 15 Sequenzen negativ geladen (E oder D). Wiederum ist diese Konsensussequenz ähnlich zu der, welche in natürlich vorkommenden Sequenzen aufgefunden wird (E oder S). Die Position +3 definiert jedoch einen neuen Konsensus, der in den natürlichen Sequenzen nicht aufgefunden wird. 15 der 15 Peptide hatten einen hydrophoben Rest (W, Y, V, F oder L) an +3, anstelle des normalerweise aufgefundenen T aus den Enzymsequenzen.

Die vielleicht bemerkenswerteste Sequenz aus der ersten Bibliothek war SMWETLNAQKTVLL (SEQ ID NO: 24), welche aus der Deletion einer einzigen Base während der Synthese oder Klonierung des Bibliotheksoligonukleotids entstand. Diese Sequenz stimmt nur an drei Resten mit der Enzymkonsensussequenz überein, entspricht aber dem Muster der anderen Bibliotheksklone an den Positionen +2 und +3. Diese Ergebnisse zeigen, dass die evolutionären Zwänge auf die Enzymsequenz aus einer Kombination von Faktoren resultieren, von denen die Fähigkeit, biotinyliert zu werden, nur einer ist.

Um die Konsensussequenz für eine Biotinylierung klarer zu definieren, wurden drei zusätzliche Bibliotheken gescreent (siehe die Tabellen 4, 5 und 6, nachstehend). Zwei basierten auf dem Muster der aus der ersten Bibliothek isolierten Klone und die andere bestand einfach aus einem K-Rest, der an beiden Seiten von 10 Randomresten flankiert war. Nach vier Runden Panning wurde ein Restriktionsfragment, das die Randomregion enthielt, aus dem Pool von angereicherten Klonen in einen MBP (Maltose-bindendes Protein) Expressionsvektor (siehe U.S. Patentanmeldung Serial No. 876,288, eingereicht am 29. April 1992) subkloniert. Diese Populationen von Plasmiden wurden danach gescreent unter Verwendung einer Kolonie-Lifttechnik, umfassend einen Nachweis mit einem Streptavidin-alkalische Phosphatase-Konjugat. Die Biotinylierung von mehreren dieser Klone wurde mittels Markierung mit 3H-Biotin bestätigt.

Die zweite Bibliothek wurde mit einer für ein Randompeptid kodierenden Sequenz konstruiert, definiert durch XXXIFEAMKMXXXXX (SEQ ID NO: 29), wobei X ein NNK-Kodon ist, unterstrichene einzelne Reste Kodons für die gezeigte Aminosäure sind, aber mit einem 70/10/10/10 Mutagenesegemisch (70% der Base, welche an einer bestimmten Position im Kodon für die Aminosäure kodiert und jeweils 10% der drei anderen Basen), und der Kodon für K festgelegt ist. Die aus dieser Bibliothek isolierten und sequenzierten biotinylierten Sequenzen sind in Tabelle 4 gezeigt.

Tabelle 4

Die dritte Bibliothek wurde mit einer für ein Randompeptid kodierenden Sequenz konstruiert, definiert durch XXXXXXIFEAMKMXXXXX (SEQ ID NO: 49), wobei X ein NNK-Kodon ist, unterstrichene einzelne Reste Kodons für die gezeigte Aminosäure sind, aber mit einem 70/10/10/10 Mutagenesegemisch (70% der Base, welche an einer bestimmten Position im Kodon für die Aminosäure kodiert und jeweils 10% der drei anderen Basen), und der Kodon für K festgelegt ist. Die aus dieser Bibliothek isolierten und sequenzierten biotinylierten Sequenzen sind in Tabelle 5 gezeigt.

Tabelle 5

Die vierte Bibliothek wurde mit einer für ein Randompeptid kodierenden Sequenz konstruiert, definiert durch XXXXXXXXXXKXXXXXXXXXX (SEQ ID NO: 69), wobei X ein NNK-Kodon ist und der Kodon für K festgelegt ist. Die aus dieser Bibliothek isolierten und sequenzierten biotinylierten Sequenzen sind in Tabelle 6 gezeigt.

Tabelle 6

Die Biotinylierungspeptide aus diesen Bibliotheken dienen dazu, die neue Konsensussequenz für die Biotinylierungspeptide der vorliegenden Erfindung weiter zu definieren. Mehrere Merkmale sind bemerkenswert. Eine starke Präferenz für L an Position –8 ist klar, insbesondere in der zweiten Bibliothek, die eine kürzere Randomsequenzregion links des modifizierten K hatte als alle anderen Bibliotheken. Die anderen Sätze an Sequenzen haben diese Präferenz an –8 gemeinsam, aber zu einem geringeren Ausmaß als die zweite Bibliothek. Das L an dieser Position kann wichtiger sein, wenn weniger Aminosäuren vorhanden sind, welche die Biotinylierungsdomäne an das Carrierprotein verbinden. In den natürlich vorkommenden Sequenzen gibt es an dieser Position keinen Konsensus.

An anderen Positionen werden viele Reste aufgefunden und es ist nur ein allgemeiner Trend offensichtlich. Beispielsweise werden an Position –6 viele Reste aufgefunden, aber keine großen hydrophoben Reste (L, V, I, W, F oder Y), eine Tendenz, die sich von derjenigen der natürlich vorkommenden Enzyme unterscheidet (L ist am häufigsten). Die Position +4 enthält ein breites Spektrum an Resten, aber mit einer klaren Präferenz für basische Aminosäuren (18 von 56 sind R, H oder K) gegenüber sauren Resten (kein D oder E).

An Position –2 ist eine Präferenz für eine kleine Größe klar, da nur A, G, S oder T aufgefunden werden. Position –1 zeigte eine Tendenz zu M in allen Bibliotheken außer der vierten Bibliothek. In den Bibliotheken mit dieser Tendenz wird M am häufigsten aufgefunden, aber Q ist häufig vorhanden. Bemerkenswerterweise erfordert die Mutation von einem M-Kodon (ATG) zu einem Q-Kodon (CAA/G) zwei Basenaustausche. In den Klonen, die diese Tendenz an dieser Position nicht zeigten, haben 4 von 4 Klonen Q, was darauf hindeutet, dass Q in der Tat der bevorzugte Rest sein könnte. Die hydrophoben Reste M, I und V werden in nahezu allen Sequenzen an Position +1 aufgefunden. Position +2 ist oftmals der natürliche Konsensus E, tendiert jedoch auch dazu, die hydrophoben Reste L, V, Y und I zu enthalten.

Um die allgemeine Nützlichkeit der Biotinylierungssequenzen zu untersuchen und ihre möglichen Anwendungen zu erweitern wurde eine Bibliothek derart hergestellt, so dass die Biotinylierungspeptide in einem Fusionsprotein am N-Terminus von cytoplasmatischem MBP exprimiert werden würden. Diese Bibliothek hatte eine ausgesprochene Tendenz zugunsten von Sequenzen, welche mit der Konsensussequenz der Erfindung passen, mit einem Randompeptid, definiert durch MAXXLXXI(F/L)(E/D)AQK(M/I)EW(H/R)XXXGGS (SEQ ID NO: 73), worin die unterstrichenen Reste festgelegt sind, die unterstrichenen Reste 97/1/1/1 mutagenisierte Kodons für die gezeigten Reste sind, und X ein NNK-Kodon ist. Die Sequenzen von positiven Klonen aus dieser Bibliothek, durch Lifting von Kolonien identifiziert, sind in Tabelle 7 gezeigt.

Tabelle 7
Q*
= supE supprimierter Amber-Kodon

Die Biotinylierung von mehreren dieser Klone wurde mittels Markierung mit 3H-Biotin bestätigt. Die Fähigkeit, funktionelle Biotinylierungssequenzen frei an jedem Ende eines Proteins zu exprimieren deutet darauf hin, dass es nicht erforderlich ist, dass ein bestimmtes Ende des Peptids frei ist um mit der Biotinholoenzymsynthetase wechselzuwirken.

Wie vorstehend diskutiert, können die kurzen Biotinylierungspeptide der Erfindung in vivo oder in vitro biotinyliert werden, und sie können für ein breites Spektrum von Anwendungen verwendet werden, umfassend Reinigung, Immobilisierung, Markierung und Nachweis von Proteinen. Ein paar veranschaulichende Beispiele umfassen: (1) die Markierung von Rezeptoren mit Biotin an einer definierten Stelle, so dass der markierte Rezeptor beispielsweise an Streptavidin gebunden werden könnte, um einen tetravalenten Rezeptor zu erzeugen um die Sensitivität von Bindeassays zu erhöhen, wie etwa die in US Patent Nr. 5,143,854 und U.S. Patentanmeldung Serial No. 946,239, eingereicht am 16. September 1992, beschriebenen; (2) die Markierung von Fusionsproteinen, die Peptid-Leads aus irgendeinem Screeningprogramm enthalten, so dass die markierten Fusionsproteine verwendet werden können um auf eine Bindung des Peptids an Rezeptoren in einem monovalenten Format (durch Sondieren mit markiertem Streptavidin, nachdem die Bindung stattgefunden hat) oder in einem multivalenten Format (durch zuvoriges Binden der Fusionen an markiertes Streptavidin und nachfolgendes Testen der Bindung an Rezeptoren) zu testen, oder so, dass Peptide auf Streptavidinbeschichteten Beads oder in Vertiefungen von Mikrotiterplatten immobilisiert werden, zum Sondieren mit Rezeptoren, wie etwa Protease-Enzymen, in Lösung; (3) die Markierung von Peptiden oder Proteinen direkt durch Anziehen von Zellen in der Gegenwart von Tritium-markiertem Biotin -- mit einem Biotinauxotroph, die Peptide könnten bei einer bekannten spezifischen Aktivität markiert werden um quantitative Messungen von Bindeaktivität zu ermöglichen; und (4) die Entwicklung von Technologie zur Durchführung von enzymatischen Reaktionen auf Oberflächen, durch Behandeln von Bibliotheken von varianten immobilisierten Sequenzen mit BirA, Biotin und ATP, so dass diejenigen Peptide, die Substrate waren, biotinyliert werden würden und mit markiertem Streptavidin nachgewiesen werden könnten.

Diese Erfindung umfasst auch Kits, welche zur Produktion von Proteinen, die Biotinylierungspeptide enthalten, nützlich sind. Derartige Kits umfassen beispielsweise ein rekombinantes Expressionspolynukleotid, welches verwendet werden kann um die erfindungsgemäßen Peptide fusioniert an eine kodierende Sequenz nach Wahl zu produzieren, und Anleitungen hinsichtlich der Verwendung der Polynukleotide. DNA-Expressionspolynukleotide können derart ausgelegt sein, so dass sie episornal replizieren oder in das Chromosom der für die Expression ausgewählten Wirtszelle integrieren. Die DNA-Polynukleotide des Kits enthalten häufig eine Mehrfachklonierungsstelle, welche mit der für die erfindungsgemäßen Peptide kodierenden Sequenz verbunden ist, so dass eine beliebige kodierende Sequenz im korrekten Translationsleseraster für eine Expression insertiert werden kann. Diese Kits können verwendet werden um die erfindungsgemäßen Peptide fusioniert an der Aminoterminus, den Carboxyterminus oder innerhalb der ausgewählten kodierenden Sequenz zu produzieren. Innerhalb dieser Fusionsproteine können die erfindungsgemäßen Peptide durch zusätzliche Abstandhaltersequenzen von den kodierenden Sequenzen getrennt sein.

Eine Expression von kodierenden Sequenzen erfolgt bevorzugt unter Kontrolle eines induzierbaren Promotors, wovon ein paar Beispiele der lac- oder tac-Promotor in E. coli, der gal4-Promotor in S. cerevisiae, der glaA-Promotor in Aspergillus niger oder der Metallothioneinpromotor aus Maus in vielen Säugerzellen sind. Alternativ können für bestimmte Anwendungen konstitutive Promotoren erwünscht sein, wie etwa der SV40 early Promotor in Säugerzellen. Für manche Anwendungen, wie etwa in vitro Translation in Kaninchen-Retikulozyten, wird es erforderlich sein, RNA in vitro unter Verwendung einer RNA-Polymerase, wie etwa der aus dem Bakteriophagen SP6, synthetisieren zu können. In diesem Fall können Signale für die Initiation der Transkription sowohl von SP6-RNA-Polymerase als auch einer alternativen RNA-Polymerase operativ mit der gleichen Expressionssequenz verknüpft sein.

Neben einem Promotor für die Initiation der Expressionssequenzen werden die Polynukleotide des Kits bevorzugt auch Sequenzen für die Termination der Transkription enthalten, wie etwa den T7-Terminator in E. coli oder den SV40-Terminator in Säugerzellen. Wenn die Proteine in Säugerzellen exprimiert werden, ist zusätzlich ein Polyadenylierungssignal wünschenswert, wie etwa die SV40-Polyadenylierungssequenz.

Natürlich können auch zusätzliche Sequenzen in den Polynukleotiden dieser Kits eingebaut sein, welche den produzierten Proteinen zusätzliche Eigenschaften vermitteln. Beispielsweise kann eine Signalsequenz, welche verursacht, dass die exprimierten Proteine aus der Zelle sezerniert werden, in die Polynukleotide eingebaut sein. Sequenzen, welche dazu dienen, exprimierte Proteine an die Membran zu binden, wie etwa eine für eine hydrophobe membranüberspannende Domäne kodierende Sequenz oder eine kodierte Sequenz, welche eine Bindung eines Glycosyl-Phosphatidylinositol-Membranankers an das Protein signalisiert, können als ein Bestandteil des Expressionspolynukleotids eingebaut sein. Die Polynukleotide können auch für eine Sequenz kodieren, welche von einer Protease wie etwa Faktor Xa erkannt wird, benachbart zu der für die erfindungsgemäßen Biotinylierungspeptide kodierenden Sequenz. Ein Fachmann wird erkennen, dass diese und viele andere Kombinationen zusätzlicher Sequenzen vorteilhaft sein können.

Andere Bestandteile der Kits können Wirtszellen umfassen, welche geeignet sind um Expression von dem Polynukleotid zu erhalten, Avidin oder Streptavidin, gekoppelt an einen festen Träger, Avidin oder Streptavidin, gekoppelt an einen nachweisbaren Marker wie etwa das Enzym Meerrettich-Peroxidase, ein Biotinylierungsenzym wie etwa gereinigte BirA, und Anleitungen für die Analyse und Reinigung der unter Verwendung dieser Kits exprimierten Proteine. Die Wirtszellen exprimieren bevorzugt ein Biotinylierungsenzym. Gegebenenfalls können Polynukleotide, die nach Transformation in Wirtszellen eine Überproduktion der Biotinylierungsenzyme hervorrufen, in den Kits bereitgestellt sein, oder die in den Kits bereitgestellten Wirtszellen können bereits modifiziert sein, so dass sie Biotinylierungsenzyme überproduzieren. Für manche Anwendungen kann es jedoch die Abwesenheit von Biotinylierungsenzym in der Wirtszelle vorteilhaft sein. Beispielsweise kann der Anwender des Kits bevorzugen, die exprimierten Fusionsproteine in vitro zu biotinylieren.

Der Fachmann erkennt aus der vorstehenden Beschreibung, dass die vorliegende Erfindung viele Vorteile und mehr Anwendungen bereitstellt als Verfahren aus dem bekannten Stand der Technik zur Biotinylierung von Proteinen. Die erfindungsgemäßen Biotinylierungspeptide sind klein aber spezifisch, ermöglichen es, ein Protein an einer definierten Stelle zu markieren, an jedem Ende des zu markierenden Proteins oder innerhalb davon. Die Erfindung stellt ein verbessertes Immobilisierungsverfahren bereit, welches es ermöglicht, die Verwendung von Antikörpern und die damit verbundenen Probleme zu vermeiden. Die hohe Bindeaffinität der Avidin-Biotin-Wechselwirkung stellt Vorteile bereit für die Markierung, Lokalisierung, den Nachweis, die Immobilisierung, und auch für Reinigungsverfahren. Beispielsweise könnte man die Biotinylierungspeptide der Erfindung zur Reinigung von BirA oder anderen Biotinylierungsenzymen verwenden.

Die erfindungsgemäßen Peptide können als das Substrat in einem Assay zum Screening auf die Gegenwart von neuen Biotinylierungsenzymen dienen. Die Biotinylierungsreaktion kann in vivo stattfinden (wo nur wenige andere Proteine natürlicherweise biotinyliert werden) oder in vitro, mit leicht zugänglichen Materialien. Wie aus der vorstehenden Offenbarung erkannt werden kann, hat die vorliegende Erfindung ein breites Spektrum an Anwendungen. Demgemäß werden die nachfolgenden Beispiele lediglich zur Veranschaulichung angegeben, und nicht als eine Einschränkung.

Beispiel 1 Konstruktion einer Bibliothek

Die Peptide-auf-Plasmiden-Bibliotheken wurden im Vektor pJS142 hergestellt, einem Derivat von Plasmid pMC5, beschrieben in der U.S. Patentanmeldung Serial No. 963,321, eingereicht am 15. Oktober 1992. Dieser Vektor ist derart ausgelegt, so dass die Randomregion einer Bibliothek mit lacl verbunden ist, durch einen Abstandhalter, welcher für die Sequenz VVHGEQVGGEASGGG (SEQ ID NO: 90) kodiert. Die erste Bibliothek wurde hergestellt durch Annealing der phosphorylierten Oligonukleotide ON-1396 (GAGGTGGTNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKatcgttNNKgctatgAAAat gNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKTAACTAAGTAAAGC (SEC ID NO: 91), worin kleine Buchstaben Basen darstellen, die mit Gemischen von 91% der Base und 3% jeder der anderen Basen synthetisiert wurden, bezeichnet als eine "91/3/3/3 Mutagenese", N ein äquimolares Gemisch aller 4 Basen bedeutet und K ein äquimolares Gemisch von G und T bedeutet), ON-829 (ACCACCTCCGG) (SEC ID NO: 92), und ON-830 (TTACTTAGTTA) (SEC) ID NO: 93), jeweils in einer Konzentration von 1 &mgr;M in 0,1 M NaCl, 50 mM Tris pH 7,4, indem während 10 min auf 70°C erwärmt wurde und die Reaktion über mehrere Stunden auf unter 15°C abkühlen gelassen wurde. Die annealten Oligonukleotide (5,2 pMol) wurden an 10 &mgr;g (2,6 pMol) Sfil-verdauten pJS142 ligiert, in 0,5 ml 20 mM Tris pH 7,4, 10 mM MgCl2, 0,1 mM EDTA, 1 mM ATP, 50 &mgr;g/ml BSA, 2 mM DTT, enthaltend 800 Kohäsivende-Einheiten an T4 DNA-Ligase (New England Biolabs), über Nacht bei 14°C. Die Ligierungen wurden danach 10 min auf 65°C erwärmt. Die einzelsträngige Lücke wurde aufgefüllt durch Zugabe von 26 Einheiten SequenaseTM 2.0 (United States Biochemical) in der Gegenwart von 0,2 mM dNTP. Die DNA wurde mit Phenol/CHCl3 extrahiert, mit Isopropanol präzipitiert, und zur Transformation von ARI 280 (lon-11 sulA1 hsdR17 &Dgr;(ompT-fepC) &Dgr;clpA319::kan &Dgr;lacl lacZU118 recA::cat) verwendet, wobei eine Bibliothek von 5 × 108 unabhängigen Transformanten erhalten wurde, welche amplifiziert und aufbewahrt wurde, wie in der U.S. Patentanmeldung Serial No. 963,321, eingereicht am 15 Oktober 1992, und in Cull et al., 1992, Proc. Natl. Acad. Sci. USA 89: 1865-1869 beschrieben, außer dass die Zellen in 35 mM HEPES pH 7,5, 0,1 mM EDTA, 50 mM KCl (HEK Puffer) aufbewahrt wurden.

Die zweite (5 × 109 Transformanten), dritte (5 × 109 Transformanten), und vierte (2,2 × 109 Transformanten) Bibliothek wurden konstruiert wie vorstehend beschrieben, unter Verwendung von ON-1544 (GAGGTGGTNNKNNKNNKatctttgaagctatgAAAatg NNKNNKNNKNNKNNKTAACTAAGTAAAGC (SEQ ID NO: 94), worin kleine Buchstaben eine 70/10/10/10 Mutagenese darstellen), ON-1545 (GAGGTGGTNNKNNKNNKNNKNNKNNKatctttgaagctatgAAAatgNNKNNKNNKNNK NNKTAACTAAGTAAAGC (SEQ ID NO: 95), worin kleine Buchstaben eine 70/10/10/10 Mutagenese darstellen), bzw. ON-828 (GAGGTGGTNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKAAANNKNNKNNKNNK NNKNNKNNKNNKNNKNNKTAACTAAGTAAAGC) (SEQ ID NO: 96), anstelle von ON-1396. Die vierte Bibliothek wurde mit 30 &mgr;g des Vektors pJS141 hergestellt, der sich von pJS142 nur dadurch unterscheidet, dass die kodierende Sequenz von lacl derart verändert ist, so dass sie für S, A bzw. S kodiert anstelle der C-Kodons, welche normalerweise an den Positionen 107, 140 und 182 aufgefunden werden. Die Bibliothek wurde amplifiziert durch Transformation des Stammes ARI 246 (lon-11 sulA1 hsdR17 &Dgr;(ompT-fepC) &Dgr;clpA319::kan lacl42::Tn10 lacZU118).

Die fünfte Bibliothek wurde im Vektor pBAD/MBP-N konstruiert, einem Derivat von pBAD18, siehe U.S. Patenanmeldung Serial No. 965,677, eingereicht am 22. Oktober 1992, der einen Polylinker und die kodierende Sequenz für die Aminosäuren 27-393 von MBP stromabwärts des Arabinose-induzierbaren araB-Promotors platziert. Diese Bibliothek wurde hergestellt durch Ligierung von annealten ON-1699 (CTAGCTAACTAATGGAGGATACATAAATGgctNNKNNKctgNNKNVKattttNgaNgctc arAAAatNgaatggcryNNKNNKNNKGGTGGTAGCC (SEQ ID NO: 97), worin kleine Buchstaben eine 97/1/1/1 Mutagenese darstellen; V = A, C oder G; r = g oder a; y = c, t), ON-1700 (TCCTCCATTAGTTAG)(SEQ ID NO: 98), und ON-1701 (TCGAGGCTACCACC)(SEQ ID NO: 99) an Nhel-Xhol-verdauten pBAD/MBP-N, wie vorstehend beschrieben. Die Bibliothek wurde zur Transformation von XL1-Blue (F' proAB laclq lacZ&Dgr;M15 Tn10(tetR)//recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 lac, Stratagene) verwendet und durch Kolonielifting wie nachstehend beschrieben gescreent.

Beispiel 2 Panning

Etwa 2 ml aufgetaute Zellen in HEK wurden zu 6 ml 25 mM HEPES pH 7,5, 0,07 mM EDTA, 8,3% Glyzerin, 1,25 mg/ml BSA, 0,83 mM DTT und 0,2 mM PMSF zugegeben. Die Zellen wurden 2 bis 4 min auf Eis lysiert durch die Zugabe von 0,15 ml 10 mg/ml Lysozym (Boehringer Mannheim), und danach wurden 2 ml 20% Lactose und 0,25 ml 2 M KCl zugegeben. Der Überstand aus einer 15-minütigen 27.000 × G Zentrifugation wurde zugegeben zu 0,1 ml Streptavidin-Agarose-Beads (Pierce) in 1 ml HEK, 0,2 M Lactose (HEKL), 4,5% BSA, 0,9 mg/ml Hering-DNA, und 1 Stunde bei 4°C sanft gemischt. Die Beads wurden zentrifugiert und viermal mit HEKL-Puffer, 1% BSA und 0,1 mg/ml Hering-DNA bei 4°C gewaschen (in späteren Runden enthielten diese Waschlösungen manchmal 10 &mgr;M Biotin), und danach 30 min bei 4°C im gleichen Puffer plus 10 &mgr;M Biotin inkubiert. Die Beads wurden fünfmal mit HEKL-Puffer, 1% BSA, zweimal mit HEKL-Puffer, und einmal oder zweimal mit HEK-Puffer gewaschen, bei 4°C. Die gebundenen Plasmide wurden 30 min bei Raumtemperatur mit 35 mM HEPES pH 7,5, 0,1 mM EDTA, 200 mM KCl, 1 mM IPTG, 10 &mgr;g/ml selbst-annealtem ON-413 (GAATTCAATTGTGAGCGCTCACAATTGAATTC)(SEQ ID NO: 100) eluiert, mit Isopropanol präzipitiert, und danach für eine Amplifikation zur Elektrotransformation von entweder ARI 280 oder ARI 298 (lon-11 sulA1 hsdR17 &Dgr;(ompT-fepC) &Dgr;clpA319::kan &Dgr;lacl lacZU118 recA::cat cytR) verwendet.

Beispiel 3 Subklonierung in MBP-Vektor

Aus dem Panning gewonnene Plasmide wurden mit BspEl und Scal verdaut, und ein Fragment, das die für Peptid kodierende Sequenz enthielt, wurde in mit Agel, Scal verdautes Plasmid pELM3, ein Derivat von pMALc2, subkloniert, das von New England Biolabs erhältlich ist, ausgelegt um kodierende Sequenzen aus pJS142 aufzunehmen. Das transferierte Fragment kodiert für GGG-Peptid und ist mit der für MBP kodierenden Region über eine für N10LGIEGRT kodierende Sequenz verbunden. Das MBP wird aufgrund des Fehlens einer Signalsequenz im Cytoplasma zurück gehalten.

Beispiel 4 Markierung mit 3H-Biotin

Zellen wurden über Nacht bei 37°C in Minimalmedium E (Davies, 1980, Advanced Bacterial Genetics (CSH Press)) mit 0,4% Glyzerin, 0,1% Vitamin-Assay-Casaminosäuren (Difco), 1 &mgr;g/ml Thiamin und 50 &mgr;g/ml Ampicillin angezogen. Die Kulturen wurden im gleichen Medium 1/10 verdünnt, mehrere Stunden angezogen, und danach zu einem gleichen Volumen Medium, enthaltend 2 &mgr;Ci/ml 3H-Biotin (Amersham) und 0,6 mM IPTG (für pELM3-Klone) oder 0,4% L-Arabinose anstelle von Glyzerin (für pBAD/MBP-N-Klone) zugegeben. Das Wachstum wurde mehrere weitere Stunden fortgesetzt, und danach wurden die Zellen geerntet und mit SDS-Proteingelpuffer lysiert. Die Proben wurden auf einem Acrylamidgel mit einem Gradienten von 4-20% gefahren, und unter Verwendung von Amplify (Amersham) und Röntgenfilm fluorographiert.

Beispiel 5 Kolonielifts

Kolonielifts wurden doppelt ausgeführt, im Wesentlichen wie beschrieben (Sambrook, 1989, Molecular Cloning: A Laboratory Manual (CSH Press)) außer dass die induzierenden Platten 10 &mgr;M Biotin und 0,3 mM IPTG (für pELM3-Klone) oder 0,2% L-Arabinose (für pBAD/MBP-N-Klone) enthielten. Das Blockierreagenz war 5% BSA, und die Sonde war 1/5000 verdünntes Streptavidin-alkalische Phosphatase-Konjugat (Gibco BRL).

Beispiel 6 Überexpression von BirA

Das birA-Gen wurde unter der Kontrolle von induzierbaren Promotoren auf zwei verschiedenen Plasmiden kloniert. Das birA-Gen wurde in einer Polymerasekettenreaktion (PCR) von dem Plasmid pBA22 (siehe Barken and Campbell, 1981, J. Mol. Biol. 146: 469-492) amplifiziert, unter Verwendung der Primen ON-1589 (SEC ID NO: 101)(5' TAC AGT GCT AGC TAA CTA ATG GAG GAT ACA TAA ATG AAG GAT AAC ACC GTG CCA CTG 3') und ON-1590 (SEQ ID NO: 102)(5' GTA TCA GAG CTC TTA TTT TTC TGC ACT ACG CAG GGA 3'). Das Fragment wurde mit Sacl und Nhel verdaut und in mit Sacl, Nhel verdautes Plasmid pJS100 kloniert, wodurch birA unter die Kontrolle des araBAD-Promotors gestellt wurde. Das resultierende Plasmid, bezeichnet als pJS170, enthält einen von pBR322 abgeleiteten Replikationsursprung, ein Ampicillinresistenzgen, und das araC-Gen, das für einen Regulator des araBAD-Promotors kodiert. Induktion der Expression von birA aus diesem Plasmid in LB + 0,2% Arabinose ermöglicht die Expression großer Mengen an BirA-Protein.

Das birA-Genfragment wurde auch in mit Sacl, Spel verdautes Plasmid plQCAT-LC9 kloniert. Dies stellt birA unter die Kontrolle des tac-Promotors, der mit IPTG induzierbar ist. Dieses Plasmid, bezeichnet als pJS169, enthält auch einen p15A-Replikationsursprung, ein Chloramphenicolresistenzgen, und das laclQ-Allel des lacl-Gens, welches für einen Repressor der Promotoren lac oder tac kodiert. Der p15A-Replikationsursprung ermöglicht die Replikation dieses Plasmids in der gleichen Zelle wie von pBR322 abgeleitete Plasmide. Somit kann BirA in der gleichen Zelle, die das Biotinylierungszielprotein exprimiert, überexprimiert werden. Zellen, die pJS169 enthalten und in LB + 0,3 mM IPTG angezogen werden, überexprimieren BirA in einem geringeren Ausmaß als Zellen, die pJS170 enthalten und mit 0,2% Arabinose induziert werden.

Beispiel 7 Verstärkte Biotinylierung in einem E. coli Stamm, der BirA überproduziert

Die Effizienz der Biotinylierung des MBP-Peptid-Fusionsproteins wurde unter zwei Wachstumsbedingungen unter Verwendung eines Bandenverschiebungsassays bestimmt. Dieser Assay wurde durchgeführt, indem deglykosiliertes Avidin (UltraAvidin, Leinco Technologies) mit einem Zellrohlysat aus einem E. coli Stamm, der das MBP-Peptid-Fusionsprotein überexprimierte, gemischt wurde. Das Gemisch wurde einer Elektrophorese auf einem nicht-denaturierenden 4-20% Acrylamidgel unterzogen und mit dem Lysat ohne Avidin verglichen. Ein Vergleich der beiden Bahnen ermöglichte die Quantifizierung der Biotinylierungseffizienz durch Beobachten der durch das zugegebene Avidin verursachten Bandenverschiebung. Fusionsproteine, die in einem Stamm exprimiert worden waren, der pJS169 enthielt (unter Induktion von birA mit 0,3 mM IPTG), in LB-Medium, enthaftend 10 &mgr;M Biotin, waren stärker biotinyliert als diejenigen, welche in Abwesenheit von extra BirA und zugegebenem Biotin exprimiert worden waren.

Beispiel 8 Biotinylierung von rekombinanten Proteinen in vitro 1. Überexpression und Reinigung von BirA

BirA kann entweder gemäß veröffentlichten Verfahren (siehe Buoncristiani and Otsuka, 1988, J. Biol. Chem. 163(2): 1013-1016) oder gemäß dem nachfolgenden Verfahren gereinigt werden.

Eine Einzelkolonie des E. coli Stamms BL21, transformiert mit pJS169, wurde über Nacht in 50 ml LB + Ampicillin angezogen. Diese Kultur wurde 1:100 in 1 Liter LB + Ampicillin angeimpft und bei 37°C unter Schütteln bis zu OD600 = 0,5 angezogen. Nach Induktion mit 0,4 mM IPTG wurden die Zellen weitere 4 Stunden angezogen, mittels Zentrifugation geerntet, in 20 mM Tris-HCl pH 7,4 + 5 mM DTT (TD5) erneut suspendiert, und durch Beschallen lysiert. Zellmaterial wurde mittels Zentrifugation entfernt, und der Überstand mit TD5-Puffer auf ein Gesamtvolumen von 100 ml verdünnt.

Roher Überstand wurde auf eine 10 ml Blue Sepharose FF-Säule (Pharmacia) aufgetragen und mit TD (20 mM Tris-HCl pH 7,4) durchgewaschen bis die A280 des Säulendurchflusses etwa 0 war. Diese Säule wurde mit 100 ml eines Gradienten von 0-1,5 M NaCl in TD eluiert, und 2 ml Fraktionen wurden gesammelt. BirAenthaltende Fraktionen wurden gepoolt und gegen TD dialysiert bis die NaCl-Konzentration etwa 15 mM betrug.

Das Dialysat wurde unter Verwendung von Amicon YM30 konzentriert und danach auf eine 5 ml S Sepharose FF-Säule (Pharmacia) aufgetragen und mit TD1 (20 mM Tris-HCl pH 7,4 + 1 mM DTT) durchgewaschen. Protein wurde mit 50 ml eines Gradienten von 0-350 mM NaCl in TD1 eluiert.

BirA-enthaltende Fraktionen wurden gepoolt, an eine Biotin-Sepharose-Säule gebunden, mit TD1/150 mM NaCl gewaschen, und mit TD1/150 mM NaCl + 2 mM Biotin eluiert. BirA-enthaltende Fraktionen wurden über YM30 gegen TD1/150 mM NaCl auf ein Endvolumen von 10 ml dialysiert.

2. Biotinylierung in vitro unter Verwendung von gereinigtem BirA-Enzym

Proteine, die an eines der erfindungsgemäßen Peptide fusioniert waren, wurden in vitro bei 37°C biotinyliert, in einem Puffer, enthaltend: RPMI-Medium 1640 (Gibco-BRL), ergänzt mit 5 mM ATP, 5 mM MgCl2 und 10 &mgr;M Biotin.

Obwohl die vorstehende Erfindung mittels Erläuterungen und Beispielen aus Gründen der Klarheit und Verständlichkeit in gewisser Ausführlichkeit beschrieben worden ist, wird offensichtlich sein, dass bestimmte Veränderungen und Modifikationen innerhalb des Schutzumfangs der beigefügten Ansprüche durchgeführt werden können.

SEQUENZPROTOKOLL

Anspruch[de]
  1. Verfahren zum Biotinylieren eines Proteins, wobei das Verfahren umfasst:

    (a) Konstruieren eines rekombinanten DNA-Expressionsvektors, der für ein Fusionsprotein kodiert, welches das Protein und ein Biotinylierungspeptid mit einer Länge von weniger als 50 Aminosäuren umfasst,

    (b) Transformieren einer rekombinanten Wirtszelle, z.B. E. coli, mit dem Vektor, und

    (c) Kultivieren der Wirtszelle in der Gegenwart von Biotin oder einem Biotinanalogon, und unter Bedingungen, so dass das Fusionsprotein und ein Biotinylierungsenzym exprimiert werden, was zu der Biotinylierung des Fusionsproteins führt.
  2. Verfahren nach Anspruch 1, wobei das Biotinylierungspeptid eine Länge von mehr als 10 Aminosäuren hat.
  3. Verfahren nach einem der vorhergehenden Ansprüche, wobei das Biotinylierungspeptid eine Aminosäuresequenz umfasst, definiert durch:

    LX1X2IX3X4X5X6KX7X8X9X10 (SEQ. ID NO:1)

    worin X1 eine beliebige Aminosäure ist, X2 eine von L, V, I, W, F, Y verschiedene Aminosäure ist, X3 gleich F oder L ist, X4 gleich E oder D ist, X5 gleich A, G, S oder T ist, X6 gleich Q oder M ist, X7 gleich I, M oder V ist, X8 gleich E, L, V, Y oder I ist, X9 gleich W, Y, V, F, L oder I ist, und X10 gleich R, H,. oder eine von D oder E verschiedene Aminosäure ist.
  4. Verfahren zum Biotinylieren eines Proteins, wobei das Verfahren umfasst:

    (a) Konstruieren eines rekombinanten DNA-Expressionsvektors, der für ein Fusionsprotein kodiert, welches das Protein und ein Biotinylierungspeptid mit einer Länge von weniger als 50 Aminosäuren umfasst,

    (b) Produzieren des durch den Vektor kodierten Fusionsproteins, entweder durch Transformieren einer rekombinanten Wirtszelle mit dem Vektor und Kultivieren von mit dem Vektor transformierten Wirtszellen, oder durch Inkubieren des Vektors in einem zellfreien Transkriptions- und Translationssystem, und

    (c) Inkubieren des Fusionsproteins in einem Reaktionsgemisch, umfassend Biotin oder ein Biotinanalogon und ein Biotinylierungsenzym, was zu der Biotinylierung des Fusionsproteins führt.
  5. Verfahren nach einem der Ansprüche 1 bis 4, wobei das Biotinylierungspeptid eine Sequenz, ausgewählt aus den in Anspruch 6 definierten Sequenzen, hat.
  6. Rekombinanter DNA-Vektor, der eine Nukleinsäure umfasst, welche für ein Biotinylierungspeptid mit einer Länge von weniger als 50 Aminosäuren kodiert, wobei das Biotinylierungspeptid:

    (a) LX1X2IX3X4X5X6KX7X8X9X10 (SEQ. ID NO:1) ist, worin X1 eine beliebige Aminosäure ist, X2 eine von L, V, I, W, F, Y verschiedene Aminosäure ist, X3 gleich F oder L ist, X4 gleich E oder D ist, X5 gleich A, G, S oder T ist, X6 gleich Q oder M ist, X7 gleich I, M oder V ist, X8 gleich E, L, V, Y oder I ist, X9 gleich W, Y, V, F, L oder I ist, und X10 bevorzugt gleich R, H, oder eine von D oder E verschiedene Aminosäure ist, oder

    (b) ausgewählt ist aus
  7. Gereinigte Präparation eines biotinylierten Fusionsproteins, erhältlich durch ein Verfahren nach einem der Ansprüche 1 bis 5, wobei das Fusionsprotein ein Biotinylierungspeptid mit einer Länge von weniger als 50 Aminosäuren umfasst, und das Biotinylierungspeptid wie in Anspruch 6 definiert ist.
  8. Kit für die enzymatische Biotinylierung eines Proteins, wobei das Kit ein rekombinantes DNA-Expressionspolynukleotid umfasst, das für ein Biotinylierungspeptid mit einer Länge von weniger als 50 Aminosäuren kodiert, und das mit einem Protein fusioniert werden kann, durch Insertieren der für das Protein kodierenden Sequenz im Leseraster, wobei das Biotinylierungspeptid wie in Anspruch 6 definiert ist.
  9. Kit nach Anspruch 8, wobei das Expressionspolynukleotid in eine Wirtszelle transformiert ist, wobei die Wirtszelle gegebenenfalls eine Biotinproteinligase überexprimiert.
  10. Kit nach Anspruch 8 oder 9, wobei das DNA-Expressionspolynukleotid eine mit der für das Peptid kodierenden Sequenz verbundene Mehrfachklonierungsstelle enthält, so dass ein beliebiges Protein für eine Expression insertiert werden kann.
  11. Verfahren zum Identifizieren eines Biotinylierungsenzyms, wobei das Verfahren umfasst:

    a) Bereitstellen eines Fusionsproteins, umfassend ein Protein und ein Biotinylierungspeptid mit einer Länge von weniger als 50 Aminosäuren, auf einer Oberfläche eines Substrats, gegebenenfalls umfassend einen Träger mit mehreren Vertiefungen, z.B. eine Mikrotiterplatte mit 96 Vertiefungen,

    b) in Kontakt Bringen des Fusionsproteins mit einem Enzym in einer vorbestimmten Region der Oberfläche, wobei das Fusionsprotein gegebenenfalls mit mehreren unterschiedlichen Enzymen in Kontakt gebracht wird, wobei jedes der unterschiedlichen Enzyme in einer unterschiedlichen vorbestimmten Region ist, und

    c) Bestimmen, ob das Fusionsprotein biotinyliert worden ist,

    wobei das Biotinylierungspeptid gegebenenfalls wie in Anspruch 6 definiert ist.
  12. Verfahren nach Anspruch 11, wobei der Schritt des Bestimmens, ob das Fusionsprotein biotinyliert worden ist, des Weiteren die Schritte umfasst:

    a) Behandeln des Fusionsproteins mit markiertem Streptavidin, wobei das markierte Streptavidin an biotinylierte Fusionsproteine bindet,

    b) Waschen des Substrats, um nicht-gebundenes markiertes Streptavidin zu entfernen, und

    c) Nachweisen der Gegenwart von markiertem Streptavidin, das an biotinyliertes Fusionsprotein gebunden hat.
  13. Verfahren nach einem der Ansprüche 1 bis 5, 11 oder 12, wobei das Biotinylierungsenzym Biotinligase ist, bevorzugt BirA.
Es folgt kein Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

  Patente PDF

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com