PatentDe  


Dokumentenidentifikation DE69927795T2 27.07.2006
EP-Veröffentlichungsnummer 0001064296
Titel TEMPERATURSTABILE DNA POLYMERASE AUS THERMOANAEROBACTER THERMOHYDROSULFURICUS
Anmelder GE Healthcare Bio-Sciences Corp., Piscataway, N.J., US
Erfinder MAMONE, A., Joseph, Parma, US;
DAVIS, Maria, Twinsburg, US;
SHA, Dan, Euclid, US
Vertreter Hammonds Rechtsanwälte Patentanwälte, 80539 München
DE-Aktenzeichen 69927795
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 17.03.1999
EP-Aktenzeichen 999114002
WO-Anmeldetag 17.03.1999
PCT-Aktenzeichen PCT/US99/05612
WO-Veröffentlichungsnummer 1999047539
WO-Veröffentlichungsdatum 23.09.1999
EP-Offenlegungsdatum 03.01.2001
EP date of grant 19.10.2005
Veröffentlichungstag im Patentblatt 27.07.2006
IPC-Hauptklasse C07H 21/04(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 1/14(2006.01)A, L, I, 20051017, B, H, EP   C12N 1/20(2006.01)A, L, I, 20051017, B, H, EP   C12N 5/00(2006.01)A, L, I, 20051017, B, H, EP   C12N 9/12(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/00(2006.01)A, L, I, 20051017, B, H, EP   C12P 19/34(2006.01)A, L, I, 20051017, B, H, EP   C12Q 1/68(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]

Diese Anmeldung beansprucht die Priorität von Mamone et al., US Serien-Nr. 08/766,014, eingereicht am 13. Dezember 1996, mit dem Titel „Thermostable DNA-Polymerase From Thermoanaerobacter thermohydrosulfuricus", die die Priorität von U.S. Serien-Nr. 60/008,688, eingereicht am 15. Dezember 1995, mit dem Titel „Thermostable DNA-Polymerase" beansprucht.

Hintergrund der Erfindung

Die vorliegende Erfindung bezieht sich auf neue thermostabile DNA-Polymerasen, die aus dem thermophilen anaeroben Thermoanaerobacter thermohydrosulfuricus erhältlich sind, auf bestimmte Deletanten und Mutanten dieses Enzyms, auf Gene und Vektoren, die die Wildtyp- und mutanten Polymerasen kodieren, und ihre Verwendung in Strang-Verdrängungs-Aktivität, Polymerasekettenreaktion, DNA-Sequenzierung und als Reverse Transkriptasen. Das Folgende ist eine Diskussion der relevanten Technik, von denen keine als Stand der Technik für die beigefügten Ansprüche anerkannt wird. DNA-Polymerasen sind eine Familie von Enzymen, die in der DNA-Reparatur und -Replikation involviert sind. DNA-Polymerasen wurden aus E.coli (z.B. E.coli-DNA-Polymerase I und das Klenow-Fragment davon) isoliert und T4-DNA-Polymerase und kürzlich thermostabile DNA-Polymerasen wurden isoliert (z.B. aus T.aquaticus, US Patent 4,889,818 und aus T.litoralis). Thermostabile DNA-Polymerasen wurden vorgeschlagen (US Patent 4,683,195) zur Verwendung bei der Amplifikation existierender Nucleinsäuresequenzen in Mengen, die groß sind im Vergleich zu der ursprünglich vorhandenen. Die Polymerasekettenreaktion (PCR) und die Strang-Verdrängungs-Amplifikation (SDA) sind zwei Verfahren zum Amplifizieren von Nucleinsäuresequenzen.

PCR basiert auf der Hybridisierung von Oligonucleotid-Primern an spezifische Sequenzen entgegengesetzter Stränge des Ziel-DNA-Moleküls und nachfolgender Verlängerung dieser Primer mit einer DNA-Polymerase, um zwei neue Stränge DNA zu erzeugen, die selbst als eine Matrize für eine weitere Runde der Hybridisierung und Verlängerung dienen können. In PCR-Reaktionen dient das Produkt eines Zyklus als die Matrize für den nächsten Zyklus derart, dass jede Wiederholung des Zyklus die Menge der spezifischen, in der Reaktion vorhandenen Sequenz verdoppelt, was zu einem exponentiellen Amplifikationsprozess führt.

PCR beruht auf einem Prozess des Temperatur-Cyclings, um die Amplifikations-Reaktion zu fördern. Dieses Temperatur-Cycling ist nötig, um die Stränge der in einem Zyklus der Reaktion gebildeten DNA zu trennen, um eine Hybridisierung der Oligonucleotide, die zum Initiieren des nächsten Zyklus erforderlich sind, zu ermöglichen. DNA-Strang-Trennung wird üblicherweise durch Schmelzen der DNA bei Temperaturen im Bereich von 90–100 °C gefolgt von Kühlen auf eine niedrigere Temperatur erreicht, um eine Oligonucleotidhybridisierung, gefolgt von Verlängerung oder Ligation, zu ermöglichen, abhängig vom Reaktionsprozeß. Dieser Cycling-Prozeß kann 20 bis 50 Mal wiederholt werden, wieder abhängig vom Prozess und dem Grad der erforderlichen Amplifikation.

Temperatur-Cycling wird normalerweise durch die Verwendung einer spezialisierten Ausrüstung erreicht, allgemein genannt Thermocyclers, die durch eine weite Vielfalt mechanischer, elektrischer oder hydraulischer Mittel arbeiten können, aber einem gemeinsamen Zweck beim Heizen und Kühlen eines kleinen Behälters oder einer Anzahl derartiger Behälter dienen, in dem/denen die Amplifikations-Reaktion ausgeführt wird.

Damit die Amplifikations-Reaktionen mit der erwünschten Effizienz und Spezifität voranschreiten, ist es nötig, den Temperatur-Cycling-Prozess innerhalb von strikt definierten und reproduzierbaren Grenzen der Temperatur und Zeit auszuführen. Ein Fehlschlag des Temperatur-Cycling-Gerätes, die erwünschten Bedingungen zu erreichen, wird zum teilweisen oder gesamten Fehlschlag der Amplifikations-Reaktion führen. Diese strikten Erfordernisse für die Zeit und die Temperatur des Cyclings kann starke Beschränkungen auferlegen, falls die Handhabung großer Anzahlen von Reaktionen erforderlich ist. Falls es erwünscht ist, mehrere hundert oder mehr Reaktionen gleichzeitig auszuführen, würde die Verwendung herkömmlicher Thermocycler extrem teuer in Bezug auf die Kapitalinvestition sein, die in die Ausrüstung erforderlich ist, und würde in jedem Fall zu Schwankungen zwischen individuellen Thermocyclern neigen. Alternative Lösungen für die Verwendung im großen Maßstab wurden konstruiert, basierend auf einem mit einem Gebläse unterstützten Ofen oder mehreren Wasserbädern, aber derartige Lösungen sind unvermeidbar mühsam in der Verwendung und erfordern noch in jedem Fall, dass der Benutzer die normalen zwingenden Schritte zum Vermeiden einer Verdampfung unternimmt, welche extrem schwierig werden, um sie auf eine große Anzahl von Cyclern anzuwenden.

In der Reverse-Transkription/Polymerasekettenreaktion (RT/PCR) wird ein DNA-Primer an einen Strang des Ziel-RNA-Moleküls hybridisiert und die nachfolgende Verlängerung dieses Primers mit einer Reversen Transkriptase erzeugt einen neuen Strang DNA, die als eine Matrize für PCR dienen kann. Die Herstellung der DNA-Matrize wird bevorzugt bei einer erhöhten Temperatur ausgeführt, um eine frühe Beendigung der Reaktion der Reversen Transkriptase, die durch die sekundäre RNA-Struktur verursacht wird, zu vermeiden. Es gibt einen Mangel effizienter Reverser Transkriptasen, die bei erhöhten Temperaturen, z.B. über 50 °C, arbeiten.

SDA unterscheidet sich von PCR darin, dass sie ein isothermer Amplifikations-Prozess ist, d.h. alle Reaktionen erfolgen bei derselben Temperatur ohne die Notwendigkeit für erhöhte Temperaturen, um DNA-Stränge zu schmelzen. Dies wird es möglich durch Annahme eines Reaktionsschemas, das die Fähigkeit bestimmter DNA-Polymerasen nutzt, dass sie, wenn sie sich entlang eines DNA-Matrize-Stranges erstrecken. alle DNA-Moleküle, die bereits an die Matrize hybridisiert sind, verdrängen. In der SDA wird diese Strang-Verdrängung verwendet, um die erzeugte Doppelstrang-DNA während des Reaktionsprozesses zu trennen und daher eine kontinuierliche Amplifikation der Ziel-DNA-Sequenz aufrechtzuerhalten (Walker, G. T., Little, M.C., Nadeau, J.G. and Shank D.D. (1992) Proc. Natl. Acad. Sci. USA 89:392–396). SDA ist deshalb im Prinzip zur Verwendung mit großen Anzahlen von Proben geeigneter als PCR, da der isotherme Prozess, der bei Temperaturen von 37 °C bis 60 °C ausgeführt wird, nicht erfordert, strenge Vorsichtsmaßnahmen zu ergreifen, um das Verdampfen zu vermeiden, und kann mit einer einfachen Temperatursteuerungsausrüstung ausgeführt werden, z.B. in einem Standardlaborinkubator.

DNA-Polymerasen, z.B. Sequenase, Klenow, Taq, etc., wurden auch beim DNA-Sequenzieren extensiv verwendet, siehe z.B. „Molecular Cloning: A Laboratory Manual" (Sambrook, Fritsch, und Maniatis, 2. Ausgabe, Cold Spring Harbor laboratory Press, 1989).

Zusammenfassung der Erfindung

Die vorliegende Erfindung stellt eine thermostabile DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus, bereit.

Dieses Enzym ist für Prozeduren nützlich, die eine Strang-verdrängende DNA-Synthese erfordern, wie SDA für DNA-Sequenzieren, Reverse Transkription und Polymerasekttenreaktion. Enthalten im Umfang der vorliegenden Erfindung sind verschiedene Mutanten (Deletion und Substitution), die die Thermostabilität und die Fähigkeit zum Replizieren von DNA mit im wesentlichen derselben Effizienz wie die native Thermoananaerobacter thermohydrosulfuricus-Polymerase beibehält.

Im einem ersten Aspekt stellt die vorliegende Erfindung eine gereinigte DNA-Polymerase oder ein Fragment davon bereit, die die DNA-Polymerase-Aktivität von Thermoanaerobacter thermohydrosulfuricus der SEQ. ID. Nr. 2 besitzt und deren Exonuclease-Aktivität durch Austauschen des Asparaginsäure-Restes in Position 8 mit einem Alanin-Rest entfernt ist und die mindestens 80 % Aminosäure-Homologie, bevorzugt mindestens 900-Homologie zu mindestens einer zusammenhängenden Aminosäuresequenz aufweist, die in 2A–D (SEQ. ID. Nr. 2) dargestellt ist. 2A–D repräsentiert die Translation von einen offenen Leserahmen umspannenden Nucleotiden 1056–3674 einer Genom-DNA, die eine thermostabile DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus (1A–E) (SEQ. ID. Nr. 1) kodiert, die möglicherweise die native Polymerase kodiert.

Wenn hier verwendet, bedeutet der Begriff Aminosäure-Homologie die Aminosäure-Identität des Eltern-Enzyms oder konservative Aminosäure-Änderungen daran. Die DNA-Polymerase kann durch eine Nucleinsäuresequenz einer vollen Länge oder einen beliebigen Teil der Nucleinsäuresequenz der vollen Länge kodiert werden, solange wie eine funktionelle Aktivität des Polypeptids beibehalten wird. Die Aminosäure-Sequenz wird im wesentlichen der in 2A–D gezeigten Sequenz oder Fragmenten davon ähnlich sein. Eine Sequenz, die im wesentlichen ähnlich ist, wird bevorzugt mindestens 80% Identität (bevorzugter mindestens 90% und am meisten bevorzugt 98–100%) zur Sequenz der 2A–D besitzen.

Mit „Identität" ist eine Eigenschaft von Sequenzen gemeint, die ihre Ähnlichkeit oder Verwandtschaft misst. Identität wird durch Teilen der Anzahl identischer Reste durch die Gesamtzahl von Resten und Multiplizieren des Produktes mit 100 bemessen. So können zwei Kopien von genau derselben Sequenz 100% Identität besitzen, aber Sequenzen, die weniger stark konserviert sind und Deletionen, Additionen oder Ersetzungen besitzen, können einen niedrigeren Grad der Identität besitzen. Jene Fachleute werden erkennen, dass mehrere Computerprogramme zum Bestimmen der Sequenzidentität erhältlich sind.

Das gereinigte Enzym der vorliegenden Erfindung besitzt ein Molekulargewicht von annähernd 90.000 Dalton, wenn es auf SDS-PAGE gemessen wird. Es besitzt eine 5'-3'-Exonuclease-Aktivität. Das Temperaturoptimum der DNA-Synthese liegt nahe 75 °C unter Assay-Bedingungen. Die optimalen Magnesiumion- und Manganion-Konzentrationen für die DNA-Synthese sind 1 mM bzw. 0,5 mM.

Der Begriff thermostabile Polymerase bedeutet ein Enzym, das gegenüber Wärme stabil (und wärmeresistent) ist und zur Verwendung in SDA und/oder Sequenzieren bei einer erhöhten Temperatur geeignet ist, z.B. 70 °C. Das thermostabile Enzym hier muss einem einzelnen Kriterium genügen, um für die Amplifikations-Reaktion wirksam zu sein, d.h. das Enzym darf nicht irreversibel denaturiert (inaktiviert) werden, wenn es den erhöhten Temperaturen für die Zeitdauer, die zum Bewirken der Amplifikation nötig ist, ausgesetzt wird. Die irreversible Denaturierung für die Zwecke hier bezieht sich auf einen permanenten und vollständigen Verlust der enzymatischen Aktivität. Bevorzugt wird das Enzym nicht irreversibel denaturiert bei ungefähr 70 °C, aber kann bei höheren Temperaturen denaturiert werden. Das hier genannte thermostabile Enzym besitzt bevorzugt eine optimale Temperatur, bei der es funktioniert, die höher ist als ungefähr 40 °C, welche die Temperatur ist, unterhalb derer die Hybridisierung des Primers an die Matrize gefördert wird, obwohl, abhängig von (1) der Salzkonzentration und der Zusammensetzung und (2) der Zusammensetzung und der Länge des Primers, die Hybridisierung bei höheren Temperaturen (z.B. 45–70 °C) erfolgen kann. Je höher das Temperaturoptimum für das Enzym ist, desto größer ist die Spezifität und/oder Selektivität des vom Primer dirigierten Verlängerungsprozesses. Jedoch liegen Enzyme, die unterhalb 40 °C aktiv sind, z.B. bei 37 °C, auch innerhalb des Umfangs dieser Erfindung, vorausgesetzt, dass sie wärmestabil sind. Bevorzugt reicht die optimale Temperatur von ungefähr 50 bis 80 °C, bevorzugter 50–70 °C.

Wenn hier verwendet, bedeutet der Begriff eine DNA-Polymerase oder ein Fragment davon, die/das die DNA-Polymerase-Aktivität von Thermoanaerobacter thermohydrosulfuricus besitzt, eine DNA-Polymerase oder ein Fragment davon (wie hiernach definiert), die die Fähigkeit hat, DNA mit im wesentlichen derselben Effizienz wie das durch die SEQ. ID. Nr. 1 kodierte Enzym zu replizieren. Mit im wesentlichen derselben Effizienz ist gemeint mindestens 80 % und bevorzugt mindestens 90 der Effizienz des Enzyms, das durch SEQ. ID. Nr. 1 kodiert wird, um Desoxynucleotide einzubauen.

Die Erfindung umfasst auch eine stabile Enzymzusammensetzung, die eine gereinigte thermostabile DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus der SEQ. ID. Nr. 2 umfasst und deren Exonuclease-Aktivität durch Austauschen des Asparaginsäure-Restes in Position 8 mit einem Alanin-Rest in einem Puffer entfernt ist.

Die DNA-Polymerasen der vorliegenden Erfindung liegen bevorzugt in gereinigter Form vor. Mit gereinigt ist gemeint, dass die DNA-Polymerase von einer Mehrzahl von Wirtszellenproteinen, die normalerweise damit in Verbindung stehen, isoliert ist; bevorzugt beträgt die Polymerase mindestens 10% (gew/gew), z.B. mindestens 50 % (gew/gew) des Proteins eines Präparats, sogar bevorzugt wird sie als ein homogenes Präparat bereitgestellt, z.B. eine homogene Lösung. Bevorzugt ist die DNA-Polymerase ein einzelnes Polypeptid auf einem SDS-Polyacrylamidgel.

Puffer um den neutralen pH (5–9), wie 5–100 mM Tris-HCl, Phosphat oder MES sind zur Verwendung in der vorliegenden Erfindung geeignet.

Es wurde gefunden, dass die gesamte Aminosäuresequenz der Polymerase nicht für die enzymatische Aktivität erforderlich ist. Daher wurde z.B. die Exonuclease-Domäne deletiert, um ein Enzym eines Molekulargewichts von annähernd 64.000 Dalton, wenn es auf SDS-PAGE gemessen wird, zu ergeben, das die Enzymaktivität beibehält und auch eine Aktivität der Reversen Transkriptase besitzt, was es zum Herstellen von cDNA nützlich macht. Dieses Exonuclease-freie Enzym ist analog dem Klenow-Fragment von E.coli-DNA-Polymerase I. So stellt die vorliegende Erfindung auch Fragmente der Polymerase bereit, die die DNA-Polymerase-Aktivität von Thermoanaerobacter thermohydrosulfuricus beibehalten, aber eine oder mehrere Aminosäuren, bevorzugt vom Amino-Terminus, deletiert haben, während sie noch mindestens 80% Aminosäure-Homologie zu mindestens 40-zusammenhängender Aminosäuresequenz, die in 2A–D (SEQ. ID. Nr. 2) dargestellt sind, besitzt.

In einem weiteren Aspekt stellt die vorliegende Erfindung eine thermostabile DNA-Polymerase bereit, die der DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus entspricht, in der bis zu einem Drittel der Aminosäuresequenz am Amino-Terminus deletiert worden ist. Insbesondere wurde gefunden, dass Fragmente von Thermoanaerobacter thermohydrosulfuricus, die N-terminale Deletionen aufweisen, um 578 Aminosäuren (siehe 4A–C) (SEQ. ID. Nr. 4) und 608 Aminosäuren (siehe 3) (SEQ. ID. Nr. 3) zu ergeben, die Enzymaktivität beibehalten.

Es ist bevorzugt, dass die 5'-3'-Exonuclease-Aktivität der DNA-Polymerase entfernt oder verringert ist. Dies kann durch Deletieren des Aminosäurebereichs des Enzyms, das für diese Aktivität verantwortlich ist, erreicht werden, z.B. durch Deletieren bis zu einem Drittel der Aminosäuresequenz am Amino-Terminus, oder durch geeignete Aminosäure-Änderungen.

Zusätzlich zu den N-terminalen Deletionen und Aminosäure-Änderungen, um die Exonuclease-Aktivität zu entfernen kann das Enzym konservative Aminosäure-Änderungen im Vergleich zum nativen Enzym besitzen, die die Thermostabilität oder Enzymaktivität nicht signifikant beeinflussen. Derartige Änderungen umfassen die Substitution von gleich geladenen Aminosäuren durch eine andere oder Aminosäuren mit kleinen Seitenketten für andere kleine Seitenketten, z.B. ala für val. Drastischere Änderungen können an nicht-kritischen Bereichen eingeführt werden, wo wenig oder kein Effekt auf die Polymerase-Aktivität durch eine derartige Änderung beobachtet wird.

Joyce und Steitz, Annu. Rev. Biochem, 63:777–822, 1994 diskutieren verschiedene Funktionen der DNA-Polymerasen einschließlich des katalytischen Zentrums, der Bindungsstelle für den 3'-Terminus der Primers und die dNTP-Bindungsstelle. Insbesondere erwähnt sie Mutationen, die das Binden des dNTP im ternären Komplex beeinflussen können. Die europäische Patentanmeldung Nr. 0 655 506 A offenbart, dass das Vorhandensein eines polaren, Hydroxyl-enthaltenden Aminosäurerests an einer Position nahe der Bindungsstelle für das dNTP-Substrat dafür wichtig ist, dass die Polymerase fähig ist, ein Didesoxynucleotid effizient einzubauen. Der Anmelder hat erkannt, dass die Modifikation der dNTP-Bindungsstelle für das dNTP-Substrat in einer DNA-Polymerase, die von Thermoanaerobacter thermohydrosulfuricus erhältlich ist, durch den Einschluss eines polaren, Hydroxyl-enthaltenden Aminosäurerestes an einer Position nahe der Bindungsstelle die Effizienz der Polymerase, ein Didesoxynucleotid einzubauen, vergrößert. Bevorzugt ist die polare, Hydroxyl-enthaltende Aminosäure Tyrosin. Es wurde auch gefunden, dass Austauschen des Phenylalanins an der Position, die 706 des nativen Enzyms entspricht, durch Tyrosin den Einbau von Didesoxynucleotiden verbessert, wenn das Enzym zum Sequenzieren verwendet wird. Insbesondere ist eine Polymerase von Thermoanaerobacter thermohydrosulfuricus, in der die Exonuclease-Aktivität gelöscht wurde, z.B. durch Punktmutation oder Deletion, und bei der das Phenylalanin an der Position, die 706 des nativen Enzyms entspricht, durch eine Aminosäure ersetzt ist, die die Effizienz des Enzyms zum Einbauen von Didesoxynucleotiden mindestens 20-fach im Vergleich zum Wildtyp-Enzym, z.B. Tyrosin, vergrössert, ein besonders bevorzugtes Enzym zur Verwendung beim Sequenzieren. Bevorzugt besitzt dieses modifizierte Enzym zwischen 540 und 582 Aminosäuren, z.B. 560 bis 582 Aminosäuren und bevorzugt 578 Aminosäuren.

Die DNA-Polymerasen der vorliegenden Erfindung können unter Verwenden von Standardtechniken konstruiert werden, die jenen, die die Technik ausführen, geläufig sind. Im Wege des Beispiels können, um eine Polymerase mit der Phenylalanin-zu-Tyrosin-Mutation herzustellen, mutagene Primer entworfen werden, damit sie die erwünschten Phe-zu-Tyr-Aminosäureänderung (FY-Mutation in einem Primer) einbauen. Die Deletion der Exonuclease-Funktion wird durch PCR, um den Amino-Terminus zu entfernen, oder Standardtechniken von auf Stellen gerichtete Mutagenese, um Punktmutationen zu erzeugen, ausgeführt.

Verbesserte Expression der DNA-Polymerasen der vorliegenden Erfindung kann erreicht werden durch Änderungen von stummen Codons (d.h. die kodierte Aminosäure wird nicht geändert). Derartige Änderungen können durch die Verwendung mutagener PCR-Primer eingeführt werden. Änderungen von stummen Codons, wie die folgenden, vergrößern die Proteinproduktion in E.coli:

Substitution des Codons GAG für GAA;

Substitution des Codons AGG, AGA, CGG oder CGA für CGT oder CGC;

Substitution des Codons CTT, CTC, CTA, TTG oder TTA für CTG;

Substitution des Codons ATA für ATT oder ATC;

Substitution des Codons GGG oder GGA für GGT oder GGC.

Die DNA-Polymerasen der vorliegenden Erfindung werden geeigneterweise in SDA, bevorzugt in Kombination mit einem thermostabilen Restriktionsenzym verwendet. Demgemäß stellt die vorliegende Erfindung eine Zusammensetzung bereit, die eine DNA-Polymerase der vorliegenden Erfindung in Kombination mit einem thermostabilen Restriktionsenzym umfasst, z.B. BsoBI von Bacillus stearothermophilus. Die Erfindung bietet auch ein Kit oder eine Lösung für SDA, umfassend eine DNA-Polymerase der vorliegenden Erfindung in Kombination und ein thermostabiles Restriktionsenzym.

Die Polymerasen der vorliegenden Erfindung sind auch nützlich in Verfahren zum Erzeugen und Amplifizieren eines Nucleinsäure-Fragmentes über einen Strang-Verdrängungs-Amplifikations(SDA)-Mechanismus. Das Verfahren umfasst allgemein:

  • a) spezifisches Hybridisieren eines ersten Primers 5' an eine Ziel-Nucleinsäuresequenz, wobei der erste Primer eine Restriktionsenzym-Erkennungssequenz 5' an eine Zielbindungsregion enthält;
  • b) Verlängern des 3'-Endes des hybridisierten Materials unter Verwenden einer DNA-Polymerase der vorliegenden Erfindung bevorzugt eine, in der die Exonuclease-Aktivität entfernt worden ist, bei Vorhandensein von drei dNTPs und einem dNTP ∝ S;
  • c) bevorzugt Nicking an der Hemiphosphorothioat-Erkennungsstelle mit einem Restriktionsenzym;
  • d) Verlängern des 3'-Endes an der Nick-Stelle unter Verwenden einer DNA-Polymerase der vorliegenden Erfindung, wobei das Strangabwärts-Komplement des Zielstranges ersetzt wird; und
  • e) Wiederholen der Schritte (c) und (d).

Dieses SDA-Verfahren schreitet mit einer linearen Amplifikations-Geschwindigkeit voran, falls ein Primer wie oben verwendet wird. Jedoch, falls zwei Primer verwendet werden, die an jeden Strang eines Doppel-Strang-DNA-Fragmentes hybridisieren, schreitet das Verfahren exponentiell voran (Walker, G.T., Little, M.C., Nadeau, J.G. und Shank D.D. (1992) Proc. Natl. Acad. Sci. USA 89:392–396).

Die vorliegende Erfindung stellt auch ein Verfahren zum Bestimmen der Nucleotidbasensequenz eines DNA-Moleküls bereit. Das Verfahren umfasst Bereitstellen eines DNA-Moleküls, Assoziieren mit einem Primermolekül, das fähig ist, an das DNA-Molekül zu hybridisieren; und Inkubieren der assoziierten Moleküle in einem Gefäß, das mindestens ein und bevorzugt vier Desoxynucleotidtriphosphate und eine DNA-Polymerase der vorliegenden Erfindung enthält, bevorzugt eine, die die Phenylalanin-zu-Tyrosin-Mutation enthält. Auch wird mindestens ein DNA-Synthese-terminierendes Mittel bereitgestellt, das die DNA-Synthese an einer spezifischen Nucleotidbase terminiert. Das Verfahren umfasst weiter Trennen der DNA-Produkte der Inkubier-Reaktion nach der Größe, wodurch mindestens ein Teil der Nucleotidbasensequenz des DNA-Moleküls bestimmt werden kann.

In bevorzugten Ausführungsformen wird das Sequenzieren bei einer Temperatur zwischen 40 und 75 °C ausgeführt.

In anderen bevorzugten Ausführungsformen besitzt die DNA-Polymerase weniger als 1.000, 250, 100, 50, 10 oder sogar 2 Einheiten der Exonuclease-Aktivität pro mg Polymerase (gemessen durch eine Standardprozedur, siehe unten) und ist fähig, Primer mit nur 4, 6 oder 10 Basen einzusetzen; und die Konzentration aller vier Desoxynucleosidtriphosphate beim Beginn des Inkubationsschrittes in ausreichend, um zu ermöglichen, dass die DNA-Synthese fortgesetzt wird, bis sie durch das Mittel, z.B. ein ddNTP, terminiert wird.

Bevorzugt wird mehr als 2, 5, 10 oder sogar 100-facher Überschuß eines dNTPs dem entsprechenden ddNTP bereitgestellt.

In einem verwandten Aspekt bietet die Erfindung ein Kit oder eine Lösung zum DNA-Sequenzieren, umfassend eine DNA-Polymerase der vorliegenden Erfindung und ein Reagenz, das zum Sequenzieren nötig ist, wie ein dITP, deaza-dGTP, ein Kettenterminierendes Mittel wie ein ddNTP und gegebenenfalls eine Pyrophosphatase.

Die DNA-Polymerasen der vorliegenden Erfindung, die die Phenylalanin-zu-Tyrosin-Mutation enthalten, werden auf geeignete Weise beim Sequenzieren verwendet, bevorzugt in Kombination mit einer Pyrophosphatase. Demgemäß stellt die vorliegende Erfindung eine Zusammensetzung bereit, umfassend eine DNA-Polymerase der vorliegenden Erfindung, die die Phenylalanin-zu-Tyrosin-Mutation enthält, in Kombination mit einer Pyrophosphatase, bevorzugt eine thermostabile Pyrophosphatase von Thermoplasma acidophilum.

In einem anderen verwandten Aspekt bietet die Erfindung ein Verfahren zum Sequenzieren eines DNA-Stranges, im wesentlichen wie oben beschrieben, mit einer oder mehreren (bevorzugt 2, 3 oder 4) Desoxyribonucleosidtriphosphaten, einer DNA-Polymerase der vorliegenden Erfindung und ein erstes Ketten-terminierendes Mittel. Die DNA-Polymerase verursacht, dass der Primer verlängert wird, um eine erste Reihe von ersten DNA-Produkten zu bilden, die sich in der Länge des verlängerten Primers unterscheiden, wobei jedes erste DNA-Produkt ein Kettenterminierendes Mittel an seinem verlängerten Ende besitzt, und die Anzahl von Molekülen jedes ersten DNA-Produktes annähernd dieselben für im wesentlichen alle DNA-Produkte sind, die sich in der Länge durch nicht mehr als 20 Basen unterscheiden. Das Verfahren bietet auch Bereitstellen eines zweiten Ketten-terminierenden Mittels in der hybridisierten Mischung bei einer Konzentration, die sich vom ersten Ketten-terminierenden Mittel unterscheidet, wobei die DNA-Polymerase die Erzeugung einer zweiten Reihe von zweiten DNA-Produkten verursacht, die sich in der Länge des verlängerten Primers unterscheidet, wobei jedes zweite DNA-Produkt das zweite Ketten-terminierende Mittel an seinem verlängerten Ende besitzt. Die Anzahl von Molekülen jedes zweiten DNA-Produktes ist annähernd dieselbe für im wesentlichen alle zweiten DNA-Produkte, die sich in der Länge voneinander um 1 bis 20 Basen unterscheiden, und ist merklich verschieden von der Anzahl der Moleküle all der ersten DNA-Produkte mit einer Länge, die sich um nicht mehr als 20 Basen von jener der zweiten DNA-Produkte unterscheidet.

In bevorzugten Ausführungsformen können drei oder vier derartige Ketten-terminierende Mittel verwendet werden, um unterschiedliche Produkte herzustellen, und die Sequenzreaktion wird mit einem Magnesiumion, oder sogar einem Mangan- oder Eisenion (z.B. bei einer Konzentration zwischen 0,05 und 100 mM, bevorzugt zwischen 1 und 10 mM) bereitgestellt; und die DNA-Produkte werden gemäß des Molekulargewichts in vier oder weniger Spuren eines Gels getrennt.

In einem anderen verwandten Aspekt bietet die Erfindung ein Verfahren zum Sequenzieren einer Nucleinsäure durch Kombinieren eines Oligonucleotid-Primers einer zu sequenzierenden Nucleinsäure, zwischen einem und vier Desoxyribonucleosidtriphosphaten, eine DNA-Polymerase der vorliegenden Erfindung und mindestens zwei Ketten-terminierende Mittel in verschiedenen Mengen, unter Bedingungen, die die Verlängerung des Oligonucleotid-Primers begünstigen, um Nucleinsäurefragmente zu bilden, die zu der zu sequenzierenden Nukleinsäure komplementär sind. Das Verfahren umfasst weiter Trennen der Nucleinsäurefragmente durch Größe und Bestimmen der Nucleinsäuresequenz. Die Mittel werden voneinander durch die Intensität eines Labels in den Primer-Verlängerungsprodukten unterschieden.

In einem weiteren Aspekt stellt die vorliegende Erfindung ein Verfahren zum Herstellen komplementärer DNA durch Kombinieren eines Oligonucleotid-Primers, einer Probe RNA, einer DNA-Polymerase der vorliegenden Erfindung und zwischen einem und vier Desoxyribonucleosidphosphaten bereit, unter Bedingungen, die die Herstellung der komplementären DNA begünstigen.

Die DNA-Polymerasen der vorliegenden Erfindung, die als Reverse Transkriptasen wirken, fehlen in beträchtlichem Ausmaß, und bevorzugt haben sie keine RNaseH-Aktivität und, als solche, sind sie in RT/PCR der Herstellung von Hybridisierungs-Sonden und RNA-Sequenzierung nützlich. In einem noch weiteren Aspekt stellt die vorliegende Erfindung gereinigte thermostabile Reverse Transkriptase bereit, mit einer Aktivität der Reversen Transkriptase von mehr als 1.000 Einheiten pro mg. Bevorzugt fehlt der Reversen Transkriptase RNaseH-Aktivität; die Reverse Transkriptase stammt von Thermoanaerobacter thermohydrosulfuricus; die Reverse Transkriptase besitzt eine N-terminale Deletion oder Aminosäure-Änderungen, die die Exonucleasefunktion entfernen. In einem weiteren Aspekt bietet die Erfindung ein Verfahren für die Reverse Transkription/Polymerasekettenreaktion (RT/PCR), die eine DNA-Polymerase der vorliegenden Erfindung und eine DNA-Polymerase, die für PCR geeignet ist, im selben Reaktionsgefäß nutzt. Bevorzugt stammt die DNA-Polymerase der vorliegenden Erfindung von Thermoanaerobacter thermohydrosulfuricus, sind bei der Polymerase eine oder mehrere Aminosäuren vom Amino-Terminus gelöscht sind oder Aminosäure-Änderungen vorhanden sind, um die Exonuclease-Aktivität zu entfernen, und ist die DNA-Polymerase, die für PCR geeignet ist, die Taq-DNA-Polymerase. In einem anderen Aspekt bietet die vorliegende Erfindung einen Kit oder eine Lösung für RT/PCR, umfassend eine DNA-Polymerase der vorliegenden Erfindung und eine DNA-Polymerase, die für PCR geeignet ist. Bevorzugt stammt die DNA-Polymerase der vorliegenden Erfindung von Thermoanaerobacter thermohydrosulfuricus, ist bei der Polymerase eine oder mehrere Aminosäuren von Amino-Terminus gelöscht oder sind Aminosäure-Änderungen vorhanden, um die Exonuclease-Funktion zu entfernen, und ist die DNA-Polymerase, die für PCR geeignet ist, die Taq-DNA-Polymerase.

In einer weiteren bevorzugten Ausführungsform bietet die Erfindung Polymerasen, bei denen die Exonuclease-Aktivität durch Austauschen eines Asparaginsäure-Restes in Position 8 mit einem Alanin-Rest entfernt ist. Dies ist eine bevorzugte Mutation, da sie nicht nur die Exonuclease-Aktivität entfernt, sondern auch die RNaseH-Aktivität entfernt, die die Reverse Transkription beeinflussen können.

In einem anderen Aspekt bietet die Erfindung ein Verfahren zur Polymerasekettenreaktion bei Vorhandensein eines Polymerase-stabilisierenden Mittels, unter Einsetzen einer enzymatisch aktiven DNA-Polymerase mit mindestens 80% Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus und bei der die Exonuclease-Aktivität entfernt ist. Die Polymerase-stabilisierenden Mittel umfassen, sind aber nicht beschränkt auf Glycerol (10 bis 50% Endkonzentration), Trimethylamin-N-oxid (TMANO; bis zu 4 M Endkonzentration), und N-Methylmorpholin-N-Oxid (MMO; bis zu 3 M Endkonzentration). Bevorzugt wird Glycerol bei einer Endkonzentration von 30% verwendet. Mit dem Polymerase-stabilisierenden Mittel ist ein Mittel gemeint, das die Verwendung der Polymerase in PCR und RT/PCR ermöglicht. Diese Mittel verringern die denaturierende Temperatur der Matrize und stabilisieren die Polymerase. Mit Stabilisieren ist gemeint, temperaturstabil machen. Mit Endkonzentration ist die Endkonzentration des Mittels in der PCR- oder RT/PCR-Lösung gemeint.

Die Erfindung bietet auch Kits, mit Polymerase-stabilisierenden Mitteln, für die Polymerasekettenreaktion, die eine enzymatisch aktive DNA-Polymerase mit mindestens 80% Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus aufweist und deren Exonuclease-Aktivität entfernt ist. Die Polymerase-stabilisierenden Mittel umfassen, sind aber nicht beschränkt auf, Glycerol (10 bis 50% Endkonzentration), TMANO (bis zu 4 M Endkonzentration) und MMO (bis zu 3 M Endkonzentration). Bevorzugt wird Glycerol bei einer Endkonzentration von 30% verwendet. Auch sind Lösungen zur Verwendung in der Polymerasekettenreaktion umfasst, die Polymerase-stabilisierende Mittel aufweisen, einschließlich, aber nicht beschränkt auf Glycerol (10 bis 50% Endkonzentration), TMANO (bis zu 4 M Endkonzentration) und MMO (bis zu 3 M Endkonzentration) und eine enzymatisch aktive DNA-Polymerase mit mindestens 80 % Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus und deren Exonuclease-Aktivität entfernt ist. Bevorzugt wird Glycerol bei einer Endkonzentration von 30% verwendet.

In bevorzugten Ausführungsformen ist die Exonuclease-Aktivität durch eine N-terminale Deletion entfernt, um zwischen 540 und 582 Aminosäuren zu ergeben, durch Deletieren bis zu einem Drittel der Aminosäuresequenz am N-Terminus, durch Substitution einer Aminosäure im Amino-Terminus zu einem Drittel des Proteins, oder durch Substitution des Asparaginsäure-Restes in Position 8 mit einem Alanin-Rest und die Glycerol-Konzentration beträgt 30%.

Die Anmelder haben erkannt, dass die DNA-Polymerasen der vorliegenden Erfindung verwendet werden können, um die Polymerasekettenreaktion (PCR) auszuführen, wenn die Reaktion bei Vorhandensein eines Polymerase-stabilisierenden Mittels, wie Glycerol, TMANO oder MMO und dergleichen, ausgeführt wird. Bevorzugt liegt die Glycerolkonzentration im Bereich von 10 bis 50% und am meisten bevorzugt liegt sie bei einer Endkonzentration von 30%. TMANO und MMO können bei Konzentrationen bis zu 4 M bzw. 3 M Endkonzentration verwendet werden. Es wurde gezeigt, dass diese Mittel die Polymerase von Thermoanaerobacter thermohydrosulfuricus stabilisieren (hier und US Patentanmeldung Nr. 08/766,014, eingereicht 13. Dezember 1996, supra). So sind die Polymerasen der vorliegenden Erfindung auch für Reverse Transkription/Polymerasekettenreaktion (RT/PCR) unter diesen Bedingungen geeignet.

Daher bietet in einem anderen Aspekt die Erfindung ein Verfahren für Reverse Transkription/Polymerasekettenreaktion, bei Vorhandensein eines Polymerase-stabilisierenden Mittels, unter Einsetzen einer enzymatisch aktiven DNA-Polymerase mit mindestens 80% Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus und bei der eine Exonucleaseaktivität entfernt ist. In bevorzugten Ausführungsformen umfassen die Polymerase-stabilisierenden Mittel, sind aber nicht beschränkt auf, Glycerol (10 bis 50% Endkonzentration), TMANO (bis zu 4 M Endkonzentration) und MMO (bis zu 3 M Endkonzentration). Bevorzugt wird Glycerol bei einer Endkonzentration von 30% verwendet.

Die Erfindung bietet auch Kits für Reverse Transkription/Polymerasekettenreaktion, mit einem Polymerase-stabilisierenden Mittel und aufweisend eine enzymatisch aktive DNA-Polymerase mit mindestens 80% Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus und bei der eine Exonucleaseaktivität entfernt ist. Auch umfasst sind Lösungen zur Verwendung in der Reversen Transkription/Polymerasekettenreaktion, umfassend ein Polymerase-stabilisierendes Mittel und eine enzymatisch aktive DNA-Polymerase mit mindestens 80% Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus und bei der eine Exonucleaseaktivität entfernt ist. In bevorzugten Ausführungsformen umfassen die Polymerase-stabilisierenden Mittel, sind aber nicht beschränkt auf, Glycerol (10 bis 50% Endkonzentration), TMANO (bis zu 4 M Endkonzentration) und MMO (bis zu 3 M Endkonzentration). Bevorzugt wird Glycerol bei einer Endkonzentration von 30% verwendet.

In bevorzugten Ausführungsformen wird die Exonuclease-Aktivität entfernt durch Vorsehen einer N-terminalen Deletion, um zwischen 540 bis 582 Aminosäuren zu ergeben, durch Deletieren bis zu einem Drittel der Aminosäuresequenz am N-Terminus, durch Substitution einer Aminosäure im Amine-Terminus zu einem Drittel des Proteins, durch Substitution des Asparaginsäure-Restes in Position 8 mit einem Alanin-Rest und die Glycerolkonzentration beträgt 30%.

Andere Merkmale und Zweckmäßigkeiten der Erfindung werden von der folgenden Beschreibung bevorzugter Ausführungsformen und von Ansprüchen offenbart.

Beschreibung bevorzugter Ausführungsformen

Die Zeichnungen werden zuerst kurz beschrieben.

Zeichnungen

1A–E ist die DNA-Sequenz für 5300 bp genomischer DNA, die die DNA-Polymerase voller Länge von Thermoanaerobacter thermohydrosulfuricus (SEQ. ID. Nr. 1) flankiert und kodiert.

2A–D ist ein zusammenhängender offener Leserahmen, der zum Kodieren der Polymerase voller Länge von Thermoanaerobacter thermohydrosulfuricus (SEQ. ID. Nr. 2) fähig ist. Die Translation erfolgt von einem offenen Leserahmen, der Nucleotide 1056–3674 genomischer DNA in 1A–E umspannt, die native Polymerase kodieren.

3 ist der zusammenhängende offene Leserahmen der Nucleotide 796–2616, Aminosäuren 266–872 plus ein Initiator-Methionin am Amino-Terminus, wobei die Exo-Mutante des Enzyms 608 Aminosäuren enthält (SEQ. ID. Nr. 3).

4A–C ist der zusammenhängende offene Leserahmen der F412Y-Mutation der exo-mutanten Polymerase, der 578 Aminosäuren enthält mit (SEQ. ID. Nr. 4). Bei Aminosäure 412 gibt es ein Tyrosin, das Phenylalanin ersetzt.

5 ist ein Schema von klonierten Polymerasen. Die Buchstaben A–D repräsentierten Startstellen der verschiedenen Konstrukte, die in der Tabelle in Beispiel 2 gezeigt sind.

6 ist eine grafische Darstellung, die die relative RT-Aktivität des Exo-Mutanten-Enzyms und anderer Enzyme, die eine Aktivität der Reversen Transkription besitzen, vergleicht. Die x-Achse zeigt die Polymerase an (MMLV, AMV, Tth, USB). Die y-Achse repräsentiert die Aktivität der Reversen Transkriptase in cpm.

7A–C ist die DNA-Sequenz, die eine native Polymerase voller Länge von Thermoanaerobacter thermohydrosulfuricus kodiert (SEQ. ID. Nr. 23).

Beispiele

Die folgenden Beispiele dienen zum Veranschaulichen der DNA-Polymerasen der vorliegenden Erfindung und sind nicht als beschränkend beabsichtigt.

Beispiel 1: Allgemeine Verfahren, die während der Reinigung und Charakterisierung verwendet werden Assay der DNA-Polymerase-Aktivität

Die DNA-Polymerase-Aktivität wurde untersucht durch Messen der Menge des Einbaus eines radiomarkierten Desoxynucleotids in Säure-fällbares Material unter Verwenden aktivierter Lachs-Sperma-DNA als eine Matrize (Richardson, C.C. (1966), DNA-Polymerase von Escherichia coli, Seiten 263–276 in G.L. Cantoni und D. R. Davies (Herausgeber), Precedures in nucleic acid research. Harper and Row, New York). Eine Einheit der DNA-Polymerase ist die Menge von Enzym, die den Einbau von 10 nmol Desoxynucleotidtriphosphat in Säure-fällbares Material in 30 min bei 70 °C einbaut. Ein Assay besteht aus 2–10 &mgr;l Proteinlösung, die DNA-Polymerase enthält, die mit 50 &mgr;l Assay-Mischung inkubiert wird (20 mM Tris HCl pH 8,5 bei Raumtemperatur, 200 &mgr;M von jedem Desoxynucleotidtriphosphat, 10 mM KCl, 5 mM MgCl2, 0,2 mg/ml aktivierte Lachs-Sperma-DNA, 1 &mgr;Ci 3000 Ci/mmol [&agr;-33P]dATP) bei 70 °C 10 min lang. Die Reaktion wird durch Zugeben der Inhalte des Assays in ein Röhrchen, das 1 ml von jedem Träger (50 &mgr;g/ml Fisch-Sperma-DNA, 2 mM EDTA) und Fällungsmittel (20 % (gew/v) Trichloressigsäure (2 % (gew/v) Natriumpyrophosphat) enthält, gestoppt. Nach der Inkubation auf Eis für mindestens 5 min wird die Lösung durch einen Glasfaserfilter (z.B. GF/B, Whatman) gefiltert, mit mehreren ml eiskalter Waschlösung (1 N-Salzsäure, 100 mM Natriumpyrophosphat) gewaschen, in ein Zählfläschchen mit wässrigem flüssigen Szintillations-Cocktail (z.B. Biosafe II, Research Products International Corp.) angeordnet und in einem Flüssigkeits-Szintillationszähler gezählt. DNA-Polymerase-Aktivität der Testlösung wird aus der gemessenen spezifischen Aktivität der Assay-Mischung berechnet. Nur Aktivitätswerte, die innerhalb des linearen Bereichs von 0,01 bis 0,2-Einheiten pro Assay-Reaktion liegen werden, werden als signifikant akzeptiert.

Messung der Proteinkonzentration

Lösungs-Protein-Konzentrationen werden spektrophotometrisch durch Bestimmen der Absorbanz der Testlösung bei einer Wellenlänge von 205 nm (A205) (Scopes, R.K. (1994), Seiten 46–48 Protein Purification. Springer-Verlag, New York) gemessen. Der Extinktionskoeffizient der Polypeptide wird als E205 (1 mg/ml) = 31 angenommen.

Assay der Exonuclease-Aktivität

Exonuclease-Aktivität wurde wie beschrieben gemessen (Kong, H., Kucera, R.B. und Jack, W.E. (1993) J. Biol. Chem. 268, 1965–1975) unter Verwenden, als ein Substrat, HindIII-verdauter Phagen&lgr;-DNA, markiert mit 3H durch die Wirkung von CpG-Methylase oder einem 500 bp PCR-Produkt, hergestellt aus pBR322 und markiert mit 3H durch Einbau von tritiierter TTP Exonuclease-Assays wurden im selben Puffer ausgeführt (20 mM Tris&bullopr;HCl pH 8,5 bei Raumtemperatur, 10 mM KCl, 5 mM MgCl2) und bei derselben Temperatur (70 °C) wie Polymerase-Assays.

Assay für das Gerichtetsein der Exonuclease

Das Gerichtetsein der damit verbundenen Exonuclease-Aktivität wurde durch Überwachen der zeitabhängigen Freisetzung von Radioaktivität von einem DNA-Substrat bestimmt, das differentiell an den 5'- und 3'-Enden, wie beschrieben, markiert war (Kong et al., supra).

Assay für die Strang-Verdrängungs-Aktivität

Ein Verlängerungs-Assay wurde entwickelt, um Polymerasen auf ihre Nützlichkeit in der SDA (Strang-Verdrängungs-Amplifikations-)Reaktion zu bewerten (Becton-Dickinson). Diese Verlängerungsreaktion testet die Fähigkeit der Polymerase, einen Stromabwärtsstrang zu ersetzen, und seine Fähigkeit, die Verlängerung an einer Nick-Stelle zu initiieren. Diese Verdrängung und Initiierung an einem Nick wird durch Assoziieren zweier Primer, die an ihren 5'-Enden markiert sind, unmittelbar benachbart zueinander initiiert. Falls die Polymerase eine Strang-Verdrängungs-Aktivität besitzt und fähig ist, an einem Nick zu initiieren, werden beide Primer verlängert und die zwei Verlängerungsprodukte können sichtbar gemacht werden. Falls die Polymerase nicht an einem Nick initiieren kann (d.h. eine Präferenz für die Initiierung an einer Lücke besitzt) oder ihr eine Verdrängungs-Aktivität mangelt, wird nur der Stromabwärts-Primer verlängert und nur ein Produkt wird detektiert.

Unter Verwenden des Plasmids pBR322 als das Ziel, wurden zwei Primer pBR1 und pBR2 synthetisiert, die unmittelbar benachbart zueinander auf dem Plasmid assoziieren. Primer pBR1 ist der Stromaufwärts-Primer und entspricht Basen 3661 bis 3690 in pBR322 (GGTTCCCAACGATCAAGGCGAGTTACATGA) (SEQ. ID. Nr. 5). Der Primer pBR2 assoziiert stromabwärts und entspricht pBR322 3691–3720 (TCCCCCATGTTG TGCAAAAAAGCGGTTAGC) (SEQ. ID. Nr. 6). Diese 30mer-Oligos wurden durch Elektroelution von einem denaturierenden Polyacrylamidgel gereinigt. Die Primer werden in einer Kinasereaktion unter Verwenden von 10 &mgr;M-Primer, 50 mM Tris&bullopr;HCl pH 7,5, 10 mM MgCl2, 70 &mgr;Ci [&ggr;-32P]-ATP und 10 Einheiten T4-Polynucleotidkinase 30 min lang bei 37 °C markiert. Eine Endkonzentration von 0,2 &mgr;M (jeweils) dieser zwei markierten Primer werden mit 200 ng PstI/HincIIverdautem pBR322 kombiniert. Diese werden bei 98 °C 3 min lang in einem Puffer denaturiert, der 25 nm Kaliumphosphat, pH 7,4, 2–8 mM MgCl2, 0,2 bis 1 mM dNTPs enthält und auf die Reaktionstemperatur (50–70 °C) 2 min lang gekühlt. Eine Einheit der Polymerase wird zugegeben und die Reaktion wird 10 min lang fortgesetzt. Die Reaktionen werden durch Zugabe eines äquivalenten Volumens von 95 % Formamid, 50 mM EDTA, Bromphenolblau-Farbstoff gestoppt. 25 &mgr;l werden über einem 6 % denaturierendem Gel elektrophoretisiert und das Gel wird einem Autoradiographie-Film ausgesetzt.

Beispiel 2: Reinigung nativen Enzyms Roh-Reinigung Wachstum von Thermoanaerobacter-thermohydrosulfuricus-Zellen

Eine lyophilisierte Kultur des Thermoanaerobacter-thermohydrosulfuricus-Stranges JW102 wurde von der Deutschen Sammlung von Mikroorganismen und Zellkulturen, GmbH (DSM) erworben. Das verwendete Wachstumsmedium war Clostridium Thermohydrosulfuricum Medium (Medium #61 im DSM-Katalog der Stränge (1993-Ausgabe), das aus (pro l) bestand: 10 g Trypton, 10 g Saccharose, 2 g Hefe-Extrakt, 0,2 g FeSO47H2O, 0,2 g Na2SO3, 0,08 g Na2S2O3&bullopr;5H2O und 1 mg Resazurin. Die Kultur wurde bei 70 °C unter anaeroben Bedingungen gezogen. Nach dem Wachstum wurde das Medium auf annähernd Raumtemperatur gekühlt und die Kultur durch Continuous-Flow-Zentrifugation geerntet. Die Zellpaste wurde bei –80 °C vor nachfolgenden Prozeduren gelagert.

Herstellung des Extraktes

Gefrorene Zellpaste (5 Gramm) wurde mit 100 ml Puffer A (50 mM Tris-HCl pH 8,0, 10 mM NaCl, 1 mM DTT, 1 mM EDTA, 10 % (gew/v) Glycerol) vermischt. Die Paste wurde bei Raumtemperatur gerührt bis die Resuspendierung abgeschlossen war. Die resultierende Zellsuspension wurde auf 0 °C durch Inkubation in einem Eisbad gekühlt und annähernd 5 min lang einer Beschallung unterzogen, um die Zellen zu lysieren. Zelltrümmer wurden durch Zentrifugation bei 70.000 × g 20 min lang bei 4 °C entfernt. Das überstehende geklärte Lysat wurde Fraktion 1 genannt.

Flüssigkeitschromatographie-Reinigung

Fraktion 1 wurde auf einer Niederdruck-Flüssigkeitschromatographie-Säule (70 ml Bettenvolumen, 26 mm ∅) aus DEAE-Zellulose (DE-52 Whatman) equilibriert mit Puffer A geladen. Die Säule wurde mit mehreren Säulenvolumina Puffer A gewaschen und die DNA-Polymerase mit einem linearen Salzgradienten von 10 mM bis 1.000 mM NaCl in Puffer A mit einer Fließgeschwindigkeit von 0,9 ml/min eluiert. Dies und all die nachfolgenden Chromatographie-Schritte wurden bei einer Umgebungs-Raumtemperatur (annähernd 25 °C) ausgeführt. Der Peak der Aktivität eluierte bei annähernd 32 mM NaCl. Aktive Fraktionen wurden gesammelt und als Fraktion 2 bezeichnet.

Fraktion 2 wurde direkt auf eine Säule (22 ml Bettenvolumen, 16 mm ∅) aus Heparinsepharose (Heparin Sepharose CL-6B, Pharmacia), equilibriert mit Puffer A geladen. Die Säule wurde mit mehreren Säulenvolumina Puffer A gewaschen und die DNA-Polymerase-Aktivität mit einem linearen Salzgradienten von 10 mM bis 700 mM NaCl in Puffer A mit einer Fließgeschwindigkeit von 0,4 ml/min eluiert. Der Peak der Aktivität eluierte bei annähernd 400 mM NaCl. Aktive Fraktionen wurden gesammelt und als Fraktion 3 bezeichnet.

Fraktion 3 wurde direkt auf eine Säule (2 ml Bettenvolumen, 16 mm ∅) aus Hydroxylapatit (BioGel HA, Bio-Rad), equilibriert mit Puffer B (50 mM Kaliumphosphat, pH 7,4, 1 mM DTT, 10 % (gew/v) Glycerol) geladen. Die Säule wurde mit mehreren Säulenvolumina Puffer B gewaschen und die DNA-Polymerase mit einem linearen Gradienten von 50 mM bis 700 mM Kaliumphosphat in Puffer A bei einer Fließgeschwindigkeit von 0,4 ml/min eluiert. Die DNA-Polymeraseenthaltenden Fraktionen wurden gesammelt und durch Ultrafiltration (Centricon-50, Amicon) auf ein Volumen von 100 ml konzentriert, zu dem 100 ml 100 %-iger Glycerol gegeben wurde, um das Endprodukt zu erhalten. Es wurde bestimmt, dass dieses Endpräparat ungefähr 1.000 Einheiten DNA-Polymerase enthält, was als annähernd 80 % rein auf einem Coomassie-gefärbten, denaturierenden Polyacrylamidgel (SDS-PAGE) beurteilt wurde.

Optimierte Reinigung Herstellung des Extraktes

Gefrorene Zellpaste (45 Gramm) wurde in 250 ml Lysepuffer (50 mM Tris-HCl, pH 8, 10 mM NaCl, 5 mM EDTA, 0,2 % (v/v) NP40, 1 mM DTT) resuspendiert. Lysozym wurde auf 200 mg/ml Endkonzentration zugegeben und die Lösung wurde bei Raumtemperatur 60 min lang gerührt. DNase I wurde zu 10 mg/ml Endkonzentration gegeben und die Inkubation wurde 10 min lang fortgesetzt. Unlösliches Material wurde durch Ultrazentrifugation bei 70.000 × g 40 min lang entfernt. Der dekantierte Überstand wird Fraktion I bezeichnet.

Polyethylenimin-Präzipation

Ein Probe-Polyethylenimin-(PFI)-Präzipitatinns-Experiment wurde ausgeführt, um die End-PEI-Konzentration für dieses Lysat zu bestimmen und die gesamte Polymeraseaktivität mit dem am wenigsten co-präzipitierenden Proteingehalt zu präzipitieren. PEI wurde von einer 10 %-igen (v/v) Stammlösung zu Fraktion I auf eine 0,4 %-ige Endkonzentration gegeben. Die Lösung wurde 20 min lang bei 4 °C gerührt. Das PEI-Präzipitat wurde durch Zentrifugation bei 8.000 × g 20 min lang gesammelt. Die Polymerase-Aktivität wurde aus dem Pellet mit 150 ml 300 mM NaCl in Puffer A extrahiert (50 mM Tris-HCl, pH 8, 1 mM DTT, 1 mM EDTA und 10 Glycerol). Diese Lösung wurde wieder bei 17.000 × g zentrifugiert. Ammoniumsulfat wurde zu dem Überstand auf eine 80 %-ige Sättigung gegeben und die Lösung wurde 1 Stunde bei 4 °C gerührt, um Proteine von restlichem PEI zu präzipitieren. Die Ammoniumsulfatfraktion wurde bei 48.000 × g 30 min lang zentrifugiert und das Pellet in 400 ml 10 mM NaCl, 50 mM Tri&bullopr;HCl, pH 8 resuspendiert. Dies wird Fraktion II bezeichnet.

Flüssigkeitschromatographie-Reinigung

Eine Säule (150 ml Bettenvolumen) aus Heparin-Sepharose CI-6B (Pharmacia) wurde mit 150 mM NaCl im Puffer A equilibriert. Die Fraktion II wurde bei 150 ml/h geladen und mit zwei Bettvolumina-Puffer A gewaschen. Die Polymerase-Aktivität wurde dann mit einem linearen Gradienten von 150 mM bis 700 mM NaCl im Puffer A eluiert, was einen Polymerase-Peak bei ungefähr 400 mM NaCl ergab. Die Peak-Fraktionen wurden gesammelt und 5-fach mit 100 mM NaCl im Puffer B verdünnt (50 mM Tris-HCl, pH 7,5, 0,1 mM DTT, 1 mM EDTA und 5 % Glycerol). Dieser Pool wird Fraktion III bezeichnet.

Eine Säule (4 ml Bettvolumen) aus ssDNA-Agarose (Pharmacia) wurde mit 100 mM NaCl im Puffer B equilibriert. Ein Drittel der Fraktion III wurde bei einer Fließgeschwindigkeit von 12 ml/h geladen. Die Säule wurde mit demselben Puffer gewaschen und die Polymerase-Aktivität mit einem linearen Gradienten von 100 mM bis 1.000 mM NaCl im Puffer B eluiert. Der Polymerase-Aktivitäts-Peak eluierte bei annähernd 375 mM NaCl. Die Peak-Fraktionen wurden gesammelt und mit Centricon-50 (Amicon) konzentriert und durch Zugeben eines gleichen Volumens 100 %-igem Glycerol gelagert.

Herstellung des Exo-Enzyms durch Subtilisin-Spaltung

Annähernd 850 Einheiten gereinigter nativer Thermoanaerobacter-thermohydrosulfuricus-DNA-Polymerase I wurde in 150 mM Kaliumphosphat pH 6,5 durch drei Runden der Verdünnung in diesem Puffer und Konzentration durch Ultrafiltration ausgetauscht, was eine Lösung ergab, die ungefähr 250 mg Protein in 550 &mgr;l enthielt. Subtilisin (10 &mgr;l einer 0,06 mg/ml Lösung) wurde zu der Polymerase gegeben und die Mischung bei 37 °C eine Stunde lang inkubiert. Nach der Inkubation wurde die Reaktion auf 10 ml Endvolumen mit Puffer A verdünnt und auf eine Säule Neparin-Sepharose geladen (4 ml Bettvolumen, 16 mm ∅), in Puffer A equilibriert, der 150 mM NaCl enthielt. Die Säule wurde in mehreren Säulenvolumina dieses Puffers gewaschen und die Polymerase-Aktivität mit einem linearen Gradienten von 150 mM bis 700 mM NaCl im Puffer A eluiert. Aktive Fraktionen wurden gesammelt.

Beispiel 3: Charakterisierung des nativen Enzyms Allgemeine Eigenschaften

Das native Enzym wandert als ein annähernd 90.000 Da-Polypeptid (gerade unterhalb der Phosphorylase B) auf SDS-PAGE. Das Enzym besitzt Strang-Verdrängungs-Aktivität. Es besitzt eine 5'-3'-Exonuclease-Aktivität bei annähernd 1/80 des Niveaus der Polymerase-Aktivität (Einheit:Einheit). Das Temperaturoptimum der DNA-Synthese liegt nahe 75 °C unter Assay-Bedingungen. Die optimale Mg2+-Konzentration des DNA-Synthese beträgt 1 mM. Die optimale Mn2+-Konzentration der DNA-Synthese beträgt 0,5 mM.

Assay auf Wärmestabilität

Um die Wärmestabilität des Enzyms zu bewerten, wurde eine Probe nativer Thermoanaerobacter-thermohydrosulfuricus-DNA-Polymerase bei erhöhten Temperaturen in mehreren Puffern inkubiert. Die Puffer bestanden alle aus 25 mM Tris-HCl, pH 8,5, 50 mM KCl, 5 mM MgCl2, 1 mM 2-Mercaptoethanol, 0,5 % (gew./v) Nonidet P-40 und 100 mg/ml BSA mit den folgenden Zugaben: BSA-Puffer: keine Zugaben. GLY-Puffer: gebe Glycerol auf 40 % (v/v) zu. MMO-Puffer: gebe N-Methylmorpholin-N-oxid (MMO) auf 3 M zu. TMANO-Puffer: gebe Trimethylamin-N-oxid (TMANO) auf 4 M zu.

Natives Enzym (0,02 Einheiten/&mgr;l) wurde in diesen Puffern bei verschiedenen Temperaturen inkubiert. Nach 5, 10 und 15 Minuten wurden 5 &mgr;l aliquote Mengen entzogen und in einem frischen Röhrchen auf Eis angeordnet. Wenn alle Proben aufgenommen waren, wurden die erwärmten aliquoten Mengen in der üblichen Weise einem Assay unterzogen. Die Ergebnisse sind ausgedrückt als der Bruchteil der Aktivität, die bei einem gegebenen Zeitpunkt bei einer gegebenen Temperatur verbleibt.

Das Enzym war am wenigsten stabil im BSA-Puffer, und behielt die Hälfte der anfänglich gemessenen Polymerase-Aktivität nach ungefähr 5 min bei 85 °C. Im GLY-Puffer behielt das Enzym die Hälfte der anfänglichen Aktivität nach ungefähr 5 min bei 85 °C. In MMO- und TMANO-Puffern war eine Inkubation bei 85 bis 90 °C erforderlich, um die Hälfte der anfänglich gemessenen Aktivität in 5 min zu eliminieren. Die Inkubation in irgendeinem dieser Puffer bei 75 °C für 15 min resultierte in nicht mehr als 20 % Verlust der anfänglichen DNA-Polymerase-Aktivität.

Beispiel 4: Charakterisierung des Subtilisin-gespaltenen Enzyms Allgemeine Eigenschaften

Das gespaltene Enzym wandert als ein Dublett, das aus Polypeptiden besteht, die bei annähernd 64 kDa und 55 kDa auf SDS-PAGE wanderten. Es ist frei von detektierbarer Exonuclease-Aktivität. Das Enzym besitzt Strang-Verdrängungs-Aktivität. Das Enzym besitzt eine dem nativen Enzym ähnliche Wärmestabilität.

Beispiel 5: Herstellung des klonierten 64 kDa-Enzyms Herstellung genomischer DNA

Gefrorene Zellpaste von Thermoanaerobacter thermohydrosulfuricus (annähernd 350 mg) wurde in 700 &mgr;l Lysis-Puffer (50 mM Tris&bullopr;HCl pH 8,0, 50 mM EDTA, 3 SDS (gew/v), 1 % 2-Mercaptoethanol (v/v) resuspendiert und 1 Stunde lang bei 65 °C inkubiert. Diese Lösung wurde dreimal mit 25:24:1 Phenol:Chloroform:Isoamylalkohol extrahiert, zweimal mit Chloroform und präzipitiert mit zwei Volumina 100 %-igem Ethanol. Das Pellet wurde kurz in vacuo getrocknet und in 700 &mgr;l TE (10 mM Tris-HCl, pH 8,0, 1 mM EDTA) aufgelöst. Die Konzentration genomischer DNA wurde spektrophotometrisch bestimmt durch Messen der Absorbanz bei 260 nm (1A260 = 50 &mgr;g/ml) und durch Vergleich der UV-Fluoreszenz von Bändern auf einem mit Ethidiumbromid gefärbten Agarosegel, im Vergleich zu Standard-Konzentrations-Marker.

Herstellung einer DNA-Polymerase I-spezifischen Sonde

Genomische DNA wurde als ein Substrat für eine PCR-Reaktion verwendet, unter Verwenden von degeneriertem Oligonucleotiden, die gegen konservierte Bereiche der DNA-Polymerase I-Familie-Polymerasen entworfen sind (Uemori, T., Ishino, Y., Fujita, K., Asada, K. und Kato, I. (1993) J. Biochem. 113, 401–410). Eine Standard-Taq PCR-Reaktion (20 &mgr;l) enthielt ungefähr 1 ng genomischer DNA und 1 mM von jedem Primer EPOLF (GACCC(ATC)AAC(CT)T(CG)CA(AG)A A(CT)AT(ATC)CC (SEQ. ID. Nr. 7) und EPOLR ((GT)A(CG)(CG)A(GT) (CT)TC(AG) TCGTG (GATC) AC (CT) TG) (SEQ. ID. Nr. 8). Nach einer Runde PCR wurde das Produkt auf einem Agarosegel getrennt. Das Produkt um den erwartenden 600 bp-Bereich wurde aus dem Gel ausgeschritten. zerbrochen, in TE getränkt und als ein Substrat für eine zweite Runde PCR unter Verwenden derselben Bedingungen verwendet. Das resultierende ca. 600 bp-Produkt wurde direkt sequenziert unter Verwenden der EPOLF und EPOLR-Primer (Sequenase PCR Product Sequencing Kit, Amersham). Es wurde gefunden, dass ein offener Leserahmen dem Zielbereich der DNA-Polymerasen I bekannter Sequenz homolog ist, wie durch BLAST-Analyse beurteilt wurde.

Herstellung subgenomischer Bibliotheken und Screening

Dieses PCR-Produkt wurde unter Verwenden eines radioaktiven oder nichtradioaktiven Hybridisierungskits markiert (Gene Images, USB) und verwendet, um Blots von Agarosegels genomischer DNA, die mit verschiedenen Restriktionsenzymen verdaut war, zu untersuchen. Das Verdauen genomischer DNA mit HindIII erzeugte ein einziges Hybridisierungsfragment von annähernd 1,7 kb. DNA-Fragmente von annähernd 1,7 kb wurden aus einem Agarosegel ausgeschnitten und in pBluescript II KS (+) (Stratagene) kloniert. Individuelle Kolonien, die an die Sonde hybridisierten, wurden gereinigt und sequenziert. Auf ähnliche Weise erzeugte ein doppeltes Verdauen von genomischer Thermoanaerobacter-thermohydrosulfuricus-DNA mit EcoRI und XhoI ein einziges Hybridisierungsfragment von annähernd 1,9 kb und Verdauen mit EcoRI erzeugte ein einziges Hybridisierungsfragment von annähernd 3 kb. Die Sequenzen dieser Klone wurden verschmolzen und bildeten einen kohärenten offenen Leserahmen, der eine hohe Homologie zu dem C-Terminusabschnitt-DNA-Polymerasen i bekannter Sequenz besaß, wie durch BLAST-Analyse beurteilt. Der Klon, der das 1,7 kb HindIII-Fragment enthielt, wurde mit EcoRI und XhoI verdaut, um ein 1,4 kb-Fragment zu erzeugen, das mit einem Gel gereinigt wurde, durch Nick-Translation mit 32P markiert wurde und verwendet wurde, um einen Blot von genomischer Thermoanaerobacter-thermohydrosulfuricus-DNA. verdaut mit PsfI und XhoI, zu untersuchen. Dies identifizierte ein einziges Hybridisierungsfragment von 3 kb, das den verbleibenden N-Terminusabschnitt des Gens enthielt. Die Nucleotidsequenz ist in 1A–E (SEO. ID. Nr. 1) dargestellt und ein fortlaufender offener Leserahmen, der möglicherweise die native Polymerase kodiert, ist in 2A–D präsentiert (SEQ. ID. Nr. 2).

Herstellung von Expressionsvektoren

Mehrere PCR-Produkte wurden aus der genomischen DNA erzeugt, die das Klonieren von Abschnitten der Polymerase-kodierenden Sequenz, die nicht die 5'-3'-Exonucleasedomäne umfasst, ermöglichte (siehe 5). Die Buchstaben A–D repräsentieren Startstellen der verschiedenen Konstrukte, die unten in der Tabelle dargelegt sind. Diese abgeschnittenen Polymerase-kodierenden Sequenzen wurden unter der Steuerung des &lgr;PL-Promotors des Expressionsvektors pRE2 platziert (Reddy, P., Peterkofsky, A. und McKenney, K. (1989) Nucleic Acids Res. 17, 10473–10488). Diese Vektoren wurden im E.coli-Strang DH-1&lgr;+(&lgr;cl+) vermehrt.

Um Fehler, die durch Taq-DNA-Polymerase in PCR eingeführt wurden, zu minimieren, wurde eine modifizierte lange PCR ausgeführt. Die PCR-Reaktion enthielt: 20 mM Tricin (pH 8,8), 85 mM KOAc, 200 mM von jeder dNTP, 5 % DMSO, 0,5 mM von jedem Primer, 1,5 mM MgOAc (zugegeben als Hot-Start), 2,5 Einheiten Hot Tub (oder rTth)-DNA-Polymerase pro 100 ml Reaktion (Amersham), 0,025 U Deep Vent DNA-(New England Biolabs)-Polymerase pro 100 &mgr;l Reaktion, 20–100 ng genomischer Thermoanaerobacter-thermohydrosulfuricus-DNA pro 100 &mgr;l Reaktion. Die Cycling-Parameter bestanden aus: 94 °C 30 s, dann 68 °C 10 m 40 s × 8 Zyklen; 94 °C 30 s, dann 68 °C 12 m 00 s × 8 Zyklen; 94 °C 30 s, dann 68 °C 13 m 20 × 8 Zyklen; 94 °C 30 s, dann 68 °C 14 m 40 s × 8 Zyklen.

Alle PCR-Produkte wurden mit dem reversen Primer DDREV(GGGGTACCT CTAGATCACTTGGCCAAAAACCA) (SEQ. ID. Nr. 9) am 3'-Ende und verschiedenen Primern, die am 5'-Ende eingesetzt wurden, erzeugt:

Die resultierenden PCR-Produkte wurden mit NdeI und KpnI verdaut und in pRE2, verdaut mit denselben Restriktionsenzymen, kloniert.

Stumme Änderungen (siehe Tabelle unten) zeigen an, dass der 5'-Primer einige Codons kodiert, die mit den nativen Sequenzen synonym sind, aber häufiger durch E.coli eingesetzt werden. Durch dieses Verfahren wurden sechs verschiedene Klone konstruiert, die verschiedene Polypeptide kodieren.

Expression eines klonierten 64 kDa-Enzyms

E.coli-Strang MZ-1 (cl857 Lysogen), der das Plasmid pRED6404 beherbergt, wurde in LB-Medium (pro I: 10 g Trypton, 5 g Hefeextrakt, 10 g NaCl), ergänzt mit 50 &mgr;g/ml Ampicillin kultiviert. Die Kultivierung wurde bei 30–32 °C gezogen, bis der OD600 1,5 erreichte, wobei bei diesem Zeitpunkt die Kulturtemperatur auf 40–42 °C erhöht war. Das Wachstum dauerte bei dieser Temperatur 2 Stunden lang an, bevor die Kultur in einer Continuous-Flow-Zentrifuge geerntet wurde. Die Zellpaste wurde bei –80 °C vor nachfolgenden Prozeduren gelagert.

Beispiel 6: Herstellung eines klonierten Enzyms voller Länge

Das Enzym voller Länge wurde durch PCR von dem Klon genomischer DNA (SEQ. ID. Nr. 1) (1A–E) kloniert. Ein 5'-Primer DDF-FOR(GGAATTCCATATGGCTTAT-AAATTTTTAATCATTGATGGTAGTAGC) (SEQ. ID. Nr. 24) wurde synthetisiert. Dieser Primer kodiert an einer NdeI-Stelle, setzt ein Alanin-Codon nach dem initiierenden Methionin ein und ändert zwei Codons zu synonymen Codons, die von E.coli bevorzugt werden (ATA → ATC, Ile an aa-Position 6 und GGA → GGT, Gly an aa-Position 9). Dieser Primer wurde im Zusammenhang mit einem Vektor-Primer von dem zusammengebauten Klon genomischer DNA verwendet, um ein PCR-Produkt zu erzeugen, das nachfolgend mit NdeI und XhoI verdaut und in ähnlich verdautes pRED6404 subkloniert wurde, um ein pLS-3 zu bilden. Die DNA für das Enzym voller Länge ist in 7A–C gezeigt (SEQ. ID. Nr. 23).

Beispiel 7: Reinigung des klonierten 64 kDa-Enzyms Herstellung eines Extraktes

Gefrorene Zellpaste (370 g) wurde mit 1800 ml Puffer A (50 mM Tris-HCl, pH 8,0, 10 mM NaCl, 1 mM DTT, 1 mM EDTA, 10 % (gew/v) Glycerol) kombiniert. Die Paste wurde bei Raumtemperatur gerührt, bis die Resuspension abgeschlossen war. Die Zellen wurden unter Verwenden einer French-Druckzelle lysiert. Zelltrümmer wurden durch Zentrifugation bei 70.000 × g 20 min lang bei 4 °C entfernt.

Flüssigkeitschromatographie-Reinigung

Das geklärte Lysat ließ man durch eine Säule aus DEAE-Zellulose bei 300 mM Salz laufen. Der gesammelte Durchfluss wurde auf 70 °C 10 min lang erwärmt, wieder durch Zentrifugation geklärt und auf eine Säule aus Heparin-Sepharose geladen. Die DNA-Polymerase wurde aus dieser Säule mit einem Salz-Gradienten wie zuvor eluiert und es wurde gefunden, dass sie in den meisten Fällen rein war. Falls nicht, wurde eine Säulen-Chromatographie auf Hydroxylapatit ausgeführt.

Beispiel 8: Charakterisierung des klonierten 64 kDa-Enzyms Allgemeine Eigenschaften

Das klonierte Enzym bezieht sich auf das gereinigte Genprodukt von pRED6404. Das klonierte Enzym wandert als ein annähernd 64.000 Da-Polypeptid (gerade unterhalb Kälberserum-Albumin, MW 67.000) auf SDS-PAGE. Die spezifische Aktivität des klonierten Enzyms beträgt 28.000 Einheiten/mg. Es ist frei von detektierbarer Exonuclease-Aktivität. Das Temperatur-Optimum der DNA-Synthese liegt nahe 72 °C unter Assay-Bedingungen. Die optimale Mg2+-Konzentration der DNA-Synthese beträgt 2 mM. Die optimale Mn2+-Konzentration der DNA-Synthese beträgt 0,7 mM.

Reverse-Transkriptase-Aktivität

Das klonierte Enzym funktionierte als eine Reverse Transkriptase in einem Assay. der poly(rA):oligo(dT12-18) und [3H]TTP bei 42 °C enthielt. Dieses Enzym besitzt eine RT-Aktivität bei Vorhandensein von Mg2+ mit oder ohne Zugabe von Mn2+.

Messung der Reverse-Transkriptase-Aktivitäten verschiedener Enzyme unter Verwenden eine SPA-Formates

Amersham's Reverse-Transkriptase-Scintillations-Proximity-Assay(SPA)-Kit NK9020), und MMLV(E70456)- und AMV-(E70041)-Enzyme wurden durch Amersham International geliefert. Das oben hergestellte klonierte 64 kD-Enzym wurde als USB-Enzym bezeichnet. Tth (N808-0098)-Enzym wurde von PerkinElmer erhalten.

MMLV- und AMV-Enzyme wurden bei 37 °C bzw. 42 °C bei Vorhandensein von Magnesium getestet. Die Tth- und USB-Enzyme wurden beide bei 60 °C verwendet, wobei Mangan als der Co-Faktor vorhanden war. Der verwendete Assay-Puffer war derselbe wie im SPA-Kit geliefert, mit Ausnahme, dass der geeignete Co-Faktor in der Puffer-Mischung ersetzt war. Im wesentlichen wurde der Assay wie folgt doppelt aufgebaut unter Verwenden des Protokolls, das im SPA-Kit geliefert wurde, in Sarstedt-Röhrchen in einem Gesamtreaktionsvolumen von 100 &mgr;l.

80 &mgr;l 0,77 &mgr;M [3H]TTP in einem Puffer, bestehend aus:

50 mM Tris&bullopr;HCl pH 8

80 mM KCl

10 mM MgCl2 oder 4 mM MnCl2

10 m M DTT

0, 05 % gew/v NP40

10 &mgr;l 0,2 &mgr;M Primer/Matrize (biotinyliertes (dT16)Oligonucleotid assoziiert an poly r(A)) in

10 mM Tris&bullopr;HCl pH 8

1 mM MgCl2

10 &mgr;l einer Einheit (wie definiert vom Hersteller) des Enzyms, das in 50 mM Tris-HCl, pH 8, 10 mM DTT aufgelöst war, wurde zu jedem Röhrchen zugegeben, um die Reaktion zu starten, und bei der angezeigten Temperatur 30 min lang inkubiert, wonach die Reaktion durch die Zugabe von 10 &mgr;l 0,56 M EDTA, pH 8 beendet wurde. 10 &mgr;l der gelieferten Streptavidin-SPA-Kügelchen wurden dann zu jedem Röhrchen gegeben, und nach dem Inkubieren für weitere 10 min bei Raumtemperatur wurden sie in einem LKB 1205-Scintillationszähler gezählt.

Geeignete Kontrollen ohne Enzyme wurden auch durchgeführt. Die erhaltenen Daten sind in 6 gezeigt. Dieses Experiment zieht nicht die Schmelztemperatur des in diesem Experiment verwendeten Primers in Betracht, die bei 60 °C theoretisch nur eine Minderheit des Primers zurücklassen würde, die noch an die Matrize assoziiert wird. Dies kann tatsächlich zu einer Unterbewertung der mit den USB- und Tth-Enzymen beobachteten Aktivität führen.

Verwendung der 64 kDa-Polymerase in Strang-Verdrängungs-Amplifikation

Die Exonuclease, der das oben beschriebene klonierte Enzym fehlte, wurde in einer Strang-Verdrängungs-Amplifikation(SDA)-Reaktion verwendet (Walker et al., (1992) Proc. Natl. Acad. Sci. USA 89:392–396). Die zu amplifizierende Ziel-DNA ist ein 1,2 kb-Klon des Insertionselements IS 6110 von Mycobacterium tuberculosis [GenBank accession No. M29899]. Die Ziel-DNA wird in pBluescript KS (Stratagene, La Jolla, CA) kloniert. Die Reaktionsmischung (Endkonzentration: 25 mM Kaliumphosphat, pH 7,4, 0,1 &mgr;g/ml BSA, 0,05 &mgr;M jedes Primers B1 (CGATCGAGCAAGCCA) (SEQ. ID. Nr. 16) und B2 (CGAGCCGCTCGCTGA) (SEQ. ID. Nr. 17), 0,5 &mgr;M jedes Primers S1.1 (ACCGCATCGAATGCATGT-CTCGGTAGGCG ACTCGACC) (SEQ. ID. Nr. 18) und S2.2 (CGATTCCGCTCAGACTTCTCGGGT TACTGAGATCCCT) (SEQ. ID. Nr. 19). 1.4 mM dCTP&agr;S, 0,5 mM von jedem dATP, dGTP und dCTP und 107 Kopien des Ziel-Plasmids) wurde auf 100 °C 3 min lang erwärmt, um das Ziel zu denaturieren und dann auf 55 °C gesetzt. Nach ungefähr 5 min bei 55 °C wurde die Enzymmischung zugegeben (Endkonzentrationen: 35 Einheiten 64 kD-Polymerase, 160 Einheiten BsoBI-Restriktionsenzym (New England Biolabs, Beverly, MA) und 6,9 mM MgCl2 (Gesamtreaktionsvolumen 50 &mgr;l) und die Inkubation wurde 10 min lang fortgesetzt. Ein gleiches Volumen von Stoplösung (95 % Formamid, 20 mM EDTA und 0,05 von jeweils Bromphenolblau und Xylene Cyanol FF) wurde zugegeben und 5 &mgr;l davon wurde auf einem 10 % denaturierendem Polyacrylamidgel elektrophoretisiert. DNA wurde sichtbar gemacht durch Färben mit Ethidiumbromid. Die 64 kDa-Polymerase erzeugte das erwartete Produkt einer vollen Länge von 105 Nucleotiden (Hauptprodukt) und das erwartete 86 Nucleotid-Nick-Produkt (Nebenprodukt).

Verwendung der 64 kDa-Polymerase in RT-PCT

Die 64kD-Polymerase wurde als eine Reverse Transkriptase zusammen mit AmpliTaq in RT-PCR verwendet.

Unter Verwenden von Kaninchen-Globin-mRNA als eine Matrize waren 106 Kopien unter dem folgenden Protokoll detektierbar. In einem Reaktionsvolumen von 100 &mgr;l wurden die folgenden Komponenten gesammelt: 1X PCR-Puffer (10mM Tris-HCl, pH 8,3, 50 mM KCl), 2 mM MgCl2, 200 &mgr;M jeweils dNTP, 100 U menschlicher placentaler RNAse-Inhibitor (Amersham), 106 Kopien von Kaninchen-Globin-mRNA (BRL), 30 pmol Globin-Abwärts-Primer (TCAGTGGTATTTGTGAGCCAGGGCA-TTGGCCACACCAGCCACCACCTTCT) (SEQ. ID. Nr. 25), 15 pmol Globin-Aufwärts-Primer (ATCCCCCAAAACAGACAGAATGGTGCATCTGTCC) (SEQ. ID. Nr. 26), 2,5 U AmpliTaq-Polymerase und 5 U 64 kD-Polymerase. Die Reaktion wurde bei 65 °C 30 min lang inkubiert, gefolgt von 5 min bei 95 °C, 35 Zyklen von (95 °C für 1 min, 65 °C für 1 min, 70 °C für 2 min), gefolgt von 72 °C für 5 min. Das Produkt wurde auf einem 2 % Ethidiumbromid-gefärbtem Agarosegel aufgelöst und das erwartete 463 bp-Produkt wurde beobachtet.

Unter Verwenden der gesamten RNA von einer Rattenleber wurde ein RT-PCT-Produkt vom Albumingen von 250 ng Matrize unter Verwenden des folgenden Protokolls detektiert. In einem Reaktionsvolumen von 100 &mgr;l wurden die folgenden Komponenten gesammelt: 1XPCR-Puffer (10 mM Tris-HCl, pH 8,3, 50 mM KCl), 2 mM MgCl2, 200 &mgr;M jeweils dNTP, 100 U menschlicher placentaler RNAse-Inhibitor (Amersham), 250 ng Rattenleber RNA, 30 pmol Albumin-Abwärts-Primer (GTT CTCCTGGAAGGAGGTGCACATGGCCTC) (SEQ. ID. Nr. 27), 15 pmol Albumin-Aufwärts-Primer (CACACAAGAGTGAGATCGCCCATCGGTTTAAGGA) (SEQ. ID. Nr. 28), 2,5 U AmpliTaq-Polymerase und 40 U 64 kD-Polymerase. Die Reaktion wurde bei 65 °C 30 min lang inkubiert, gefolgt von 5 min bei 95 °C, 35 Zyklen von (95 °C für 1 min, 65 °C für 1 min, 70 °C für 2 min) gefolgt von 72 °C für 5 min. Das Produkt wurde auf einem 2 % Ethidiumbromid-gefärbten Agarosegel aufgelöst und das erwartete 386 bp-Produkt wurde beobachtet.

Beispiel 9: Konstruktion der FY-DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus Ausgangsmaterial

Die DNA-Konstrukte, die zum Erzeugen der FY-Polymerase verwendet wurden, waren wie folgt:

pRED6706 ist ein Expressionsvektor, der ein Polypeptid von 608 Aminosäuren kodiert. Nach einem konstruierten intitiierenden Methionin repräsentieren die verbleibenden kodierten 607 Aminosäuren den C-terminalen Abschnitt der DNA-Polymerase I, erhältlich von Thermoanaerobacter thermohydrosulfuricus. pRED6404 ist ein Expressionsvektor, der ein Polypeptid von 578 Aminosäuren kodiert. Nach einem konstruierten initiierenden Methionin repräsentieren die verbleibenden kodierten 577 Aminosäuren den C-terminalen Abschnitt der DNA-Polymerse I, die von Thermoanaerobacter thermohydrosulfuricus erhältlich ist.

pPREF2 kodiert dasselbe Polypeptid mit pRED6404, besitzt aber drei stumme Mutationen der Thermoanaerobacter-thermohydrosulfuricus-Sequenz bei Codons 7, 10 und 11, um Codons zu eliminieren, die von E.coli selten genutzt werden.

All diese Konstrukte werden vom Expressionsvektor pRE2 erhalten (Nucleic Acids Res. (1989) 17, 10473–88), der den &lgr; PL-Promotor und die &agr; cII-Ribosomen-Bindungsstelle nutzt.

Konstruktion von F412Y

Thermoanaerobacter-thermohydrosulfuricus-DNA-Polymerase wurde auf die Sequenz (RXXXKXXXFXXXYG) (SEQ. ID. Nr. 20) abgesucht, um das Motiv B oder den O-Helixbereich zu lokalisieren. Die Sequenz (RRAAKAVNFGIIYG) (SEQ. ID. Nr. 21) wurde bei Aminosäureresten gefunden, die als 433 bis 466 des vorhergesagten pRED6706-Gen-Produkts nummeriert waren. Ein mutagenes Oligonucleotid DDFY(AAGGTCAGAAAGCCCATAATCGCTTATGCCATATATTATG CCATAATTTACGGC) (SEQ. ID. Nr. 22) wurde anti-parallel zu den Nucleotiden 1315–1371 der pRED6706-kodierenden Sequenz entworfen, mit Ausnahme für die Änderung (AAA-ATA) bei nt 1325. Diese Änderung entspricht Phenylalanin, das zu Tyrosin in der exprimierten Polymerase geändert wurde. Diese Oligonucleotid überlappt auch eine einzige XhoI-Restriktionsstelle beim Nucleotid 1361.

Das Oligonucleotid DDFY zusammen mit DD64pref (SEQ. ID. Nr. 13), das komplementär zu den Nucleotiden 94–133 der pRED6706-kodierenden Sequenz ist, enthält eine NdeI-Restriktionsstelle, die zum Ausrichten der PCR-Amplifizierung und gleichzeitigen Mutagenese von pRED6706 verwendet wurden. Das resultierende PCR-Produkt wurde mit NdeI und XhoI verdaut, gereinigt durch Agarosegel-Elektrophorese und ligiert mit dem großen Fragment des ähnlich behandelten pRED6404. Das ligierte Konstrukt wurde verwendet, um den kompetenten E.coli-Strang DH1&lgr;+(&lgr;cl+) zu transformieren. Klone, die ein geeignetes Restriktionsenzym-Verdauungsmuster ergaben, wurden sequenziert, um die Mutation zu bestätigen.

Fremd-Mutationen wurden zusätzlich zu der erwünschten Mutation in allen untersuchten Klonen gefunden, so wurde ein AflIII/KpnI-Restriktionsfragment, das ausschließlich die F412Y-Mutation (pRED6404-Nummerierung) enthielt, in pRED6404 subkloniert, um pLS-1 zu erhalten.

Beispiel 10: Reinigung der F412Y-DNA-Polymerase

Das Plasmid pLS-1 wurde in den E.coli-Strang MZ-1 (&lgr; cl857-Lysogen) transformiert. Ein I der Kultur im LB-Medium, das 100 &mgr;g/ml Ampicillin enthielt, wurde bei 30 °C bis OD600=1.1 gezogen. Die Temperatur wurde auf 42 °C angehoben und das Wachstum wurde für 2 Stunden fortgesetzt. Die Zellen wurden durch Zentrifugation (4 g nasses Gewicht) geerntet und im 15 ml Puffer A (50 mM Tris-HCl, pH 8,0, 1 mM DTT, 1 mM PMSF, 1 mM EDTA, 10 % (v/v) Glycerol) resuspendiert, der 50 mM NaCl enthielt. Die Resuspension wurde viermal für 30 Sekunden beschallt und das Lysat wurde durch Zentrifugation geklärt. Das geklärte Lysat wurde zu 300 mM in NaCl gemacht und man ließ es durch eine Säule von DEAE-Zellulose (65 ml Bettvolumen) laufen, die in Puffer A, der 300 mM NaCl enthielt, ins Gleichgewicht gebracht war. Die Durchfluss-Fraktion (45 ml) wurde gesammelt, auf 70 °C 15 min lang erwärmt und durch Zentrifugation geklärt. Der geklärte Überstand wurde mit Puffer A verdünnt, der 50 mM NaCl enthielt, auf ein Gesamtvolumen von 120 ml. Diese Lösung wurde auf eine Säule aus Heparin-Sepharose (70 ml Bettvolumen) geladen, die mit Puffer A, der 150 mM NaCl enthielt, ins Gleichgewicht gebracht war. Die Säule wurde mit demselben Puffer gewaschen und die Aktivität aus der Säule mit einem linearen Salzgradienten von 150 mM bis 700 mM NaCl-Puffer eluiert. Aktive Fraktionen, die mehr als 90% rein durch SDS-PAGE beurteilt wurden, wurden gesammelt, durch Ultrafiltration konzentriert und gegen 50 mM Phosphat, 50 % (v/v) Glycerol dialysiert. Die Sequenz ist in 4A–C (SEQ. ID. Nr. 4) bereit gestellt.

Beispiel 11: Mutante voller Länge ohne 5'- bis 3'-Exonuclease

Die Entfernung der 5'- bis 3'-Exonuclease-Aktivität ist für Anwendungen erwünscht, die für diese Polymerase geeignet sind, einschließlich Amplifizierung und Sequenzieren. Weil die 5'- bis 3'-Exonuclease-Aktivität co-incident mit der RnaseH-Aktivität sein kann, ist es auch wichtig, die 5'- bis 3'-Exonuclease-Aktivität für die Anwendung der Reversen Transkription zu entfernen oder reduzieren. Einzelne Nucleotid-Substitutionen sind geeignet, um die Exonuclease-Aktivität zu reduzieren oder zu entfernen.

Die Aminosäuresequenz der Tts-Polymerase wurde mit bekannten homologen DNA-Polymerase 1-Enzymen wie E.coli DNA Pol I, Taq DNA-Polymerase und Tth DNA-Polymerase verglichen, um konservierte Motive in der 5'- bis 3'-Exonucleasedomäne zu identifizieren (Gutman und Minton, Nucleic Acids Research, 21:4406–4407, 1993).

Ein Carboxylat-Rest, der dafür bekannt ist, dass er an der aktiven Exonucleasestelle der Taq DNA-Polymerase vorhanden ist (Kim et al., Nature 376:612–616, 1995) wurde mutagenisiert. Dieser Rest entspricht einem Asparaginsäurerest in Position 8 (D8) in der Tts-Polymerase, der zu einem Alanin-Rest (A) mutagenisiert wurde, um die Carboxylat-Funktion zu entfernen und die 5'- bis 3'-Exonuclease-Aktivität zu beseitigen. Ein Oligo-Primer (CTTACATATGGCTTATAAATTTTTAATCATTG-CTGGTAGTAG) (SEQ. ID. Nr. 28) wurde verwendet, um die Stellen-gerichtete Mutagenese auszuführen. Diese Mutagenese wandelt Asp8 zu Ala8 um und führt eine günstige Klonierungsstelle (NdeI) am 5'-Ende ein. Das pLS-3-Konstrukt (Tts-Polymerase voller Länge) wurde als eine Matrize und Elternklon verwendet. Ein 1,45 kb-Produkt wurde durch PCR mit dem oben angegebenen Primer und einem internen Tts-Rückwärts-Primer amplifiziert. Das NdeI/EcoRI-Fragment dieses PCR-Produktes wurde zurück substituiert in den pLS-3-Klon. Der Vektor pRE2 und die bakteriellen Stränge DH1&lgr;+ und M5248 sind wie zuvor beschrieben.

Jene, die die Technik ausführen, können bekannte Techniken und andere ausführen, die jenen, die die Technik ausführen, bekannt sind, um andere Aminosäuren-Reste im Amino-Terminus zu einem Drittel der Tts-Polymerase zu ändern, um die Exonuclease-Aktivität zu entfernen. Es gibt mindestens sechs konservierte Motive, die am Amino-Terminus der homologen DNA-Polymerasen lokalisiert sind, in dem Änderungen in den Aminosäuren-Resten zu einem Verlust oder einer Reduktion der Exonuclease-Aktivität führt. Diese konservierten Motive werden in Gutman und Minton (supra) identifiziert und von Daten von der Kristallstruktur der Taq-Polymerase gestützt (Kim, et al. (1995) Nature 376:612–616). Die vorliegende Erfindung umfasst Änderungen in diesen Bereichen.

Beispiel 12: PCR mit &Dgr;Tts in 30 % Glycerol

PCR wurde mit &Dgr;Tts-Enzym bei Vorhandensein von 30 % Glycerol ausgeführt, um das Enzym zu stabilisieren und die Temperaturen zu reduzieren, die zum DNA-Assoziieren in der Reaktion notwendig sind. Eine 100 &mgr;l PCR-Reaktion enthält 10 ng einer 6 kb Plasmid-Matrize, 100 pmol jeweils von Vorwärts- und Rückwärts-Primern, die ungefähr 500 bp entfernt sind, 200 &mgr;M dNTP, 10 mM Tris-HCl, pH 8,3, 50 mM KCl, 1,5 mM MgCl2 und 30 % Glycerol. Die Reaktionsmischung wurde auf 95 °C 2 min lang erwärmt, bevor ATts zugegeben wurde. Eine AmpliTaqTM(PE Applied Biosystems, Foster City, CA)-Kontrollreaktion wurde getrennt unter denselben Bedingungen ausgeführt. Das Cycling-Programm bestand aus: 80 °C für 15 Sekunden, 40 °C für 30 Sekunden und 55 °C für 1 min, wiederholt für 30 Zyklen. Ein PCR-Produkt einer geeigneten Größe wurde bei 2,5,5 und 10 Einheiten von &Dgr;Tts erzeugt, und diese Menge des Produktes war zwei- oder dreimal größer als jenes, dass durch 2,5 Einheiten von AmpliTaqTM unter denselben Bedingungen erzeugt wurde.

Beispiel 13: RT/PCR-Protokoll mit &Dgr;Tts

Die Reverse Transkription wird mit &Dgr;Tts-Enzym ausgeführt, als der erste Schritt von RT/PCR. Eine 20&mgr;l-Reaktion enthält 40 Einheiten von &Dgr;Tts-Enzym, 5 mM MgCl2, 20 Einheiten placentalem Rnase-Inhibitor (Amersham Pharmacia Biotech, Inc., Cleveland, OH), 1 mM jeweils von dATP, dCTP, dGTP und dTTP, 15 pmol Primer, 10 mM Tris-HCl pH 8,3, 50 mM KCl und 50 ng Globin-mRNA-Matrize. Man ließ die Reaktion 45 min bei 65 °C voranschreiten. Diese 20 &mgr;l Reaktionsmischung wurde zu einer PCR-Reaktionsmischung mit einem Endvolumen von 100 &mgr;l gegeben, die 10 mM Tris-HCl, pH 8,3, 50 mM KCl, 5 mM MgCl2, 100 pmol jeweils von Vorwärts- und Rückwärts-Primern, die ungefähr 500 bp entfernt waren, und 30 % Glycerol enthielt. Weitere Zugabe von Enzym ist nicht notwendig; &Dgr;Tts führt PCR bei Vorhandensein von Glycerol aus. Das Cycling-Programm besteht aus 50 Zyklen: 80 °C für 15 Sekunden, 40 °C für 30 Sekunden, 65 °C für 1 min.

Ein Fachmann würde leicht anerkennen, dass die vorliegende Erfindung gut angepasst ist, um die Aufgaben auszuführen und die erwähnten Ziele und Zweckmäßigkeiten zu erhalten, wie jene, die darin inhärent sind. Die Verfahren, Kits, Lösungen und Moleküle, die hier beschrieben werden, sind zur Zeit repräsentativ für bevorzugte Ausführungsformen und sind beispielhaft nicht beabsichtigt als Beschränkungen für den Umfang der Erfindung. Änderungen darin und andere Verwendungen werden jenen Fachleuten einfallen und werden innerhalb des Geistes der Erfindung umfasst sein, der durch den Umfang der Ansprüche definiert ist.

Es wird dem Fachmann einfach offenbar sein, dass variierende Substitutionen und Modifikationen auf die Erfindung ausgeführt werden können, die hier offenbart ist, ohne vom Umfang und Geist der Erfindung abzuweichen.

Alle in der Beschreibung erwähnten Patente und Veröffentlichungen zeigen die Niveaus der Fachleute an, die die Erfindung betrifft. Alle Patente und Veröffentlichungen sind hier durch Bezugnahme im selben Umfang enthalten, als wenn jede einzelne Veröffentlichung spezifisch und individuell als durch Bezugnahme enthalten angezeigt wäre.

Die veranschaulichend hier beschriebene Erfindung kann auf geeignete Weise in Abwesenheit eines beliebigen Elementes oder Elemente, Beschränkung oder Beschränkungen ausgeführt werden, die hier nicht spezifisch offenbart ist. Daher kann z.B. in jedem Fall hier ein beliebiger der Begriffe „umfassend", „im wesentlichen bestehend aus" und „bestehend aus" mit jedem der anderen zwei Begriffe ausgetauscht werden. Die Begriffe und Ausdrücke, die verwendet wurden, werden als Begriffe der Beschreibung und nicht der Beschränkung verwendet, und es gibt keine Absicht, dass bei der Verwendung derartiger Begriffe und Ausdrücke beliebige Äquivalente der gezeigten und beschriebenen Merkmale oder Teile davon ausgeschlossen werden, aber es wird anerkannt, dass verschiedene Modifikationen innerhalb des Umfangs der beanspruchten Erfindung möglich sind.

Zusätzlich werden, wo Merkmale oder Aspekte der Erfindung in Begriffen von Markush-Gruppen beschrieben werden, jene Fachleute erkennen, dass die Erfindung auch dadurch in Form von einem/einer beliebigen individuellen Element oder Subgruppe der Elemente der Markush-Gruppe beschrieben wird.

Andere Ausführungsformen liegen innerhalb der folgenden Ansprüche.


Anspruch[de]
  1. Enzymatisch aktive DNA-Polymerase, die mindestens 80% Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus der Seq. ID. Nr. 2 besitzt und bei der eine Exonuclease-Aktivität durch Austauschen des Asparaginsäure-Restes in Position 8 mit einem Alanin-Rest entfernt ist.
  2. DNA-Polymerase nach Anspruch 1, bei der Phenylalanin in Position 706 mit Tyrosin in Seq. ID. Nr. 2 ausgetauscht ist.
  3. Kit für eine Polymerasekettenreaktion, umfassend ein Polymerasestabilisationsmittel und eine enzymatisch aktive DNA-Polymerase, die mindestens 80% Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus der Seq. ID. Nr. 2 besitzt und bei der eine Exonuclease-Aktivität durch Austauschen des Asparaginsäure-Restes in Position 8 mit einem Alanin entfernt ist.
  4. Kit nach Anspruch 3, das auch ein Mittel enthält, das unabhängig ausgewählt ist aus der Gruppe, die besteht aus Glycerol, Trimethylamin-N-oxid und N-Methylmorpholin-N-oxid.
  5. Verfahren zur Polymerasekettenreaktion oder Reversen Transkription, in Anwesenheit eines Polymerasestabilisationsmittels, unter Verwenden einer enzymatisch aktiven DNA-Polymerase, die mindestens 80% Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus der Seq. ID. Nr. 2 besitzt und bei der eine Exonuclease-Aktivität durch Austauschen des Asparaginsäure-Restes in Position 8 mit einem Alanin entfernt ist.
  6. Verfahren nach Anspruch 5, bei dem das Mittel unabhängig ausgewählt ist aus der Gruppe, die besteht aus Glycerol, Trimethylamin-N-oxid und N-Methylmorpholin-N-oxid.
  7. Verfahren zum Erzeugen und Amplifizieren eines Nucleinsäurefragmentes durch Strangverdrängung unter Verwenden einer DNA-Polymerase, die mindestens 80% Identität in ihrer Aminosäuresequenz zur DNA-Polymerase von Thermoanaerobacter thermohydrosulfuricus der Seq. ID. Nr. 2 besitzt und bei der eine Exonuklease-Aktivität durch Austauschen des Asparaginsäure-Restes in Position 8 mit einem Alanin-Rest entfernt ist.
  8. Verfahren zum Sequenzieren von DNA, wodurch mindestens ein Teil der Nucleotidbasensequenz einer DNA-Matrize bestimmt werden kann, umfassend den Schritt des Erzeugens von Ketten-terminierten Fragmenten aus der DNA-Matrize mit einer DNA-Polymerase des Anspruchs 1 in Anwesenheit mindestens eines Ketten-terminierenden Mittels und das Bestimmen der Sequenz mindestens eines Teils der DNA-Matrize aus den Größen der Fragmente.
  9. Kit zum Sequenzieren von DNA, umfassend eine DNA-Polymerase nach Anspruch 1 und eine Pyrophosphatase.
Es folgen 18 Blatt Zeichnungen






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

  Patente PDF

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com