PatentDe  


Dokumentenidentifikation DE60209711T2 16.11.2006
EP-Veröffentlichungsnummer 0001390710
Titel AMPLIFIKATION UND NACHWEIS VON MYCOPLASMA PNEUMONIAE
Anmelder Becton Dickinson and Co., Franklin Lakes, N.J., US
Erfinder FINN, Stefanie, Owings Mills, MD 21117, US;
PRICE, A., James, Lutherville, MD 21093, US;
HELLYER, J., Tobin, Westminster, MD 21157, US
Vertreter Patentanwälte von Kreisler, Selting, Werner et col., 50667 Köln
DE-Aktenzeichen 60209711
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE, TR
Sprache des Dokument EN
EP-Anmeldetag 11.04.2002
EP-Aktenzeichen 027313592
WO-Anmeldetag 11.04.2002
PCT-Aktenzeichen PCT/US02/11630
WO-Veröffentlichungsnummer 2002086441
WO-Veröffentlichungsdatum 31.10.2002
EP-Offenlegungsdatum 25.02.2004
EP date of grant 08.03.2006
Veröffentlichungstag im Patentblatt 16.11.2006
IPC-Hauptklasse C07H 21/04(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12Q 1/44(2006.01)A, L, I, 20051017, B, H, EP   C12Q 1/68(2006.01)A, L, I, 20051017, B, H, EP   C12P 19/34(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Gebiet der Erfindung

Die vorliegende Erfindung bezieht sich auf Verfahren zur Bestimmung der An- oder Abwesenheit von Mycoplasma pneumoniae in Atemwegsproben oder anderen Patientenproben oder Kulturproben. Das Verfahren beinhaltet die Verwendung von Nucleinsäureprimern zum spezifischen Amplifizieren einer Zielsequenz innerhalb des ORF6-Gens, vorzugsweise unter Verwendung einer der Techniken Strangverdrängungsamplifikation (SDA), thermophile Strangverdrängungsamplifikation (tSDA) oder Fluoreszenzechtzeit-tSDA.

Hintergrund der Erfindung

M. pneumoniae ist vorwiegend ein Pathogen der menschlichen Atemwege und kann Bronchitis, Pharyngitis und atypische Lungenentzündung verursachen. Es infiziert am häufigsten ältere Kinder und junge Erwachsene. Zu den Standardlaborverfahren für die Diagnose von M. pneumoniae gehören Kultur und Serologie. Beide Verfahren haben Nachteile; M. pneumoniae ist heikel und erfordert zum Kultivieren 1 bis 3 Wochen, während die Serologie unempfindlich und unspezifisch ist. Nucleinsäure-Amplifikationsverfahren zum Nachweis von M. pneumoniae bieten potentiell die Vorteile von Geschwindigkeit und verbesserter Empfindlichkeit und Spezifität.

Die physikalische Kartierung, wie sie von Wenzel et al. (1988, Nucl. Acids Res. 16: 8323–8336) beschrieben wurde, und die Sequenzierung des vollständigen Genoms, wie sie von Himmelreich et al. (1996, Nucl. Acids Res. 24: 4420–4449) beschrieben wurde, von M. pneumoniae wurden durchgeführt. Mehrere Mycoplasma-Membranproteine sind bekanntermaßen an der Anheftung von M. pneumoniae an Wirtszellen beteiligt. Dazu gehören die Proteine P1, HMW1 und HMW3 sowie die 40- und 90-kDa-Expressionsprodukte des ORF6-Gens, die alle zusammen in einem Transmembran-Proteinkomplex assoziiert sind (Sperker et al., 1991, Mol. Microbiol. 5: 299–306; Layh-Schmitt, 1993, Zentralbl. Bakteriol. 278: 287–295; Layh-Schmitt et al., 1999, FEMS Microbiol. Lett. 174: 143–149; Layh-Schmitt et al., 2000, Microbiol. 146: 741–747). Das ORF6-Gen ist eines von zwei offenen Leserastern, die das Gen des Anheftungsproteins P1 flankieren. Eine operonartige Organisation mit der Reihenfolge ORF4-ORF5/P1-ORF6 wurde für diesen Bereich des M.-pneumoniae-Genoms vorgeschlagen (Su et al., 1987, Infect. Immun. 55: 3023–3029). Das 3950-bp-ORF6-Gen enthält ein repetitives Element (RepMP5) von 1900 bp, das im gesamten M.-pneumoniae-Genom insgesamt achtmal wiederholt wird (Ruland et al., 1994, J. Bacteriol. 176: 5202–5209). Wegen der Wichtigkeit des ORF6-Gens für die Pathogenität des Organismus ist es ein potentiell nützliches Ziel für die Entwicklung von M.-pneumoniaespezifischen diagnostischen Tests. Die Auswahl des RepMP5-Elements innerhalb des ORF6-Gens als Ziel für solche Assays hat auch den Vorteil, dass die Empfindlichkeit erhöht werden kann im Vergleich zu derjenigen, die durch Verwendung einer Sequenz mit einer einzigen Kopie als Ziel innerhalb des M.-pneumoniae-Genoms erreicht werden kann.

Die Nucleinsäureamplifikation ist eine machtvolle Technologie, die den schnellen Nachweis von spezifischen Zielsequenzen ermöglicht, und ist daher eine vielversprechende Technologie für den schnellen Nachweis und die schnelle Identifizierung von M. pneumoniae. Die Oligonucleotidprimer der vorliegenden Erfindung sind auf die Nucleinsäureamplifikation und den Nachweis von M. pneumoniae anwendbar.

Die folgenden Ausdrücke sind hier wie folgt definiert:

Ein Amplifikationsprimer ist ein Primer für die Amplifikation einer Zielsequenz durch Verlängerung des Primers nach der Hybridisierung mit der Zielsequenz. Amplifikationsprimer haben typischerweise eine Länge von etwa 10–75 Nucleotiden, vorzugsweise etwa 15–50 Nucleotiden. Die Gesamtlänge eines Amplifikationsprimers für die SDA beträgt typischerweise etwa 25–50 Nucleotide. Das 3'-Ende eines SDA-Amplifikationsprimers (die Zielbindungssequenz) hybridisiert mit dem 3'-Ende der Zielsequenz. Die Zielbindungssequenz hat eine Länge von etwa 10–25 Nucleotiden und verleiht dem Amplifikationsprimer Hybridisierungsspezifität. Der SDA-Amplifikationsprimer umfasst weiterhin eine Erkennungsstelle für eine Restriktions-Endonuclease 5' von der Zielbindungssequenz. Die Erkennungsstelle gehört zu einer Restriktions-Endonuclease, die einen Einzelstrangbruch in dem einen Strang eines DNA-Duplex erzeugt, wenn die Erkennungsstelle hemimodifiziert ist, wie es von G. Walker et al. beschrieben ist (1992, Proc. Natl. Acad. Sci. USA 89: 392–396, und 1992, Nucl. Acids Res. 20: 1691–1696). Die Nucleotide 5' von der Erkennungsstelle der Restriktions-Endonuclease (der "Schwanz") fungieren als Polymerase-Reprimerstelle, wenn der Rest des Amplifikationsprimers während der SDA gespalten und verdrängt wird. Die Reprimerfunktion der Schwanznucleotide hält die SDA-Reaktion aufrecht und erlaubt die Synthese mehrerer Amplikons aus einem einzigen Zielmolekül. Der Schwanz hat typischerweise eine Länge von etwa 10–25 Nucleotiden. Seine Länge und Sequenz sind im Allgemeinen nicht entscheidend und können routinemäßig ausgewählt und modifiziert werden. Da die Zielbindungssequenz derjenige Teil eines Primers ist, der dessen Zielspezifität bestimmt, besteht der Amplifikationsprimer bei Amplifikationsverfahren, die keine speziellen Sequenzen an den Enden des Ziels erfordern, im Allgemeinen im Wesentlichen nur aus der Zielbindungssequenz. Zum Beispiel werden bei der Amplifikation einer Zielsequenz gemäß der Erfindung unter Verwendung der Polymerase-Kettenreaktion (PCR) Amplifikationsprimer eingesetzt, die aus den Zielbindungssequenzen der hier beschriebenen Amplifikationsprimer bestehen. Bei Amplifikationsverfahren, die außer der spaltbaren Erkennungsstelle der Restriktions-Endonuclease und dem SDA-Schwanz noch andere spezielle Sequenzen erfordern, die an das Ziel angehängt sind (z.B. einen RNA-Polymerase-Promotor für die self-sustained sequence replication (3SR), die nucleic acid sequence-based amplification (NASBA), das transcription-based amplification system (TAS) oder die rolling circle amplification (RCA)), kann die erforderliche spezielle Sequenz unter Verwendung von Routineverfahren für die Herstellung von Oligonucleotiden mit der Zielbindungssequenz verknüpft werden, ohne die Hybridisierungsspezifität des Primers zu verändern.

Ein Bumperprimer oder externer Primer ist ein Primer, der bei isothermen Amplifikationsreaktionen verwendet wird, um Primerverlängerungsprodukte zu verdrängen. Der Bumperprimer assoziiert mit einer Zielsequenz stromaufwärts des Amplifikationsprimers, so dass bei der Verlängerung des Bumperprimers der stromabwärts gelegene Amplifikationsprimer und sein Verlängerungsprodukt verdrängt werden.

Die Ausdrücke "Ziel" oder "Zielsequenz" beziehen sich auf Nucleinsäuresequenzen, die amplifiziert werden sollen. Dazu gehören die ursprüngliche zu amplifizierende Nucleinsäuresequenz, der komplementäre zweite Strang der ursprünglichen zu amplifizierenden Nucleinsäuresequenz sowie beide Stränge einer Kopie der ursprünglichen Sequenz, die durch die Amplifikationsreaktion erzeugt wird. Diese Kopien dienen als amplifizierbare Ziele aufgrund der Tatsache, dass sie Kopien der Sequenz enthalten, mit der die Amplifikationsprimer hybridisieren.

Kopien der Zielsequenz, die während der Amplifikationsreaktion erzeugt werden, werden als Amplifikationsprodukte, Amplimere oder Amplikons bezeichnet.

Der Ausdruck "Verlängerungsprodukt" bezieht sich auf die Kopie einer Zielsequenz, die durch Hybridisierung eines Primers und Verlängerung des Primers durch Polymerase unter Verwendung der Zielsequenz als Matrize erzeugt wird.

Der Ausdruck "artspezifisch" bezieht sich auf den Nachweis, die Amplifikation oder Oligonucleotid-Hybridisierung einer Organismenart oder einer Gruppe verwandter Arten, ohne dass ein wesentlicher Nachweis, eine wesentliche Amplifikation oder Oligonucleotid-Hybridisierung anderer Arten derselben Gattung oder von Arten einer anderen Gattung erfolgt.

Der Ausdruck "Assaysonde" bezieht sich auf jedes Oligonucleotid, das verwendet wird, um den Nachweis oder die Identifikation einer Nucleinsäure zu erleichtern.

Detektorsonden, Detektorprimer, Abfangsonden, Signalprimer und Reportersonden, wie sie unten beschrieben sind, sind Beispiele für Assaysonden.

Ein Signalprimer umfasst eine 3'-Zielbindungssequenz, die mit einer komplementären Sequenz im Ziel hybridisiert, und umfasst weiterhin eine 5'-Schwanzsequenz, die zu dem Ziel nicht komplementär ist (die Adaptersequenz). Die Adaptersequenz ist ein indirekt nachweisbarer Marker, der so gewählt wird, dass seine komplementäre Sequenz mit dem 3'-Ende der unten beschriebenen Reportersonde hybridisiert. Der Signalprimer hybridisiert mit der Zielsequenz wenigstens teilweise stromabwärts der Hybridisierungsstelle eines Amplifikationsprimers. Der Signalprimer wird von der Polymerase in ähnlicher Weise verlängert wie bei der Verlängerung der Amplifikationsprimer. Durch die Verlängerung des Amplifikationsprimers wird das Verlängerungsprodukt des Signalprimer in einer zielamplifikationsabhängigen Weise verdrängt, wodurch ein einzelsträngiges Produkt entsteht, das eine 5'-Adaptersequenz, eine stromabwärts gelegene Bindungssequenz und eine 3'-Bindungssequenz, die für die Hybridisierung eines flankierenden SDA-Amplifikationsprimers spezifisch ist, umfasst. Durch die Hybridisierung und Verlängerung dieses flankierenden Amplifikationsprimers und seine anschließende Spaltung und Verlängerung entstehen Amplifikationsprodukte, die das Komplement der Adaptersequenz enthalten, das als Hinweis auf die Zielamplifikation nachgewiesen werden kann.

Eine Reportersonde gemäß der vorliegenden Erfindung fungiert als Nachweisoligonucleotid und umfasst einen Marker, bei dem es sich vorzugsweise um wenigstens ein Donor/Quencher-Farbstoffpaar handelt, d.h. einen Fluoreszenzdonorfarbstoff und einen Quencher für das Donorfluorophor. Der Marker ist mit einer Sequenz oder Struktur in der Reportersonde (der Reporter-Struktureinheit), die nicht direkt mit der Zielsequenz hybridisiert, verknüpft. Die Sequenz der Reportersonde 3' von der Reporter-Struktureinheit wird so gewählt, dass sie mit dem Komplement der Signalprimer-Adaptersequenz hybridisiert. Im Allgemeinen enthält das 3'-Ende der Reportersonde keine Sequenzen mit einer wesentlichen Komplementarität zur Zielsequenz. Wenn die Amplifikationsprodukte, die das oben beschriebene Komplement der Adaptersequenz enthalten, vorhanden sind, können sie mit dem 3'-Ende der Reportersonde hybridisieren. Das Priming und die Verlängerung ausgehend vom 3'-Ende der Adapterkomplementsequenz ermöglicht die Bildung des Komplements der Reporter-Struktureinheit. Durch diese Bildung wird die Reporter-Struktureinheit doppelsträngig, was den Nachweis des Markers der Reportersonde ermöglicht und die Anwesenheit oder Amplifikation des Ziels anzeigt.

Der Ausdruck "Amplikon" bezieht sich auf das Produkt der Amplifikationsreaktion, das durch die Verlängerung von einem der beiden oder beiden Partnern eines Paars von Amplifikationsprimern erzeugt wird. Ein Amplikon kann exponentiell amplifizierte Nucleinsäuren enthalten, wenn beide verwendeten Primer mit einer Zielsequenz hybridisieren. Alternativ dazu können Amplikons auch durch lineare Amplifikation erzeugt werden, wenn einer der verwendeten Primer nicht mit der Zielsequenz hybridisiert. Dieser Ausdruck wird hier also generisch verwendet und impliziert nicht die Anwesenheit von exponentiell amplifizierten Nucleinsäuren.

Kurzbeschreibung der Erfindung

Die vorliegende Erfindung stellt Oligonucleotidprimer bereit, die für die Amplifikation einer Zielsequenz, die man in M. pneumoniae findet, verwendet werden können. Insbesondere umfasst die Zielsequenz ein Segment des ORF6-Gens. Die Amplifikationsprimer wurden im Hinblick auf eine Amplifikation mit hoher Effizienz und hoher Spezifität bei erhöhten Temperaturen, wie bei der tSDA und PCR, gestaltet, doch sind sie auch für Amplifikationsreaktionen bei niedrigerer Temperatur geeignet, wie herkömmliche SDA, 3SR, TAS, NASBA oder RCA. Eine Oligonucleotid-Reportersonde, die mit dem Komplement von zielspezifischen Signalprimern hybridisiert, wird verwendet, um die Amplifikationsprodukte nachzuweisen.

Die Oligonucleotide der Erfindung können nach einer Kultur als Mittel verwendet werden, um die Identität des kultivierten Organismus zu bestätigen. Alternativ dazu können sie auch für den Nachweis und die Identifizierung von M. pneumoniae in klinischen Proben von Menschen oder Tieren unter Verwendung bekannter Amplifikationsverfahren verwendet werden. In beiden Fällen stellen die erfindungsgemäßen Oligonucleotide und Assayverfahren ein Mittel bereit, um schnell zwischen M. pneumoniae und anderen Mikroorganismen zu unterscheiden, was es dem Fachmann erlaubt, diesen Mikroorganismus schnell zu identifizieren, ohne auf die traditionelleren Verfahren zurückzugreifen, auf die man sich üblicherweise verlässt. Eine solche schnelle Identifikation des spezifischen ätiologischen Mittels, das an einer Infektion beteiligt ist, liefert Informationen, die verwendet werden können, um in kurzer Zeit geeignete Maßnahmen zu bestimmen.

Zusammenfassung der Sequenzen

SEQ ID Nr. 1–2 sind Sequenzen von Oligonucleotiden, die als stromaufwärts gelegene Primer für die Amplifikation einer Sequenz innerhalb des ORF6-Gens verwendet werden. SEQ ID Nr. 3–4 sind Sequenzen von Oligonucleotiden, die als stromabwärts gelegene Primer für die Amplifikation einer Sequenz innerhalb des ORF6-Gens verwendet werden. SEQ ID Nr. 5–6 sind Sequenzen von Oligonucleotiden, die als stromaufwärts gelegene Bumperprimer für die SDA-Amplifikation verwendet werden. SEQ ID Nr. 7–8 sind Sequenzen von Oligonucleotiden, die als stromabwärts gelegene Bumperprimer für die SDA-Amplifikation verwendet werden. SEQ ID Nr. 9–10 sind Sequenzen von Signalprimern für die Amplifikation und den Nachweis einer Sequenz innerhalb des ORF6-Gens. SEQ ID Nr. 11 ist eine Sequenz für eine Reportersonde, die für den Nachweis einer Sequenz innerhalb des ORF6-Gens entworfen wurde, wenn sie in Verbindung mit einem der oben genannten Signalprimer verwendet wird. SEQ ID Nr. 12 ist eine Sequenz eines Oligonucleotids, das als stromaufwärts gelegener Primer für die PCR-Amplifikation einer Sequenz innerhalb des ORF6-Gens verwendet wird. SEQ ID Nr. 13 ist eine Sequenz eines Oligonucleotids, das als stromabwärts gelegener Primer für die PCR-Amplifikation einer Sequenz innerhalb des ORF6-Gens verwendet wird.

Kurzbeschreibung der Zeichnungen

Die verschiedenen Ziele, Vorteile und neuen Merkmale der vorliegenden Erfindung werden anhand der folgenden Beschreibung, wenn man sie in Verbindung mit den Begleitzeichnungen liest, leicht verständlich. Dabei zeigen:

1 den Nachweis einer M.-pneumoniae-Nucleinsäure-ORF6-Gen-Zielsequenz bei der SDA-Reaktion (Strangverdrängungsamplifikation) nach dem Verfahren der Erfindung.

2 die Bildung eines 529-bp-Amplifikationsprodukts, wenn SEQ ID Nr. 12 und 13 bei der PCR-Amplifikation einer M.-pneumoniae-Nucleinsäure-ORF6-Gen-Zielsequenz verwendet werden.

3 das Fehlen von Kreuzreaktivität von SEQ ID Nr. 12 und 13, wenn sie bei der PCR-Amplifikation der Nucleinsäure von Organismen verwendet werden, die phylogenetisch mit M. pneumoniae verwandt sind.

4 die Ausrichtung der Zielbindungssequenzen von SEQ ID Nr. 1, 3, 5, 7 und 9 bei der SDA-Amplifikation des ORF6-Gens von mehreren M.-pneumoniae-Stämmen.

5 die Ausrichtung der Zielbindungssequenzen von SEQ ID Nr. 2, 4, 6, 8 und 10 bei der SDA-Amplifikation des ORF6-Gens von mehreren M.-pneumoniae-Stämmen.

Ausführliche Beschreibung der Erfindung

Die vorliegende Erfindung bezieht sich auf Oligonucleotide, Amplifikationsprimer und Signalprimer, die Spezifität für M. pneumoniae in Nucleinsäure-Amplifikationsreaktionen aufweisen. Ebenfalls bereitgestellt werden Verfahren zum Nachweisen und Identifizieren von M.-pneumoniae-Nucleinsäuren unter Verwendung der Oligonucleotide der Erfindung. Die bevorzugten Verfahren sind die Verwendung von SDA, tSDA oder homogener Echtzeitfluoreszenz-tSDA. Diese Verfahren sind dem Fachmann aus Literaturstellen wie US-Patent Nr.. 5,547,861, US-Patent Nr. 5,648,211, US-Patent Nr. 5,846,726, US-Patent Nr. 5,919,630, US-Patent Nr. 5,928,869, US-Patent Nr. 5,958,700, US-Patent Nr. 5,935,791, US-Patent Nr. 6,054,279, US-Patent Nr. 6,130,047, US-Patentanmeldung Serial No. 09/590,061, eingereicht am B. Juni 2000, und US-Patentanmeldung Serial No. 09/602,996, eingereicht am 23. Juni 2000, bekannt.

Die Primer der vorliegenden Erfindung wurden auf der Grundlage einer Analyse von ORF6-Gensequenzdaten vom M129-Stamm entworfen, der unter der Genbank-Zugriffsnummer NC 000912 hinterlegt ist. Wie in Tabelle 1 gezeigt ist, wurden PCR-Primer, die mehrere Zielbereiche innerhalb des ORF6-Gens überspannen, in Bezug auf ihre Spezifität für M. pneumoniae bewertet. Die Sequenzkonservierung innerhalb des ausgewählten Zielbereichs wurde durch eine Sequenzanalyse von PCR-Produkten aus 8 Referenzstämmen von M. pneumoniae bewertet, um Homologie im Zielbereich nachzuweisen. Zwei SDA-Systeme wurden innerhalb des PCR-amplifizierten ORF6-Zielbereichs entworfen. Primer, die für die Verwendung in tSDA entwickelt wurden, sind in Tabelle 1 gezeigt. Ebenfalls gezeigt sind Signalprimer und eine Reportersonde für die Amplifikation und den Nachweis der resultierenden Amplikons. Die beispielhaften Restriktions-Endonuclease-Erkennungsstellen (BsoBI) in den Amplifikationsprimern sind in Halbfettdruck gezeigt, und die Zielbindungssequenzen sind kursiv gedruckt. Die Zielbindungssequenzen eines Amplifikationsprimers bestimmt dessen Zielspezifität.

Tabelle 1 Amplifikationsoligonucleotide Stromaufwärts-Primer

  • ORF6LP1: 5'-CGATTCCGCTCCAGACTTCTCGGGAATGCCTTGAGTTTTGA (SEQ ID NO: 1)
  • ORF6LP2: 5'-CGATTCCGCTCCAGACTTCTCGGGCAACCCCGGACCCA (SEQ ID NO: 2)

Stromabwärts-Primer

  • ORF6RP1: 5'-ACCGCATCGATTGACTGTCTCGGGAGACCCGGAAGTGTC (SEQ ID NO: 3)
  • ORF6RP2: 5'-ACCGCATCGATTGACTGTCTCGGGCACCGGTCAACTTTC (SEQ ID NO: 4)

Stromaufwärts-Bumperprimer

  • ORF6LB1: 5'-TTCGGACCAAAGTAAT (SEQ ID NO: 5)
  • ORF6LB2.1: 5'-AATGGGGTTGCTCA (SEQ ID NO: 6)

Stromabwärts-Bumperprimer

  • ORF6RB1:5'-GACATAGCTGGCGAA (SEQ ID NO:7)
  • ORF6RB2: 5'-ATCCAGGGGTTCAT (SEQ ID NO: 8)

Signalprimer

  • ORF6ADPT1: 5'-ACGTTAGCCACCATACGGATGAAGGCACTTAATGGCTCGCAG (SEQ ID NO: 9)
  • ORF6ADPT2: 5'-ACGTTAGCCACCATACGGATTCACCGGCTTTAAGCTCGATA (SEQ ID NO: 10)

Reportersonde

  • TBD10: 5'(dabcyl)TAGTGCCCGAGCACT(rhodamine)ACGTTAGCCACCATACGGAT (SEQ ID NO: 11)

PCR-Primer

  • ORF6Left PCR: 5'-TACAGGATCCACGAGTTCGGATCAAGGT (SEQ ID NO: 12)
  • ORF6Right PGR: 5'-ACGTAAGCTTTCGAATCCAGGGGTTCAT (SEQ ID NO: l3)

Da Nucleinsäuren keine vollständige Komplementarität erfordern, um zu hybridisieren, sollte man sich darüber im Klaren sein, dass die hier offenbarten Sonden- und Primersequenzen bis zu einem gewissen Grad modifiziert sein können, ohne ihre Eignung als M.-pneumoniae-spezifische Sonden und Primer zu verlieren. Wie in der Technik bekannt ist, kann eine Hybridisierung von komplementären und partiell komplementären Nucleinsäuresequenzen durch Einstellung der Hybridisierungsbedingungen unter Erhöhung oder Erniedrigung der Stringenz erhalten werden (d.h. Einstellung des Hybridisierungs-pH, der Temperatur oder des Salzgehalts des Puffers). Solche kleineren Modifikationen der offenbarten Sequenzen sowie alle notwendigen Einstellungen der Hybridisierungsbedingungen unter Aufrechterhaltung der M.-pneumoniae-Spezifität erfordern nur Routineversuche, die der Fachmann leicht durchführen kann.

Die unter Verwendung der hier offenbarten Primer erzeugten Amplifikationsprodukte können anhand einer charakteristischen Größe nachgewiesen werden, zum Beispiel, wie es in 2 und 3 gezeigt ist, auf Polyacrylamid- oder Agarose-Gelen, die mit Ethidiumbromid angefärbt sind. Alternativ dazu können amplifizierte Zielsequenzen mittels einer Assaysonde nachgewiesen werden, bei der es sich um ein Oligonucleotid handelt, das mit einem nachweisbaren Marker markiert ist. In einer Ausführungsform kann wenigstens eine markierte Assaysonde zum Nachweis amplifizierter Zielsequenzen durch Hybridisierung (eine Detektorsonde), durch Hybridisierung und Verlängerung, wie es von Walker et al. beschrieben wurde (1992, Nucl. Acids Res. 20: 1691–1696) (ein Detektorprimer), oder durch Hybridisierung, Verlängerung und Umwandlung in eine doppelsträngige Form, wie es in der EP 0 678 582 beschrieben wurde (ein Signalprimer), verwendet werden.

Eine bevorzugte Ausführungsform für den Nachweis des amplifizierten Ziels ist schematisch in 1 gezeigt. In dieser Ausführungsform besteht die 5'-Schwanzsequenz des Signalprimers aus einer Sequenz, die nicht mit dem Ziel (der Adaptersequenz) hybridisiert. Die Adaptersequenz ist ein indirekt nachweisbarer Marker, der so ausgewählt werden kann, dass sie bei einer Vielzahl von Signalprimern, die unterschiedliche 3'-Zielbindungssequenzen aufweisen, dieselbe ist (d.h. eine "universelle" 5'-Schwanzsequenz). Oligonucleotide mit SEQ ID Nr. 9 und 10 sind als Signalprimer in Verbindung mit den Amplifikationsprimern der Erfindung zum Nachweis von M.-pneumoniae-Organismen besonders gut geeignet. Vorzugsweise ist eine Assaysonde eine einzelne Reportersondensequenz, die mit dem Komplement der Adaptersequenz der Signalprimer der Erfindung hybridisiert. Ein Oligonucleotid mit der Sequenz SEQ ID Nr. 11 ist als Reportersonde besonders gut geeignet, wenn es in Verbindung mit den Signalprimern der Erfindung zum Nachweis von M. pneumoniae verwendet wird. Alternativ dazu kann eine Assaysonde so ausgewählt werden, dass sie mit einer Sequenz im Ziel hybridisiert, die sich zwischen den Amplifikationsprimern befindet. In einer weiteren Ausführungsform kann ein Amplifikationsprimer oder seine Zielbindungssequenz als Assaysonde verwendet werden.

Der nachweisbare Marker der Assaysonde ist eine Struktureinheit, die entweder direkt oder indirekt als Hinweis auf die Gegenwart der Zielnucleinsäure nachgewiesen werden kann. Für einen direkten Nachweis des Markers können Assaysonden mit einem Radioisotop markiert sein und durch Autoradiographie nachgewiesen werden, oder sie können mit einer Fluoreszenz-Struktureinheit markiert sein und durch Fluoreszenz nachgewiesen werden, wie in der Technik bekannt ist. Alternativ dazu können die Assaysonden auch indirekt nachgewiesen werden, indem man sie mit einem Marker markiert, der zusätzliche Reagentien erfordert, um nachweisbar zu sein. Zu den indirekt nachweisbaren Markern gehören zum Beispiel chemilumineszierende Mittel, Enzyme, die sichtbare Reaktionsprodukte erzeugen, sowie Liganden (z.B. Haptene, Antikörper oder Antigene), die durch Bindung an markierte spezifische Bindungspartner (z.B. Antikörper oder Antigene/Haptene) nachgewiesen werden können. Liganden sind auch geeignet, um das ligandmarkierte Oligonucleotid (die Abfangsonde) auf einer festen Phase zu immobilisieren und so seinen Nachweis zu erleichtern. Zu den besonders gut geeigneten Markern gehören Biotin (nachweisbar durch Bindung an markiertes Avidin oder Streptavidin) sowie Enzyme wie Meerrettich-Peroxidase oder Alkalische Phosphatase (nachweisbar durch Hinzufügen von Enzymsubstraten, so dass farbige Reaktionsprodukte entstehen). Verfahren zur Addition solcher Marker an oder zum Einbau solcher Marker in Oligonucleotide sind in der Technik wohlbekannt, und alle diese Verfahren sind für die Verwendung in der vorliegenden Erfindung geeignet.

Beispiele für spezielle Nachweisverfahren, die eingesetzt werden können, sind ein Chemilumineszenzverfahren, bei dem amplifizierte Produkte unter Verwendung einer biotinylierten Abfangsonde und einer enzymkonjugierten Detektorsonde nachgewiesen werden, wie es im US-Patent Nr. 5,470,723 beschrieben ist. Nach der Hybridisierung dieser beiden Assaysonden mit verschiedenen Stellen im Assaybereich der Zielsequenz (zwischen den Bindungsstellen für die beiden Amplifikationsprimer) wird der Komplex mit Hilfe der Abfangsonde auf einer streptavidinbeschichteten Mikrotiterplatte abgefangen, und das chemilumineszente Signal wird entwickelt und in einem Luminometer abgelesen. Als weitere Alternative für den Nachweis von Amplifikationsprodukten kann bei der SDA-Reaktion ein Signalprimer mitverwendet werden, wie er in EP 0 678 582 beschrieben ist. Bei noch einer weiteren Alternative zum Nachweis von Amplifikationsprodukten kann der Signalprimer Sequenzen enthalten, die nicht mit der Zielsequenz, d.h. der Adaptersequenz, hybridisieren. In dieser Ausführungsform, wie sie in 1 gezeigt ist, kann eine Reportersonde mit assoziiertem Marker mit dem Komplement der Adaptersequenz hybridisieren. In beiden Ausführungsformen des Signalprimers werden sekundäre Amplifikationsprodukte während der SDA in einer zielamplifikationsabhängigen Weise erzeugt und können als Hinweis auf die Zielamplifikation nachgewiesen werden.

Wegen der kommerziellen Zweckmäßigkeit können Amplifikationsprimer für den spezifischen Nachweis und die Identifizierung von Nucleinsäuren in Form eines Kits verpackt sein. Typischerweise enthält ein solcher Kit wenigstens ein Paar Amplifikationsprimer. Reagentien zur Durchführung einer Nucleinsäureamplifikationsreaktion können den zielspezifischen Amplifikationsprimern ebenfalls zugegeben werden, zum Beispiel Puffer, zusätzliche Primer, Nucleotidtriphosphate, Enzyme usw. Die Komponenten des Kits sind zusammen in einem gemeinsamen Behälter verpackt, der gegebenenfalls auch Anweisungen zur Durchführung einer speziellen Ausführungsform der erfindungsgemäßen Verfahren enthält. Weitere wahlfreie Komponenten können ebenfalls in dem Kit enthalten sein, z.B. ein mit einem Marker markiertes Oligonucleotid, das sich zur Verwendung als Assaysonde eignet, und/oder Reagentien oder Mittel zum Nachweis des Markers.

Für die vorliegende Erfindung kann ein solcher Kit so konfiguriert sein, dass er die notwendigen Komponenten für eine Palette von Atemwegsorganismen bereitstellt. Eine solche Atemwegspalette kann Bordetella pertussis, Legionella pneumophila, M. pneumoniae und Organismen der Familie Chlamydiaceae neben anderen Mikroorganismen, die eine Atemwegsinfektion verursachen können, umfassen. Ein solcher Atemwegspalettenkit würde also die Primer für die Amplifikation einer Nucleinsäuresequenz umfassen, die für die Organismen der Atemwegspalette jeweils spezifisch sind. Geeignete Primer, Bumper, Signalprimer und Reportersonden zum Amplifizieren und Nachweisen von B. pertussis, L. pneumophila und Organismen der Familie Chlamydiaceae sind in der gleichzeitig anhängigen US-Patentanmeldung Serial No. 09/626,855, die am 27. Juli 2000 eingereicht wurde, in der gleichzeitig anhängigen US-Patentanmeldung Serial No. 09/626,354, die am 27. Juli 2000 eingereicht wurde, und in der gleichzeitig anhängigen US-Patentanmeldung Serial No. 09/708,208, die am 8. November 2000 eingereicht wurde, beschrieben. Wenn er verwendet wird, kann ein solcher Atemwegspalettenkit getrennte Amplifikationsreaktionen für jeden Organismus oder eine oder mehrere Multiplex-Amplifikationsreaktionen ermöglichen, um Ergebnisse zu liefern, die auf die Anwesenheit oder Abwesenheit jedes der Organismen der Palette hinweisen.

Die Zielbindungssequenzen der Amplifikationsprimer verleihen den Oligonucleotiden Artspezifität der Hybridisierung und verleihen der Amplifikationsreaktion daher Artspezifität. Die Zielbindungssequenzen der Amplifikationsprimer der Erfindung eignen sich also auch für andere Nucleinsäure-Amplifikationsvorschriften, wie PCR, herkömmliche SDA (ein Reaktionsschema, das im Wesentlichen dasselbe ist wie bei tSDA, aber unter Verwendung von mesophilen Enzymen bei niedrigeren Temperaturen durchgeführt wird), 3SR, NASBA, TAS und RCA. Insbesondere können die Zielbindungssequenzen der Erfindung für jede Amplifikationsvorschrift eingesetzt werden, die eine zyklische spezifische Hybridisierung von Primern mit der Zielsequenz, eine Verlängerung der Primer unter Verwendung der Zielsequenz als Matrize und eine Abtrennung oder Verdrängung der Verlängerungsprodukte von der Zielsequenz verwenden. Für Amplifikationsverfahren, die keine speziellen Nichtzielbindungssequenzen erfordern (z.B. PCR), können die Amplifikationsprimer auch im Wesentlichen aus den Zielbindungssequenzen der Amplifikationsprimer bestehen, die in Tabelle 1 aufgeführt sind.

Weitere Sequenzen, wie sie für die Durchführung einer ausgewählten Amplifikationsreaktion erforderlich sind, können gegebenenfalls zu den hier offenbarten Zielbindungssequenzen hinzugefügt werden, ohne die Artspezifität des Oligonucleotids zu verändern. Zum Beispiel können die spezifischen Amplifikationsprimer eine Erkennungsstelle für die Restriktions-Endonuclease BsoBI enthalten, die während der SDA-Reaktion einen Einzelstrangbruch erfährt. Der Fachmann wird sich darüber im Klaren sein, dass auch andere einzelstrangbruchfähige Restriktions-Endonuclease-Erkennungsstellen anstelle der BsoBI-Erkennungsstelle verwendet werden können; dazu gehören unter anderem die in EP 0 684 315 offenbarten Erkennungsstellen. Vorzugsweise gehört die Erkennungsstelle zu einer thermophilen Restriktions-Endonuclease, so dass die Amplifikationsreaktion unter den Bedingungen einer tSDA durchgeführt werden kann. Ähnlich ist auch die Schwanzsequenz des Amplifikationsprimers (5' von der Restriktions-Endonuclease-Erkennungsstelle) im Allgemeinen nicht entscheidend, obwohl die für die SDA verwendete Erkennungsstelle und Sequenzen, die entweder mit ihrer eigenen Zielbindungssequenz oder mit den anderen Primern hybridisieren, vermieden werden sollten. Einige Amplifikationsprimer für die SDA bestehen daher aus 3'-Zielbindungssequenzen, einer einzelstrangbruchfähigen Restriktions-Endonuclease-Erkennungsstelle 5' von der Zielbindungssequenz und einer Schwanzsequenz mit einer Länge von etwa 10–25 Nucleotiden 5' von der Restriktions-Endonuclease-Erkennungsstelle. Die einzelstrangbruchfähige Restriktions-Endonuclease-Erkennungsstelle und die Schwanzsequenz sind Sequenzen, die für die SDA-Reaktion erforderlich sind. Wie in der US-Patentanmeldung Serial No. 09/573,242, die am 18. Mai 2000 eingereicht wurde, beschrieben ist, können einige Amplifikationsprimer für die SDA aus zielspezifischen Sequenzen sowohl 5' als auch 3' von der Restriktionsenzym-Erkennungsstelle bestehen. Mit dieser Gestaltung kann eine Erhöhung der Effizienz der zielspezifischen Hybridisierung erreicht werden. Für andere Amplifikationsreaktionen (z.B. 3SR, NASBA, TAS und RCA) können die Amplifikationsprimer aus der Zielbindungssequenz und zusätzlichen Sequenzen, die für die ausgewählte Amplifikationsreaktion erforderlich sind (z.B. für die SDA erforderlichen Sequenzen, wie sie oben beschrieben sind, oder einem Promotor, der durch RNA-Polymerase erkannt wird, für 3SR), bestehen. Bei der Anpassung der Zielbindungssequenzen der Erfindung an andere Amplifikationsverfahren als SDA werden Routineverfahren zur Herstellung von Amplifikationsprimern, wie chemische Synthese, und die wohlbekannten strukturellen Anforderungen an die Primer der ausgewählten Amplifikationsreaktion eingesetzt. Die Zielbindungssequenzen der Erfindung können daher bei einer Vielzahl von Amplifikationsreaktionen leicht an die für den M.-pneumoniae-Organismus spezifische Zielamplifikation und -detektion angepasst werden, wobei man nur Routineverfahren für die Herstellung, Durchmusterung und Optimierung verwendet.

Bei der SDA sind die Bumperprimer für die Artspezifität nicht wesentlich, da sie die Funktion haben, die stromabwärts befindlichen artspezifischen Amplifikationsprimer zu verdrängen. Die Bumperprimer müssen nur mit dem Ziel stromaufwärts von den Amplifikationsprimern hybridisieren, so dass sie bei Verlängerung den Amplifikationsprimer und sein Verlängerungsprodukt verdrängen. Die besondere Sequenz des Bumperprimers ist daher im Allgemeinen nicht entscheidend und kann von jeder stromaufwärts gelegenen Zielsequenz abgeleitet sein, die ausreichend nahe bei der Bindungsstelle des Amplifikationsprimers liegt, um eine Verdrängung des Verlängerungsprodukts des Amplifikationsprimers bei der Verlängerung des Bumperprimers zu ermöglichen. Gelegentliche Fehlpaarungen mit dem Ziel in der Bumperprimersequenz oder ein bestimmtes Maß an Kreuzhybridisierung mit Nichtzielsequenzen beeinträchtigen die Amplifikationseffizienz im Allgemeinen nicht, solange der Bumperprimer noch in der Lage ist, mit der spezifischen Zielsequenz zu hybridisieren.

Bei Amplifikationsreaktionen unter Verwendung der Primer der Erfindung kann Thymin eingebaut werden, wie es von Walker et al. gelehrt wird (1992, Nucl. Acids Res. 20: 1691–1696), oder TTP kann in der Reaktion vollständig oder partiell durch 2'-Desoxyuridin-5'-triphosphat ersetzt werden, so dass die Kreuzkontamination anschließender Amplifikationsreaktionen reduziert wird, wie es z.B. in EP 0 624 643 gelehrt wird. dU (Uridin) wird in Amplifikationsprodukte eingebaut und kann durch Behandlung mit Uracil-DNA-Glycosylase (UDG) herausgeschnitten werden. Durch diese abasischen Stellen wird das Amplifikationsprodukt in anschließenden Amplifikationsreaktionen unamplifizierbar. Vor der Durchführung der anschließenden Amplifikation kann UDG durch Uracil-DNA-Glycosylase-Inhibitor (UGI) inaktiviert werden, um ein Herausschneiden von dU aus neu gebildeten Amplifikationsprodukten zu verhindern.

SDA ist ein isothermes Verfahren der Nucleinsäureamplifikation, bei dem die Verlängerung von Primern, die Erzeugung eines Einzelstrangbruchs an einer hemimodifizierten Erkennungs-/Spaltungsstelle einer Restriktions-Endonuclease, die Verdrängung einzelsträngiger Verlängerungsprodukte, die Assoziation von Primern mit den Verlängerungsprodukten (oder der ursprünglichen Zielsequenz) und die anschließende Verlängerung der Primer gleichzeitig in der Reaktionsmischung erfolgen. Dies steht im Gegensatz zur PCR, bei der die Schritte der Reaktion als Ergebnis der Temperaturzykluseigenschaft der Reaktion in diskreten Phasen oder Zyklen erfolgen. SDA beruht auf 1) der Fähigkeit einer Restriktions-Endonuclease, einen Einzelstrangbruch im unmodifizierten Strang einer Hemiphosphorothioat-Form ihrer doppelsträngigen Erkennungs-/Spaltungsstelle zu erzeugen, und 2) der Fähigkeit bestimmter Polymerasen, die Replikation am Einzelstrangbruch einzuleiten und den stromabwärts gelegenen Nichtmatrizenstrang zu verdrängen. Nach einer anfänglichen Inkubation bei erhöhter Temperatur (etwa 95°C), um doppelsträngige Zielsequenzen für die Assoziation der Primer zu denaturieren, erfolgen die anschließende Polymerisation und Verdrängung neu synthetisierter Stränge bei einer konstanten Temperatur. Die Erzeugung jeder neuen Kopie der Zielsequenz besteht aus fünf Schritten: 1) Bindung von Amplifikationsprimern an eine ursprüngliche Zielsequenz oder ein zuvor polymerisiertes, verdrängtes einzelsträngiges Verlängerungsprodukt, 2) Verlängerung der Primer durch eine Polymerase ohne 5'→3'-Exonuclease-Funktion, die ein &agr;-Thiodesoxynucleosidtriphosphat (&agr;-Thio-dNTP) einbaut, 3) Erzeugung eines Einzelstrangbruchs in einer hemimodifizierten doppelsträngigen Erkennungsstelle, 4) Dissoziation des Restriktionsenzyms von dem Einzelstrangbruch und 5) Verlängerung vom 3'-Ende des Einzelstrangbruchs her durch die Polymerase ohne 5'→3'-Exonuclease-Funktion unter Verdrängung des stromabwärts befindlichen, neu synthetisierten Strangs. Die Erzeugung von Einzelstrangbrüchen, Polymerisation und Verdrängung erfolgen gleichzeitig und kontinuierlich bei einer konstanten Temperatur, da die Verlängerung ausgehend von dem Einzelstrangbruch eine weitere spaltbare Restriktionsstelle regeneriert. Wenn ein Paar von Amplifikationsprimern verwendet wird, von denen jeder mit einem der beiden Stränge einer doppelsträngigen Zielsequenz hybridisiert, verläuft die Amplifikation exponentiell. Der Grund dafür ist, dass der Sense- und der Antisense-Strang in anschließenden Amplifikationsrunden als Matrizen für den entgegengesetzten Primer dienen. Wenn ein einzelner Amplifikationsprimer verwendet wird, erfolgt die Amplifikation linear, da nur ein Strang als Matrize für die Primerverlängerung dient. Beispiele für Restriktions-Endonucleasen, die einen Einzelstrangbruch in ihren doppelsträngigen Erkennungs-/Spaltungsstellen erzeugen, wenn ein &agr;-Thio-dNTP eingebaut wird, sind HincII, HindII, AvaI., NciI und Fnu4HI. Alle diese Restriktions-Endonucleasen und andere, die die erforderliche spaltende Wirkung haben, sind zur Verwendung in der herkömmlichen SDA geeignet. Sie sind jedoch relativ thermolabil und verlieren oberhalb von etwa 40°C ihre Aktivität.

Ziele für die Amplifikation durch SDA können hergestellt werden, indem man größere Nucleinsäuren durch Restriktion mit einer Endonuclease fragmentiert, welche die Zielsequenz nicht schneidet. Es wird jedoch allgemein bevorzugt, dass Zielnucleinsäuren mit ausgewählten Restriktions-Endonuclease-Erkennungs-/Spaltungsstellen für die Erzeugung des Einzelstrangbruchs in der SDA-Reaktion so erzeugt werden, wie es von Walker et al. (1992, Nucl. Acids Res. 20: 1691–1696) und im US-Patent Nr. 5,270,184 (auf das hier ausdrücklich Bezug genommen wird) beschrieben ist. Kurz gesagt, wenn die Zielsequenz doppelsträngig ist, werden vier Primer damit hybridisiert. Zwei der Primer (S1 und S2) sind SDA-Amplifikationsprimer, und zwei (B1 und B2) sind externe oder Bumperprimer. S1 und S2 binden an entgegengesetzte Stränge von doppelsträngigen Nucleinsäuren, die die Zielsequenz flankieren. B1 und B2 binden an die Zielsequenz 5' (d.h. stromaufwärts) von S1 bzw. S2. Dann wird die Polymerase ohne Exonucleasefunktion verwendet, um in Gegenwart von drei Desoxynucleosidtriphosphaten und wenigstens einem modifizierten Desoxynucleosidtriphosphat (z.B. 2'-Desoxyadenosin-5'-O-(1-thiotriphosphat), "dATP&agr;S") alle vier Primer gleichzeitig zu verlängern. Die Verlängerungsprodukte von S1 und S2 werden dabei durch die Verlängerung von B1 und B2 von der ursprünglichen Zielsequenzmatrize verdrängt. Die verdrängten einzelsträngigen Verlängerungsprodukte der Amplifikationsprimer dienen als Ziele für die Bindung der entgegengesetzten Amplifikations- und Bumperprimer (z.B. bindet das Verlängerungsprodukt von S1 an S2 und B2). Der nächste Zyklus der Verlängerung und Verdrängung führt zu zwei doppelsträngigen Nucleinsäurefragmenten mit hemimodifizierten Restriktions-Endonuclease-Erkennungs-/Spaltungsstellen an jedem Ende. Diese sind geeignete Substrate für die Amplifikation durch SDA. Wie bei der SDA finden die einzelnen Schritte der Zielerzeugungsreaktion gleichzeitig und kontinuierlich statt, wobei Zielsequenzen mit den Erkennungs-/Spaltungssequenzen an den Enden entstehen, welche für die Erzeugung des Einzelstrangbruchs durch das Restriktionsenzym bei der SDA erforderlich sind. Da alle Komponenten der SDA-Reaktion bereits in der Zielerzeugungsreaktion vorhanden sind, treten automatisch und kontinuierlich erzeugte Zielsequenzen in den SDA-Zyklus ein und werden amplifiziert.

Zur Verhinderung einer Kreuzkontaminierung einer SDA-Reaktion durch die Amplifikationsprodukte einer anderen kann dUTP anstelle von dTTP in SDA-amplifizierte DNA eingebaut werden, ohne die Amplifikationsreaktion zu hemmen. Dann können die uracilmodifizierten Nucleinsäuren spezifisch erkannt und durch Behandlung mit Uracil-DNA-Glycosylase (UDG) inaktiviert werden. Wenn daher dUTP in einer früheren Reaktion in SDA-amplifizierte DNA eingebaut wird, können alle anschließenden SDA-Reaktionen vor der Amplifikation von doppelsträngigen Zielen mit UDG behandelt werden, und jede dU-haltige DNA aus früher amplifizierten Reaktionen wird unamplifizierbar gemacht. Die in der anschließenden Reaktion zu amplifizierende Ziel-DNA enthält kein dU und wird durch die UDG-Behandlung nicht beeinträchtigt. Dann kann UDG vor der Amplifikation des Ziels durch Behandlung mit UGI gehemmt werden. Alternativ dazu kann UDG auch thermisch inaktiviert werden. In der tSDA kann die höhere Temperatur der Reaktion selbst (≥ 50°C) gleichzeitig verwendet werden, um UDG zu inaktivieren und das Ziel zu amplifizieren.

SDA erfordert eine Polymerase, der die 5'→3'-Exonuclease-Aktivität fehlt, die die Polymerisation an einem Einzelstrangbruch in doppelsträngigen Nucleinsäuren einleitet und den Strang stromabwärts des Einzelstrangbruchs verdrängt, während sie einen neuen komplementären Strang erzeugt und dabei den nicht gebrochenen Strang als Matrize verwendet. Die Polymerase muss verlängern, indem sie Nucleotide an eine freie 3'-OH-Gruppe addiert. Um die SDA-Reaktion zu optimieren, ist es auch wünschenswert, dass die Polymerase hochgradig prozessiv ist, um die Länge der Zielsequenz, die amplifiziert werden kann, zu maximieren. Hochgradig prozessive Polymerasen können neue Stränge mit erheblicher Länge polymerisieren, bevor sie abdissoziieren und die Synthese des Verlängerungsprodukts beenden. Die Verdrängungswirkung ist für die Amplifikationsreaktion wesentlich, da sie das Ziel für die Synthese weiterer Kopien verfügbar macht und das einzelsträngige Verlängerungsprodukt erzeugt, an das bei exponentiellen Amplifikationsreaktionen ein zweiter Amplifikationsprimer hybridisieren kann. Die einzelstrangspaltende Wirkung des Restriktionsenzyms ist ebenfalls von großer Wichtigkeit, da diese Einzelstrangbrüche die Reaktion fortbestehen lassen und die Einleitung anschließender Runden der Zielamplifikation ermöglichen.

tSDA wird im Wesentlichen als herkömmliche SDA durchgeführt, wie sie von Walker et al. beschrieben ist (1992, Proc. Natl. Acad. Sci. USA 89: 392–396, und 1992, Nucl. Acids Res. 20: 1691–1696), wobei eine Polymerase und eine Restriktions-Endonuclease verwendet werden, die bei höheren Temperaturen stabil bleiben als die bei der SDA verwendeten Enzyme. Selbstverständlich wird die Temperatur der Reaktion auf die höhere Temperatur eingestellt, die für die verwendeten Enzyme geeignet ist, und die Erkennungs-/Spaltungsstelle der HincII-Restriktions-Endonuclease wird durch die geeignete Erkennungs/Spaltungsstelle der Restriktions-Endonuclease für die ausgewählte thermostabile Endonuclease ersetzt. Ebenfalls im Gegensatz zu Walker et al. kann der praktische Anwender die Enzyme schon vor dem anfänglichen Denaturierungsschritt mit in das Reaktionsgemisch aufnehmen, wenn sie bei der Denaturierungstemperatur ausreichend stabil sind. Bevorzugte Restriktions-Endonucleasen für die Verwendung bei der tSDA sind BsrI, BstNI, BsmAI, BslI und BsoBI (New England BioLabs) und BstOI (Promega). Die bevorzugten Polymerasen für tSDA sind Bca (Panvera) und Bst (New England BioLabs).

Weiterhin können SDA- und tSDA-Reaktionen zum Amplifizieren längerer Nucleinsäureziele (z.B. Nucleinsäuremoleküle mit einer Länge von mehr als etwa 100 Basenpaaren) verstärkt werden, indem man ein DNA-bindendes Protein, wie gp32, im Reaktionsgemisch mitverwendet. Diese Technik ist dem Fachmann aufgrund ihrer gründlichen Beschreibung in der Europäischen Patentanmeldung Veröffentlichungs-Nr. 0 869 187 A2 bekannt.

Homogene Echtzeit-Fluoreszenz-tSDA ist eine Modifikation der tSDA. Sie verwendet Detektoroligonucleotide, um ein reduziertes Fluoreszenzquenchen in einer zielabhängigen Weise zu erzeugen. Die Detektoroligonucleotide enthalten ein Donor/Akzeptor-Farbstoffpaar, das so miteinander verknüpft ist, dass in Abwesenheit des Ziels ein Fluoreszenzquenchen erfolgt. Die Entfaltung oder Linearisierung einer intramolekular basengepaarten Sekundärstruktur im Detektoroligonucleotid in Gegenwart des Ziels erhöht den Abstand zwischen den Farbstoffen und reduziert das Fluoreszenzquenchen. Die Entfaltung der basengepaarten Sekundärstruktur beinhaltet typischerweise eine intermolekulare Basenpaarung zwischen der Sequenz der Sekundärstruktur und einem komplementären Strang, so dass die Sekundärstruktur wenigstens zum Teil zerstört wird. Sie kann in Gegenwart eines komplementären Stranges ausreichender Länge vollständig linearisiert werden. In einer bevorzugten Ausführungsform befindet sich eine Erkennungsstelle einer Restriktions-Endonuclease (RERS) zwischen den beiden Farbstoffen, so dass eine intermolekulare Basenpaarung zwischen der Sekundärstruktur und einem komplementären Strang die RERS ebenfalls doppelsträngig und durch eine Restriktions-Endonuclease spaltbar macht. Durch die Spaltung durch die Restriktions-Endonuclease werden der Donor- und der Akzeptorfarbstoff auf getrennte Nucleinsäurefragmente aufgeteilt, was weiter zu einem reduzierten Quenchen beiträgt. In beiden Ausführungsformen wird eine damit einhergehende Änderung eines Fluoreszenzparameters (z.B. eine Erhöhung der Donorfluoreszenzintensität, eine Abnahme der Akzeptorfluoreszenzintensität oder ein Fluoreszenzverhältnis vor und nach der Entfaltung) als Hinweis auf die Anwesenheit der Zielsequenz überwacht. Die Überwachung einer Änderung in der Donorfluoreszenzintensität ist bevorzugt, da diese Änderung typischerweise größer ist als die Änderung der Akzeptorfluoreszenzintensität. Andere Fluoreszenzparameter, wie eine Änderung in der Fluoreszenzlebensdauer, können ebenfalls überwacht werden. "Spaltung eines Oligonucleotids" bezieht sich auf das Aufbrechen der Phosphodiesterbindungen beider Stränge eines DNA-Duplex oder das Aufbrechen der Phosphodiesterbindung von einzelsträngiger DNA. Dies steht im Gegensatz zum Einzelstrangbruch, der sich auf das Aufbrechen der Phosphodiesterbindung nur eines der beiden Stränge in einem DNA-Duplex bezieht.

Ein Detektoroligonucleotid für die homogene Echtzeit-Fluoreszenz-tSDA kann ein Oligonucleotid sein, das sowohl einen einzelsträngigen 5'- oder 3'-Abschnitt, der mit der Zielsequenz hybridisiert (die Zielbindungssequenz), als auch eine intramolekular basengepaarte Sekundärstruktur neben der Zielbindungssequenz umfasst. In einer bevorzugten Ausführungsform, wie sie in 1 gezeigt ist, ist das Detektoroligonucleotid eine Reportersonde, die einen einzelsträngigen 5'- oder 3'-Abschnitt umfasst, der nicht mit der Zielsequenz hybridisiert. Stattdessen hybridisiert der einzelsträngige 5'- oder 3'-Abschnitt mit dem Komplement der Signalprimer-Adaptersequenz (der Adapterkomplement-bindenden Sequenz). Ein weiteres Merkmal der Reportersonde besteht darin, dass sich dieser hybridisierende Abschnitt neben einer intramolekular basengepaarten Sekundärstruktur befindet. Die Detektoroligonucleotide der Erfindung umfassen weiterhin ein Donor/Akzeptor-Farbstoffpaar, das mit dem Detektoroligonucleotid verknüpft ist, so dass die Donorfluoreszenz gelöscht wird, wenn die Sekundärstruktur intramolekular basengepaart ist und die Entfaltung oder Linearisierung der Sekundärstruktur zu einer Abnahme des Fluoreszenzquenchens führt.

Die Detektoroligonucleotide der Erfindung für die homogene Echtzeit-Fluoreszenz-tSDA umfassen eine Sequenz, die unter den ausgewählten Reaktionsbedingungen für die Primerverlängerung oder -hybridisierung eine intramolekular basengepaarte Sekundärstruktur bildet. In einer Ausführungsform kann sich die Sekundärstruktur neben der Zielbindungssequenz des Detektoroligonucleotids befinden, so dass wenigstens ein Teil der Zielbindungssequenz einen einzelsträngigen 3'- oder 5'-Schwanz bildet. In einer bevorzugten Ausführungsform, wie sie in 1 gezeigt ist, befindet sich die Sekundärstruktur neben der Adapterkomplement-bindenden Sequenz des Reportersonden-Detektoroligonucleotids, so dass wenigstens ein Teil der Adapterkomplement-bindenden Sequenz einen einzelsträngigen 3'- oder 5'-Schwanz bildet. Der hier verwendete Ausdruck "neben der Zielbindungssequenz" oder "neben der Adapterkomplement-bindenden Sequenz" bedeutet, dass die gesamte oder ein Teil der Zielbindungssequenz/Adapterkomplement-bindenden Sequenz in einem 5'- oder 3'-Schwanz, der für die Hybridisierung mit dem Ziel/Adapter-Komplement zur Verfügung steht, einzelsträngig zurückbleibt. Das heißt, die Sekundärstruktur umfasst nicht die gesamte Zielbindungssequenz/Adapterkomplement-bindende Sequenz. Ein Teil der Zielbindungssequenz/Adapterkomplement-bindenden Sequenz kann an der intramolekularen Basenpaarung in der Sekundärstruktur beteiligt sein, sie kann die Gesamtheit oder einen Teil einer ersten Sequenz beinhalten, die an der intramolekularen Basenpaarung in der Sekundärstruktur beteiligt ist, aber vorzugsweise nicht in ihre komplementäre Sequenz hineinragt. Wenn die Sekundärstruktur zum Beispiel eine Stamm-Schleifen-Struktur ist (z.B. eine "Haarnadel") und die Zielbindungssequenz/Adapterkomplement-bindende Sequenz des Detektoroligonucleotids als einzelsträngiger 3'-Schwanz vorliegt, kann die Zielbindungssequenz/Adapterkomplement-bindende Sequenz sich auch durch den gesamten oder einen Teil des ersten Arms des Stammes sowie gegebenenfalls durch die gesamte oder einen Teil der Schleife erstrecken. Die Zielbindungssequenz/Adapterkomplement-bindende Sequenz erstreckt sich jedoch vorzugsweise nicht in den zweiten Arm der Sequenz, die an der intramolekularen Basenpaarung im Stamm beteiligt ist. Das heißt, es ist wünschenswert, zu vermeiden, dass beide Sequenzen an der intramolekularen Basenpaarung in einer Sekundärstruktur beteiligt sind, die zur Hybridisierung mit dem Ziel/Adapter-Komplement befähigt ist. Fehlpaarungen im intramolekular basengepaarten Teil der Sekundärstruktur des Detektoroligonucleotids können die Größe der Fluoreszenzänderung in Gegenwart des Ziels reduzieren, sind jedoch akzeptabel, wenn es auf die Assayempfindlichkeit nicht ankommt. Fehlpaarungen in der Zielbindungssequenz/Adapterkomplement-bindenden Sequenz des einzelsträngigen Schwanzes sind ebenfalls akzeptabel, können jedoch in ähnlicher Weise die Assayempfindlichkeit und/oder -spezifität reduzieren. Es ist jedoch ein Merkmal der vorliegenden Erfindung, dass eine perfekte Basenpaarung sowohl in der Sekundärstruktur als auch in der Zielbindungssequenz/Adapterkomplementbindenden Sequenz die Reaktion nicht beeinträchtigen. Perfekte Paarungen in den an der Hybridisierung beteiligten Sequenzen verbessern die Assayspezifität ohne negative Auswirkungen auf die Reaktionskinetik.

Wenn man sie zu der Amplifikationsreaktion gibt, wird die Detektoroligonucleotid-Reportersonde der Erfindung durch Hybridisierung und Verlängerung, wie es in 1 gezeigt ist, in die doppelsträngige Form umgewandelt. Durch die Strangverdrängung durch die Polymerase wird außerdem die Sekundärstruktur entfaltet oder linearisiert und durch Synthese eines komplementären Stranges in die doppelsträngige Form umgewandelt. Falls ein RERS vorhanden ist, wird es ebenfalls doppelsträngig und durch die Restriktions-Endonuclease spaltbar. Wenn die Sekundärstruktur durch die strangverdrängende Aktivität der Polymerase entfaltet oder linearisiert wird, nimmt der Abstand zwischen dem Donor- und dem Akzeptorfarbstoff zu, wodurch das Quenchen der Donorfluoreszenz reduziert wird. Die damit verbundene Änderung der Fluoreszenz entweder des Donor- oder des Akzeptorfarbstoffs kann als Hinweis auf eine Amplifikation der Zielsequenz überwacht oder nachgewiesen werden. Die Spaltung des RERS erhöht die Größe der Fluoreszenzänderung im Allgemeinen noch weiter, indem zwei getrennte Fragmente des doppelsträngigen sekundären Amplifikationsprodukts erzeugt werden, an die jeweils einer der beiden Farbstoffe geknüpft ist. Diese Fragmente können frei in die Reaktionslösung diffundieren, was den Abstand zwischen den Farbstoffen des Donor/Akzeptor-Paars weiter erhöht. Eine Erhöhung der Donorfluoreszenzintensität oder eine Abnahme der Akzeptorfluoreszenzintensität kann als Hinweis darauf nachgewiesen und/oder überwacht werden, dass eine Amplifikation des Ziels stattfindet oder stattgefunden hat, aber andere Fluoreszenzparameter, die durch die Nähe des Donor/Akzeptor-Farbstoffpaars beeinflusst werden, können ebenfalls überwacht werden. Eine Änderung der Fluoreszenzintensität des Donors oder Akzeptors kann auch als Änderung eines Verhältnisses von Donor- und/oder Akzeptorfluoreszenzintensität nachgewiesen werden. Zum Beispiel kann eine Änderung der Fluoreszenzintensität nachgewiesen werden als a) Erhöhung des Verhältnisses der Donorfluorophor-Fluoreszenz nach der Linearisierung oder Entfaltung der Sekundärstruktur und der Donorfluorophor-Fluoreszenz im Detektoroligonucleotid vor der Linearisierung oder Entfaltung oder b) Senkung des Verhältnisses der Akzeptorfarbstoff-Fluoreszenz nach der Linearisierung oder Entfaltung und der Akzeptorfarbstoff-Fluoreszenz im Detektoroligonucleotid vor der Linearisierung oder Entfaltung.

Daraus geht hervor, dass die Detektoroligonucleotide der Erfindung neben der SDA auch zur Verwendung beim Nachweis von Amplikons bei anderen Primerverlängerungs-Amplifikationsverfahren (z.B. PCR, 3SR, TAS oder NASBA) angepasst werden können. Zum Beispiel können die Verfahren zur Verwendung bei der PCR angepasst werden, indem man PCR-Amplifikationsprimer sowie eine strangverdrängende DNA-Polymerase, der die 5'→3'-Exonuclease-Aktivität fehlt (z.B. Sequencing Grade Taq von Promega oder exo- Vent oder exo Deep Vent von New England BioLabs), in der PCR verwendet. Die Signalprimer hybridisieren mit dem Ziel wenigstens teilweise stromabwärts von den PCR-Amplifikationsprimern, werden verdrängt und nach der Hybridisierung mit der Detektoroligonucleotid-Reportersonde und anschließenden Verlängerung doppelsträngig gemacht. Bei der PCR kann gegebenenfalls jedes beliebige RERS zur Verwendung im Detektor-Oligonucleotid ausgewählt werden, da typischerweise keine modifizierten Desoxynucleosidtriphosphate vorhanden sind, die anstelle einer Spaltung des RERS einen Einzelstrangbruch induzieren könnten. Da thermische Zyklen ein Merkmal der Amplifikation durch PCR sind, wird die Restriktions-Endonuclease für die Endpunktbestimmung der Amplifikation vorzugsweise nach dem letzten Zyklus der Primerassoziation und -verlängerung bei niedriger Temperatur hinzugefügt. Während der Amplifikation könnte jedoch auch eine thermophile Restriktions-Endonuclease vorhanden sein, die während der Hochtemperaturphasen der PCR-Reaktion aktiv bleibt, so dass man einen Echtzeitassay erhält. Wie bei SDA-Systemen reduziert die Trennung des Farbstoffpaars das Fluoreszenzquenchen, wobei eine Änderung eines Fluoreszenzparameters, wie der Intensität, als Hinweis auf die Amplifikation des Ziels dient.

Die Fluoreszenzänderung, die aus der Entfaltung oder Linearisierung der Detektoroligonucleotide resultiert, kann an einem ausgewählten Endpunkt der Reaktion nachgewiesen werden. Da linearisierte Sekundärstrukturen jedoch gleichzeitig mit der Hybridisierung oder Primerverlängerung erzeugt werden, kann die Fluoreszenzänderung auch überwacht werden, während die Reaktion abläuft, d.h. in "Echtzeit". Dieses homogene Echtzeit-Assayformat kann verwendet werden, um halbquantitative oder quantitative Informationen über die ursprünglich vorhandene Menge des Ziels zu erhalten. Zum Beispiel ist die Geschwindigkeit, mit der sich die Fluoreszenzintensität während der Entfaltungs- oder Linearisierungsreaktion (entweder als Teil der Zielamplifikation oder in Nachweisverfahren ohne Amplifikation) ändert, ein Hinweis auf die ursprünglichen Zielmengen. Als Ergebnis erreicht die Donorfluoreszenz schneller einen ausgewählten Schwellenwert (d.h. kürzere Zeit bis zur Positivität), wenn mehr ursprüngliche Kopien der Zielsequenz vorhanden waren. Die Abnahme der Akzeptorfluoreszenz weist in ähnlicher Weise eine kürzere Zeit bis zur Positivität auf, welche nachgewiesen wird als die Zeit, die zum Erreichen eines ausgewählten Minimalwertes erforderlich ist. Außerdem ist die Geschwindigkeit der Änderung der Fluoreszenzparameter im Verlaufe der Reaktion größer bei Proben, die größere Anfangsmengen des Ziels enthalten, als bei Proben, die kleinere Anfangsmengen des Ziels enthalten (d.h. erhöhte Steigung der Fluoreszenzkurve). Diese oder andere Messungen, die in der Technik bekannt sind (z.B. US-Patent Nr. 5,928,907, US-Patentanmeldung Serial No. 09/196,123, eingereicht am 20. November 1998, und US-Patentanmeldung Serial No. 09/574,031, eingereicht am 19. Mai 2000, auf die alle hier ausdrücklich Bezug genommen wird), können als Hinweis auf die Gegenwart des Ziels oder als Hinweis auf eine Amplifikation des Ziels vorgenommen werden. Die Anfangsmenge des Ziels wird typischerweise durch Vergleich der experimentellen Ergebnisse mit Ergebnissen für bekannte Zielmengen bestimmt.

Assays auf die Anwesenheit einer ausgewählten Zielsequenz gemäß den Verfahren der Erfindung können in Lösung oder auf einer festen Phase durchgeführt werden. Homogene Echtzeit- oder Endpunktassays, bei denen das Detektoroligonucleotid als Primer fungiert, werden typischerweise in Lösung durchgeführt. Hybridisierungsassays unter Verwendung der Detektoroligonucleotide der Erfindung können ebenfalls in Lösung durchgeführt werden (z.B. als homogene Echtzeitassays), sind jedoch auch besonders gut für Festphasenassays für den Echtzeit- oder Endpunktsnachweis eines Ziels geeignet. Bei einem Festphasenassay können Detektoroligonucleotide über interne oder terminale Marker unter Verwendung von in der Technik bekannten Verfahren auf der festen Phase (z.B. Kügelchen, Membranen oder dem Reaktionsgefäß) immobilisiert werden. Zum Beispiel kann ein biotinmarkiertes Detektoroligonucleotid auf einer avidinmodifizierten festen Phase immobilisiert werden, wo es eine Fluoreszenzänderung erzeugt, wenn es unter geeigneten Hybridisierungsbedingungen dem Ziel ausgesetzt wird. Auf diese Weise erleichtert der Abfang des Ziels die Abtrennung des Ziels aus der Probe und erlaubt die Entfernung von Substanzen in der Probe, die den Nachweis des Signals oder andere Aspekte des Assays stören können. Ein Beispiel für ein Festphasensystem, das verwendet werden kann, ist ein Arrayformat, wie die in der Technik bekannten.

Beispiele

Die folgenden Beispiele erläutern spezielle Ausführungsformen der hier beschriebenen Erfindung. Wie der Fachmann erkennen wird, sind verschiedene Änderungen und Modifikationen möglich, die im Umfang der beschriebenen Erfindung liegen.

Beispiel 1 ORF6-M.-pneumoniae-Spezifität

Um die Spezifität des ORF6-Gens für M. pneumoniae zu bestimmen, wurde eine PCR-Amplifikation mit DNA aus mehreren M.-pneumoniae-Stämmen durchgeführt, wobei man die Primer SEQ ID Nr. 12 und SEQ ID Nr. 13 verwendete. Kurz gesagt, die PCR-Bedingungen waren wie folgt: jeweils 10 &mgr;M der Primer SEQ ID Nr. 12 und SEQ ID Nr. 13; jeweils 200 nM dATP, dTTP, dCTP und dGTP; 5 Einheiten AmpliTAQ-DNA-Polymerase (Perkin Elmer) und 1 &mgr;l einer 1:10-Verdünnung von ATCC-Organismus-Stammlösung in einem Reaktionsvolumen von 50 &mgr;l, das 1x AmpliTAQ-Puffer enthält. Die PCR wurde auf einem M) Research PTC-200 Peltier Thermal Cycler durchgeführt, und die Temperaturwechselbedingungen bestanden aus einem Zyklus bei 95°C während 5 Minuten, gefolgt von 35 Zyklen bei 95°C während 45 Sekunden, bei 52°C während 45 Sekunden und bei 72°C während 60 Sekunden. 9 &mgr;l jedes PCR-Produkts wurden mit 1 &mgr;l Ladungsfarbstoff gemischt und durch Agarose-Gel-Elektrophorese analysiert. Ein 100-bp-Leiter-Gelmarker (GibcoBRL) wurde verwendet, um die Produktgröße abzuschätzen. Das Gel wurde ungefähr 45 Minuten lang mit 98 Volt laufen gelassen. 2 zeigt die Ergebnisse einer Analyse von Produkten aus der PCR-Amplifikation von acht M.-pneumoniae-ATCC-Stämmen auf einem 1%-Agarose-Gel. Tabelle 1 zeigt die getesteten Stämme mit der Identifizierung von Banden, die den markierten Banden in 2 entsprechen.

In jedem Fall wurde ein PCR-Produkt von 529 bp (ORF6-amplifizierter Zielbereich) beobachtet, was die Anwesenheit des ORF6-Gens in allen acht M.-pneumoniae-Stämmen beweist.

Um zu bestimmen, ob Homologe des ORF6-Gens in Spezies existieren, die phylogenetisch mit M. pneumoniae verwandt sind, wurde DNA von 4 anderen Mycoplasma-Spezies durch PCR amplifiziert, wobei man die Primer SEQ ID Nr. 12 und SEQ ID Nr. 13 unter den oben beschriebenen Bedingungen verwendete. Die PCR-Produkte wurden durch Elektrophorese auf einem 1,5%-Agarose-Gel analysiert, wie es in 3 gezeigt ist. Die Ergebnisse dieser Analyse sind in Tabelle 2 zusammengefasst. Nur die positive M.-pneumoniae-Kontrolle (ATCC 29342) ergab eine Bande mit der vorhergesagten Größe von 529 bp, was darauf hinweist, dass die ORF6-Primer SEQ ID Nr. 12 und SEQ ID Nr. 13 spezifisch für diese Spezies sind.

Beispiel 2 Sequenzausrichtungen

Die in Beispiel 1 erzeugten PCR-Produkte wurden sequenziert, und eine Ausrichtung der acht ORF6-Sequenzen wurde unter Verwendung des MegAlign-Softwareprogramms (DNAStar) zusammengestellt.

Zwei SDA-Systeme wurden innerhalb des durch die Primer SEQ ID Nr. 12 und SEQ ID Nr. 13 begrenzten ORF6-Bereichs entworfen. 4 zeigt die Ausrichtung der Zielbindungssequenzen der Oligonucleotide des SDA-Systems 1, SEQ ID Nr. 1, SEQ ID Nr. 3, SEQ ID Nr. 5, SEQ ID Nr. 7 und SEQ ID Nr. 9 gegenüber dem ORF6-Zielbereich. Eine absichtliche Fehlpaarung wurde in SEQ ID Nr. 5 eingebaut (C durch T ersetzt), um Wechselwirkungen mit SEQ ID Nr. 1 zu vermeiden. 5 zeigt die Ausrichtung der Zielbindungssequenzen der Oligonucleotide des SDA-Systems 2, SEQ ID Nr. 2, SEQ ID Nr. 4, SEQ ID Nr. 6, SEQ ID Nr. 8 und SEQ ID Nr. 10 gegenüber dem ORF6-Zielbereich. Innerhalb der Zielbindungsbereiche dieser Oligonucleotide sind keine Fehlpaarungen vorhanden.

Die Ausrichtungen beweisen eine Homologie innerhalb der Oligonucleotid-Zielbindungssequenzen für beide ORF6-SDA-Systeme über alle bewerteten Stämme von M. pneumoniae hinweg.

Beispiel 3 SDA-Systeme, die für das ORF6-Gen entworfen wurden

Um die Spezifität der Oligonucleotide, die die beiden oben genannten SDA-Systeme umfassen, für die ORF6-Zielsequenz zu bewerten, wurden Nucleinsäure-Sequenzhomologien bewertet, wobei das in der Technik wohlbekannte Basic Local Alignment Search Tool ("BLAST") verwendet wurde (1990, Proc. Natl. Acad. Sci. USA 87: 2267–2268; 1990, J. Mol. Biol. 215: 403410; 1993, Nature Genetics 3: 266–272; 1997, Nuc. Acids Res. 25: 3389–3402). BLASTN wurde verwendet, um eine Nucleotid-Abfragesequenz gegen eine Nucleotidsequenz-Datenbank abzugleichen. Das BLASTN-Programm identifiziert homologe Sequenzen durch Identifizieren von ähnlichen Segmenten, die hier als "hochpunktende Segmentpaare" bezeichnet werden, zwischen einer Abfrage-Nucleinsäuresequenz und einer Testsequenz, die vorzugsweise von einer Nucleinsäuresequenz-Datenbank erhalten wird. Hochpunktende Segmentpaare werden vorzugsweise mittels einer Punktematrix, von denen viele in der Technik bekannt sind, identifiziert (d.h. ausgerichtet). Vorzugsweise ist die verwendete Punktematrix die Blosum62-Matrix (1992, Science 256: 1443–1445; 1993, Proteins 17: 49–61). Das BLASTN-Programm bewertet die statistische Signifikanz aller identifizierten hochpunktenden Segmentpaare und wählt vorzugsweise diejenigen Segmente aus, die eine anwenderspezifizierte Signifikanzschwelle, wie eine prozentuale Homologie, überschreiten. Vorzugsweise wird die statistische Signifikanz eines hochpunktenden Segmentpaars unter Verwendung der Formel für die statistische Signifikanz von Karlin (1990, Proc. Natl. Acad. Sci. USA 87: 2267–2268) bewertet.

Eine BLASTN-Analyse wurde mit der GenBank-Datenbank unter Verwendung der Zielsequenz, die den linken und rechten Bumper überspannt, für jedes der ORF6-SDA-Systeme 1 (SEQ ID Nr. 5 bis SEQ ID Nr. 7) und 2 (SEQ ID Nr. 6 bis SEQ ID Nr. 8) durchgeführt. Eine Analyse der Ergebnisse zeigte eine signifikante Homologie nur mit Sequenzen aus dem Genom von M. pneumoniae. Diese Ergebnisse beweisen, dass die Oligonucleotide, die die ORF6-SDA-Systeme 1 und 2 umfassen, spezifisch für M. pneumoniae sind.


Anspruch[de]
Oligonucleotid, bestehend aus einer Zielbindungssequenz, die aus der Gruppe ausgewählt ist, die aus den Zielbindungssequenzen von ORF6LP1 (SEQ ID Nr. 1), ORF6LP2 (SEQ ID Nr. 2), ORF6Left PCR (SEQ ID Nr. 12), ORF6RP1 (SEQ ID Nr. 3), ORF6RP2 (SEQ ID Nr. 4) und ORF6Right PCR (SEQ ID Nr. 13) besteht, und gegebenenfalls einer Sequenz, die für eine Amplifikationsreaktion erforderlich ist. Oligonucleotid gemäß Anspruch 1, wobei die für die Amplifikationsreaktion erforderliche Sequenz eine Erkennungsstelle für eine Restriktions-Endonuclease ist, an der von einer Restriktions-Endonuclease ein Einzelstrangbruch eingeführt werden kann. Oligonucleotid, ausgewählt aus der Gruppe, die aus ORF6ADPT1 (SEQ ID Nr. 9), einer zu SEQ ID Nr. 9 komplementären Nucleinsäure, ORF6ADPT2 (SEQ ID Nr. 10) und einer zu SEQ ID Nr. 10 komplementären Nucleinsäure besteht. Paar von Amplifikationsprimern, umfassend:

a) einen ersten Primer, der aus einer Zielbindungssequenz, die aus der Gruppe ausgewählt ist, die aus ORF6LP1 (SEQ ID Nr. 1), ORF6LP2 (SEQ ID Nr. 2) und ORF6Left PCR (SEQ ID Nr. 12) besteht, und gegebenenfalls einer Sequenz, die für eine Amplifikationsreaktion erforderlich ist, besteht; und

b) einen zweiten Primer, der aus einer Zielbindungssequenz, die aus der Gruppe ausgewählt ist, die aus den Zielbindungssequenzen von ORF6RP1 (SEQ ID Nr. 3), ORF6RP2 (SEQ ID Nr. 4) und ORF6Right PCR (SEQ ID Nr. 13) besteht, und gegebenenfalls einer Sequenz, die für eine Amplifikationsreaktion erforderlich ist, besteht.
Kit, umfassend:

a) einen oder mehrere Primer, die aus der Gruppe ausgewählt sind, die aus ORF6LP1 (SEQ ID Nr. 1), ORF6LP2 (SEQ ID Nr. 2) und ORF6Left PCR (SEQ ID Nr. 12) besteht;

b) einen oder mehrere Primer, die aus der Gruppe ausgewählt sind, die aus ORF6RP1 (SEQ ID Nr. 3), ORF6RP2 (SEQ ID Nr. 4) und ORF6Right PCR (SEQ ID Nr. 13) besteht;

c) einen oder mehrere Signalprimer, die aus der Gruppe ausgewählt sind, die aus ORF6ADPT1 (SEQ ID Nr. 9), einer zu SEQ ID Nr. 9 komplementären Nucleinsäure, ORF6ADPT2 (SEQ ID Nr. 10) und einer zu SEQ ID Nr. 10 komplementären Nucleinsäure besteht.
Kit gemäß Anspruch 5, der weiterhin Folgendes umfasst:

e) ein Paar von Primern, die spezifisch für die Amplifikation einer für Legionella pneumophila spezifischen Nucleinsäuresequenz sind;

f) ein Paar von Primern, die spezifisch für die Amplifikation einer für Bordetella pertussis spezifischen Nucleinsäuresequenz sind; und

g) ein Paar von Primern, die spezifisch für die Amplifikation einer Nucleinsäuresequenz sind, die eine Chlamydieninfektion anzeigt.
Verfahren zum Nachweis der Anwesenheit oder Abwesenheit von Mycoplasma-pneumoniae-Organismen in einer Probe, wobei das Verfahren Folgendes umfasst:

a) Behandeln der Probe unter Verwendung eines Paars von Nucleinsäureprimern in einer Nucleinsäureamplifikationsreaktion, wobei es sich bei dem ersten Primer um ORF6LP1 (SEQ ID Nr. 1) und bei dem zweiten Primer um ORF6RP1 (SEQ ID Nr. 3) handelt; und b) Nachweisen eines gegebenenfalls amplifizierten Nucleinsäureprodukts, wobei der Nachweis des amplifizierten Produkts die Anwesenheit von Mycoplasma-pneumoniae-Organismen anzeigt.
Verfahren zum Nachweis der Anwesenheit oder Abwesenheit von Mycoplasma-pneumoniae-Organismen in einer Probe, wobei das Verfahren Folgendes umfasst:

a) Behandeln der Probe unter Verwendung eines Paars von Nucleinsäureprimern in einer Nucleinsäureamplifikationsreaktion, wobei es sich bei dem ersten Primer um ORF6LP2 (SEQ ID Nr. 2) und bei dem zweiten Primer um ORF6RP2 (SEQ ID Nr. 4) handelt; und

b) Nachweisen eines gegebenenfalls amplifizierten Nucleinsäureprodukts, wobei der Nachweis des amplifizierten Produkts die Anwesenheit von Mycoplasma-pneumoniae-Organismen anzeigt.
Verfahren zum Amplifizieren einer Zielnucleinsäuresequenz eines Mycoplasma-pneumoniae-Organismus, umfassend:

a) Hybridisieren von

i) einem ersten Amplifikationsprimer, der aus der Gruppe ausgewählt ist, die aus den Zielbindungssequenzen von ORF6LP1 (SEQ ID Nr. 1), ORF6LP2 (SEQ ID Nr. 2) und ORF6Left PCR (SEQ ID Nr. 12) besteht, und gegebenenfalls einer Sequenz, die für eine Amplifikationsreaktion erforderlich ist; und

ii) einem zweiten Amplifikationsprimer, der aus der Gruppe ausgewählt ist, die aus den Zielbindungssequenzen von ORF6RP1 (SEQ ID Nr. 3), ORF6RP2 (SEQ ID Nr. 4) und ORF6Right PCR (SEQ ID Nr. 13) besteht, und gegebenenfalls einer Sequenz, die für eine Amplifikationsreaktion erforderlich ist;

mit der Nucleinsäure; und

b) Verlängern des hybridisierten ersten und zweiten Amplifikationsprimers an der Zielnucleinsäuresequenz, wodurch die Zielnucleinsäuresequenz amplifiziert wird.
Verfahren gemäß Anspruch 7, 8 oder 9, wobei die Nucleinsäureamplifikationsreaktion eine Polymerase-Kettenreaktion (PCR) oder eine Strangverdrängungsamplifikationsreaktion (SDA) ist.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com