PatentDe  


Dokumentenidentifikation DE69636068T2 30.11.2006
EP-Veröffentlichungsnummer 0000811057
Titel VIRALE ZUBEREITUNGEN, VEKTOREN, IMMUNOGENE UND IMPFSTOFFE
Anmelder Cantab Pharmaceuticals Research Ltd., Cambridge, GB
Erfinder INGLIS, Charles, Stephen, Cambridge CB1 6LX, GB;
BOURSNELL, Edward, Michael, Cambridge CB1 4NY, GB
Vertreter LEINWEBER & ZIMMERMANN, 80331 München
DE-Aktenzeichen 69636068
Vertragsstaaten AT, BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 21.02.1996
EP-Aktenzeichen 969031152
WO-Anmeldetag 21.02.1996
PCT-Aktenzeichen PCT/GB96/00385
WO-Veröffentlichungsnummer 1996026267
WO-Veröffentlichungsdatum 29.08.1996
EP-Offenlegungsdatum 10.12.1997
EP date of grant 26.04.2006
Veröffentlichungstag im Patentblatt 30.11.2006
IPC-Hauptklasse C12N 7/00(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 15/86(2006.01)A, L, I, 20051017, B, H, EP   A61K 39/42(2006.01)A, L, I, 20051017, B, H, EP   C12N 5/00(2006.01)A, L, I, 20051017, B, H, EP   A61K 48/00(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]

Diese Erfindung betrifft virale Präparate, Immunogene, Vakzinen und immuntherapeutische Mittel, insbesondere mutierte Viren, ihre Kultivierung, Vakzinen und ihre Herstellung und Verwendungen, z.B. als Vektoren zur Provokation von Immunantworten oder in der korrigierenden Gentherapie.

Stand der Technik

Abgeschwächte Lebendviren, einschließlich gentechnisch veränderter Rekombinanten, sind als nützliche Vakzinenvektoren bekannt. Das Genom des Lebendvirus kann gentechnisch so verändert werden, dass es Gene trägt, die für heterologe Antigene kodieren, gegen die immunologische Antworten erwünscht sind, auf solche Weise, dass die replikative Fähigkeit des Lebendvirus aufrechterhalten wird und dass das heterologe Gen in Zellen exprimiert wird, die durch das rekombinante Virus infiziert sind. Die exprimierten Antigene sind somit verfügbar, um eine nützliche Immunantwort zu provozieren. Die heterologen Antigene können aus einem infektiösen Pathogen stammen, sodass eine schützende oder therapeutische Immunantwort gegen das infektiöse Mittel hervorgerufen werden kann, alternativ dazu können sie jedoch auch tumorzellspezifische oder tumorassoziierte Antigene aufweisen; Ziel ist, eine Immunantwort gegen Tumorzellen zu induzieren, um somit Tumorabstoßung oder -regression zu induzieren.

Allgemeiner gesprochen zählen rekombinante virale Vektoren zu mehreren bekannten Mitteln, die zur Einführung von Fremdgenen in Zellen verfügbar sind, sodass sie als Protein exprimiert werden können. Ein zentrales Element ist das Targetgen selbst unter der Steuerung einer geeigneten Promotorsequenz, die in der zu transduzierenden Zelle funktionieren kann. Bekannte Verfahren umfassen nichtvirale Verfahren, wie z.B. den einfachen Zusatz des Targetgenkonstrukts in Form von freier DNA; die Inkubation mit Komplexen von Target-DNA und spezifischen Proteinen, die zur Aufnahme der DNA in die Targetzelle entworfen sind; und die Inkubation mit Target-DNA, die z.B. in Liposomen oder anderen lipidbasierten Transfektionsmitteln eingekapselt ist.

Eine weitere Möglichkeit ist die Verwendung von rekombinanten Virusvektoren, die so gentechnisch verändert sind, dass sie das erwünschte Targetgen enthalten, und die in der Lage sind, die Targetzellen zu infizieren und somit das Targetgen in exprimierbarer Form in die Zelle tragen. Zahlreiche verschiedene Viren wurden bereits für diesen Zweck verwendet, einschließlich Retroviren, Adenoviren und Adeno-assoziierter Viren.

Die Beschreibung der EP-A-0.176.170 (Institut Merieux: B. Roizman) beschreibt fremde Gene, die unter der Steuerung von Promotorregulationsregionen des Genoms in ein virales Herpes-Simplex-Genom insertiert werden und somit einen Vektor zur Expression des Fremdgens bereitstellen. DNA-Konstrukte, Plasmidvektoren, die die Konstrukte enthalten und nützlich zur Expression des Fremdgens sind, rekombinante Viren, die mit dem Vektor produziert werden, sowie zugehörige Verfahren werden offenbart.

Die Beschreibung der EP-A-0.448.650 (General Hospital Corporation: A.I. Geller, X.O. Breakefield) beschreibt Herpes-Simplex-Typ-1-Expressionsvektoren, die in der Lage sind, eine nichtmitotische Zelle zu infizieren und sich darin zu vermehren, zur Verwendung bei der Behandlung neurologischer Erkrankungen sowie zur Erzeugung von Tier- und In-vitro-Modellen solcher Erkrankungen.

Rekombinante Viren sind speziell zur Verwendung in der Gentherapie bekannt, die bei Leiden eingesetzt wird, die mit genetischen Fehlern in Zusammenhang steht.

Beispiele für Gene, die bei Gentherapie verwendet oder für diese Verwendung vorgeschlagen werden, umfassen: das Gen für menschliche Adenosin-Deaminase (ADA), wie beispielsweise in der WO 92/10564 (K.W. Culver et al., US Secretary for Commerce & Cellco Inc), der WO 89/12109 & EP-A-0.420.911 (I.H. Pastan et al.) erwähnt; das Mukoviszidose-Gen und Varianten, die in der WO 91/02796 (L-C Tsui et al., HSC Research & University of Michigan) und der WO 94/12649 (R.J. Gregory et al., Genzyme Corp) beschrieben werden.

Der Stand der Technik bezüglich maligner Tumorbehandlung umfasst Untersuchungen, die das Potenzial für therapeutische Impfung gegen Tumoren unter Verwendung von autologem Material, das aus dem eigenen Tumor eines Patienten stammt, hervorkehrten. Die allgemeine Theorie hinter diesem Ansatz ist, dass Tumorzellen ein oder mehrere Proteine oder biologische Makromoleküle exprimieren können, die sich von normalen gesunden Zellen unterscheiden und die daher verwendet werden, um eine Immunantwort auszurichten, die dann die Tumorzellen erkennen und zerstören soll.

Diese Tumortargets können überall in Tumoren eines bestimmten Typs vorhanden sein. Ein gutes Beispiel hierfür ist Zervixkrebs, wobei in diesem Fall die große Mehrheit der Tumoren die menschlichen Papillomavirus-E6- und -E7-Proteine exprimieren. In diesem Fall ist das Tumortarget kein Eigenprotein, und daher ist sein Potenzial als ein einmaliger, tumorspezifischer Marker für Krebsimmuntherapie eindeutig.

Es gibt immer mehr Hinweise darauf, dass bestimmte Eigenproteine auch als Tumortarget-Antigene verwendet werden können. Dies basiert auf der Beobachtung, dass sie durchwegs in Tumorzellen exprimiert werden, nicht aber in normalen gesunden Zellen. Beispiele hierfür umfassen die MAGE-Proteinfamilie. Es wird angenommen, dass es noch mehr Eigenproteine, die als Tumortargets nützlich sind, zu identifizieren gibt.

Tumor-assoziierte Antigene und ihre Rolle in der Immunbiologie bestimmter Krebsarten werden beispielsweise von P. van der Bruggen et al. in: Current Opinion in Immunology 4(5), 608–612 (1992), diskutiert. Andere solche Antigene aus der MAGE-Reihe werden in T. Boon, Adv. Cancer Res. 58, 177–210 (1992), identifiziert, und MZ2-E und andere verwandte Tumorantigene werden in P. van der Bruggen et al., Science 254, 1643–1647 (1991), identifiziert; Tumor-assoziierte Mucine werden in P.O. Livingston in: Current Opinion in Immunology 4(5), 624–629 (1992), erwähnt; z.B. MUC1, wie es in J. Burchell et al., Int. J. Cancer 44, 691–696 (1989), erwähnt wird.

Auch wenn manche potenziell nützliche, Tumor-spezifische Marker somit bereits identifiziert und charakterisiert wurden, bleibt die Suche nach neuen und vielleicht noch spezifischeren Markern arbeits- und zeitaufwändig und bietet auch keine Erfolgsgarantie.

Die Verabreichung von Cytokinen als solche an Säugetiere wurde bereits versucht, wird jedoch häufig nur schlecht vom Wirt toleriert und geht oft mit zahlreichen Nebenwirkungen einschließlich Übelkeit, Knochenschmerzen und Fieber einher. (A. Mire-Sluis, TIBTech Bd. 11 (1993); M.S. Moore in: Ann. Rev. Immunol. 9, 159–191 (1991)). Diese Probleme werden durch die Höhe der Dosierungen, die häufig erforderlich ist, um wirksame Plasmakonzentrationen aufrechtzuerhalten, noch erschwert.

Virusvektoren wurden bereits für die Verwendung bei Krebsimmuntherapie vorgeschlagen, um ein Mittel zur Steigerung von Tumor-Immunreaktivität bereitzustellen.

Es ist bekannt, wie Lebendvirusvektoren zu modifizieren sind, damit sie Gene enthalten, die für ein Cytokin oder Tumorantigen kodieren: siehe die Beschreibung der WO 94/16716 (E. Paoletti et al., Virogenetics Corp.) und die darin zitierten Verweise; die WO 94/16716 beschreibt, abgeschwächte rekombinante Vakziniaviren zur Verwendung in der Krebstherapie, die DNA enthalten, die für ein Cytokin oder ein Tumorantigen kodiert. Cytokine sind Beispiele für immunmodulierende Proteine. Immunmodulierende Proteine, die die Immunantwort steigern, wie z.B. Cytokin, Interleukin 1, Interleukin 2 und Granulozyten-Makrophagen-Koloniewachstum stimulierender Faktor (GM-CSF) (siehe z.B. A. W. Heath et al., Vaccine 10(7) (1992), und Tao Mi-Hua et al., Nature 362 (1993)), können wirksame Vakzinenadjuvanzien sein.

Es wurde vorgeschlagen, GMCSF-transduzierte Tumorzellen als therapeutische Vakzine gegen Nierenkrebs einzusetzen. Die Vorschriften für entsprechende Versuche umfassen das Entfernen von Tumormaterial aus den Patienten und anschließend die Transduktion mit dem geeigneten Immunmodulatorgen. Die gentechnisch veränderten Zellen müssen dann in den Patienten zurück eingeführt werden, um eine nützliche Immunantwort zu stimulieren.

Auch wenn bereits vorgeschlagen wurde, immunmodulierende Gene in bestimmte Arten von Tumorzellen einzuführen, werden in bestehenden Verfahren gewisse Einschränkungen gesehen, unabhängig davon, ob die Schwierigkeiten auf ein geringes quantitatives Ausmaß von Transduktion, auf Komplexität oder auf unerwünschte Nebenwirkungen der verwendeten Systeme zurückzuführen sind.

Erst jüngst wurde ein experimentelles, intrakranielles murines Melanom beschrieben, das mit einer neuroattenuierten HSV1-Mutante 1716 (B.P. Randazzo et al., Virology 211, 94–101 (1995)) behandelt wurde, deren Replikation auf Tumorzellen eingeschränkt zu sein schien und im umgebenden Gehirngewebe nicht auftrat.

Darüber hinaus wurden Vektoren basierend auf Herpesvirus saimiri, einem Virus aus nichtmenschlichen Primaten, beschrieben, die zu Genexpression in menschlichen Lymphzellen führen (B. Fleckenstein & R. Grassmann, Gene 102(2), 265–269 (1991)). Es wurde jedoch als nicht wünschenswert erachtet, solche Vektoren in klinischem Zusammenhang zu verwenden.

Der Stand der Technik umfasst die Beschreibung der WO 92/05263 (Inglis et al., Immunology Limited) (deren Inhalt hierin durch Verweis aufgenommen ist), die beispielsweise die Verwendung eines mutierten Virus, dessen Genom in Bezug auf ein Gen defekt ist, das für die Produktion von infektiösem Virus essenziell ist, als Vakzine beschreibt, sodass das Virus normale Wirtszellen infizieren und Replikation und Expression von viralen Antigen-Genen in solchen Zellen erfahren, jedoch das infektiöse Virus nicht produzieren kann. Die WO 92/05263 beschreibt insbesondere ein HSV-Virus, das durch Deletion eines Gens deaktiviert ist, das für das essenzielle Glykoprotein H (gH) kodiert, das für Virusinfektiosität erforderlich ist (A. Forrester et al., J. Virol. 66, 341–348 (1992)). In Abwesenheit von gH-Proteinexpression werden nichtinfektiöse Viruspartikel, die nahezu das vollständige Repertoire von viralen Proteinen bereitstellen, produziert. Diese Viren-Nachkommenschaft ist jedoch nicht in der Lage, Wirtszellen zu infizieren, und eine Ausbreitung des Virus innerhalb des Wirts wird unterbunden. Für solch ein Virus wurde gezeigt, dass es eine wirksame Vakzine in Tiermodellsystemen ist (Farrell et al., J. Virol. 68, 927–932 (1994); McLean et al., J. Infect. Dis. 170, 1100–1109 (1994)). Diese mutierten Viren können in einer Zelllinie kultiviert werden, die das Genprodukt exprimiert, hinsichtlich dessen das mutierte Virus defekt ist. Zelllinien, die für die Kultur bestimmter Viren dieses Typs geeignet sind, wurden bereits in der Literatur beschrieben: beispielsweise in Verweisen, die in der genannten Beschreibung WO 92/05263 erwähnt werden.

Vollständige oder wesentliche Sequenzdaten wurden bereits für mehrere Viren wie z.B. Epstein-Barr-Virus EBV (Baer et al., Nature 310, 207 (1984)), menschliches Zytomegalievirus CMV (Weston & Barrell, J. Mol. Biol. 192, 177–208 (1986)), Varicel-Ia-Zoster-Virus VZV (Davison & Scott, J. Gen. Virol. 67, 759–816 (1986)) und Herpes-Simplex-Virus HSV (McGeoch et al., J. Gen. Virol. 69, 1531–1574 (1988)) veröffentlicht. Das gH-Glykoprotein ist dafür bekannt, dass es Homologe in EBV, CMV und VZV aufweist (Desai et al., J. Gen. Virol. 69, 1147 (1988)).

Virusvektoren stellen eine Möglichkeit für intrazelluläre Zufuhr sowohl von DNA als auch von Protein, für Immunisierung und Gentherapie, z.B. korrigierende Gentherapie, sowie für die Verwendung bei beispielsweise Krebsimmuntherapie bereit, wobei jedoch der Stand der Technik stets den Bedarf offen lässt, weitere virale Vektoren und Verfahren bereitzustellen, die zur Transformation menschlicher und nichtmenschlicher Tierzellen und zur Expression von Proteinen darin nützlich sind.

Zusammenfassung und Beschreibung der Erfindung

Gemäß der vorliegenden Erfindung, wie nachstehend näher beschrieben wird, stellt eine genetisch deaktivierte (genetisch funktionslose), mutierte Herpesvirusvakzine einen nützlichen Träger für Gene bereit, die für immunmodulierende Proteine kodieren, und kann daher als Virusvektor verwendet werden. Die Herpesvirusvakzine kann Zellen z.B. eines geimpften Individuums infizieren, was zur intrazellulären Synthese viraler Antigene sowie der immunmodulierenden Proteine führt. So kann die Immunantwort auf das Virus in bestimmten Beispielen der Erfindung potenziert werden, unabhängig davon, ob sie gegen viral kodierte Antigene gerichtet ist oder als Reaktion auf das immunmodulierende Protein, für das das Virus kodiert, auftritt. Wirkt die genetisch deaktivierte Vakzine auch als Vektor zur Zufuhr fremder Antigene, so kann die Immunantwort gegen das Fremdantigen auch gesteigert werden.

Da das Vakzinenvirus jedoch nur einen einzigen Replikationszyklus in Zellen des geimpften Wirts durchlaufen kann, ist die Produktion der immunmodulierenden Proteine auf die Stelle der Impfung beschränkt, was im Gegensatz zum Fall eines replikationsfähigen Virus steht, bei dem sich die Infektion durch den gesamten Körper ausbreiten kann. Darüber hinaus ist die gesamte produzierte Menge, auch wenn sie lokal ausreichend ist, um eine heftige Immunantwort zu stimulieren, wesentlich geringer als jene, die von einem replikationsfähigen Virus produziert wird, und ruft daher sehr viel weniger wahrscheinlich negative systemische Reaktionen hervor.

Es wird als Vorteil angesehen, eine Herpesvakzine oder ein Vektorsystem mit dem immunologischen Nutzen eines Lebendvirus oder Virusvektors bereitzustellen, die bzw. das gleichzeitig den Vorteil lokaler Produktion von immunmodulierendem Protein besitzt und die bzw. das das potenzielle Risiko des Auftretens unvorhergesehener Krankheitsbilder für das geimpfte Individuum minimiert, wobei sie bzw. es auch das potenzielle Risiko für die Umwelt unterbindet, eine Ausbreitung eines neuen und potenziell gefährlichen, replizierenden Pathogens zu ermöglichen.

Die Verabreichung von Cytokinen als solche wird häufig von Wirten nur schlecht vertragen und geht oft mit zahlreichen Nebenwirkungen einschließlich Übelkeit, Knochenschmerzen und Fieber einher. (A. Mire-Sluis, TIBTech Bd. 11 (1993); M.S. Moore, Ann. Rev. Immunol. 9, 159–191 (1991)). Diese Probleme werden durch die Höhe der Dosis, die häufig erforderlich ist, um wirksame Plasmakonzentration aufrechtzuerhalten, noch verschärft. Um systemische Toxizität zu reduzieren, wird eine stärker ortsgerichtete Zufuhr von aktivem Cytokin, wie hierin beschrieben, vorgeschlagen.

Ein früherer Ansatz zur Beseitigung dieses Problems umfasste die Fusion von Antigen- und Cytokingenen, um ein einziges bifunktionelles Polypeptid zu erzeugen (M. Hazama et al., Vaccine 11, 6 (1993)).

Ein alternativer Ansatz dazu ist die Inkorporation einer Nucleotidsequenz, die für ein immunmodulierendes Protein kodiert, in eine Lebendvirusvakzine. Die Beschreibung der WO 94/16716 (E. Paoletti et al., Virogenetics Corp.) beschreibt attenuierte rekombinante Vakziniaviren, die für Cytokin oder Tumorantigen kodierende DNA enthalten, zur Verwendung in der Krebstherapie.

Virusvektoren haben bereits Anwendung im Rahmen von Krebsimmuntherapie durch Bereitstellung eines Mittels zur Förderung von Tumorimmunreaktivität gefunden.

Die Erfinder der vorliegenden Beschreibung ziehen jedoch in Betracht, dass die Verwendung von Lebendviren, die immunmodulierende Gene tragen sollen, ein Risiko für die Gesellschaft sowie für die geimpfte Person selbst darstellen kann. Ein Vakzinenvirus, das nicht in der Lage ist, sich von Zelle zu Zelle auszubreiten, wie es von der hierin beschriebenen Erfindung bereitgestellt wird, stellt einen beachtlichen Sicherheitsvorteil bereit, da es unter normalen Umständen zu keiner Übertragung der Vakzinen auf andere Individuen kommen kann.

Ein unüblicher Umstand, unter dem ein Übertragungsrisiko auftreten könnte, ist jedoch, dass, sofern es zu Rekombination zwischen dem genetisch deaktivierten Virus und einem natürlich vorkommenden Wildvirus innerhalb des geimpften Individuums kommt, ein Transfer des immunmodulierenden Gens auf das natürliche Virusgenom stattfinden könnte oder dass es zur Rekonstitution von Replikationsfähigkeit im Vakzinenvirus durch Erwerb des fehlenden Gens kommen könnte. Es ist durchwegs bekannt, dass homologe Rekombination zwischen eng verwandten Viren mit relativ hoher Häufigkeit auftreten kann, wenn Zellen gleichzeitig mit beiden Viren infiziert werden. Diese potenzielle Fähigkeit kann jedoch dadurch umgangen werden, dass, wie auch gemäß vorliegender Offenbarung bevorzugt wird, sichergestellt wird, dass das immunmodulierende Gen an dem Punkt innerhalb des Vakzinenvirusgenoms insertiert wird, an dem das essenzielle Gen deletiert wurde. Die aus diesem Konstruktionsmodus resultierende Konsequenz ist, dass homologe Rekombination mit einem Wildvirus, sollte dieses tatsächlich innerhalb des geimpften Wirts vorkommen, nicht zur Produktion eines neuen Virus führen kann, das sowohl replikationsfähig ist als auch das immunmodulierende Gen trägt (7 der beiliegenden Zeichnungen). Dies begründet sich darin, dass der Transfer des deletierten Gens zurück in das Vakzinenvirus zu einem Verlust heterologer Sequenzen, die an dieser Stelle insertiert sind, führen würde. Umgekehrt würde ein Transfer der heterologen Sequenzen auf das Wildvirus zu einem Verlust eines essenziellen Gens führen.

Gemäß vorliegender Erfindung wird daher ein mutiertes Herpesvirus bereitgestellt, das ein Genom aufweist, das hinsichtlich eines ersten Gens, das für die Produktion von infektiösem Virus essenziell ist, defekt ist, und das eine heterologe Nucleotidsequenz umfasst, die für ein immunmodulierendes Protein kodiert. Darüber hinaus kann in bestimmten Ausführungsformen das Virus auch für ein heterologes Antigen, z.B. ein vitales oder nichtvirales Antigen, z.B. ein Tumorantigen, kodieren.

Mutierte Herpesviren können beispielsweise auf HSV1, HSV2, VZV, CMV, EBV, HHV6, HHV7 oder auf nichtmenschlichen Tier-Herpesviren wie z.B. PRV, IBRV/HBV, MDV, EHV und dergleichen basieren.

Das Genom des mutierten Herpesvirus ist hinsichtlich eines ausgewählten Gens, das für die Produktion eines infektiösen Virus durch infizierte Wirtszellen essenziell ist, defekt, sodass das Virus normale Wirtszellen (d.h. Zellen, die nicht jene sind, die mutiert wurden, sodass sie das Produkt des essenziellen Gens, hinsichtlich dessen das Virus defekt ist, exprimieren) infizieren kann und vitale Replikation und Expression viraler Antigen-Gene in diesen Zellen verursachen kann, jedoch nicht die Produktion des normalen infektiösen Virus hervorrufen kann. In solch einem mutierten Virus kann der genetische Defekt so beschaffen sein (z.B. Deletion von Herpesvirus gH oder gD), das die Produktion und Freisetzung von nichtinfektiösen Viruspartikeln ermöglicht werden, wenn das mutierte Virus Wirtszellen infiziert, die nicht solche rekombinanten komplementären Wirtszellen sind.

Somit stellt die vorliegende Erfindung ein mutiertes Herpesvirus bereit, dessen Genom hinsichtlich eines Gens, das für die Produktion von infektiösem Virus essenziell ist, defekt ist, sodass das Virus normale Zellen infizieren und darin replizieren kann, um die Produktion und Freisetzung von nichtinfektiösen Viruspartikeln aus den Zellen hervorzurufen, und zumindest eine heterologe Nucleotidsequenz enthält, die zumindest für ein immunmodulierendes Protein kodiert. Mehrere verschiedene Sequenzen können in einem einzelnen viralen Vektor, der, sofern erwünscht, für mehrere verschiedene immunmodulierende Proteine kodiert, getragen werden. Alternativ dazu können Gemische von Vektoren, die jeweils eine jeweilige heterologe Nucleinsäuresequenz enthalten, die für ein immunmodulierendes Protein kodiert, verwendet werden.

Die vorliegende Erfindung stellt auch ein mutiertes Herpesvirus bereit, dessen Genom hinsichtlich eines Gens, das für die Produktion von infektiösem Virus essenziell ist, defekt ist und das genetisches Material in sich trägt, das für ein Immunogen oder mehrere verschiedene Immunogene aus einem Pathogen kodiert, das für das Virus exogen ist, sodass das Virus normale Zelle infizieren kann und gewisse Replikation und Expression des genetischen Materials, das für das Immunogen kodiert, erfahren kann, jedoch keine infektiösen Viruspartikel produzieren kann, und das eine heterologe Nucleotidsequenz enthält, die für ein immunmodulierendes Protein kodiert.

Wie hierin verwendet umfasst die Bezeichnung "immunmodulierendes Protein" und damit verwandte Bezeichnungen ein Protein oder Proteine, das/die eine Wirtsimmunantwort auf ein mutiertes Virus oder Protein, das davon kodiert wird, oder auf ein Antigen wie z.B. ein Immunogen aus einem Pathogen oder einer Quelle, die für das Virus exogen ist, oder ein tumorassoziiertes Antigen entweder steigert/steigern oder unterdrückt/unterdrücken. Die immunmodulierenden Proteine sind normalerweise nicht jene Proteine, die zur Zeit selbst als Immunogene (Antigene) verwendet werden. Ein immunmodulierendes Protein kann ein natürliches Element eines menschlichen oder nichtmenschlichen tierischen Immunsystems, z.B. eines Säugetierimmunsystems, mit funktioneller Bindungsfähigkeit an eine andere natürliche Komponente eines solchen Immunsystems sein. Alternativ dazu kann ein immunmodulierendes Protein ein Protein sein, für das ein Pathogen kodiert, das funktionelle Bindungsfähigkeit an eine natürliche Komponente eines solchen Immunsystems aufweist. Alternativ dazu kann ein immunmodulierendes Protein ein künstliches Protein, beispielsweise ein Fragment eines natürlichen immunmodulierenden Proteins, oder ein Mutein eines solchen Proteins oder Fragments oder ein Fusionsprotein, das beliebige dieser Komponenten umfasst, sein. Zahlreiche immunmodulierende Proteine sowie genetische Materialien, die für diese kodieren, und ihre Nucleotid- und Aminosäuresequenzen sind in der Literatur des vorliegenden Fachbereichs bekannt und sind in genetischen Sequenzdatenbanken, wie z.B. der EMBL-Datenbank, verfügbar, und mehrere davon sind im Handel in Form von gentechnisch verändertem Material zum Klonieren und für andere manipulative Vorgänge erhältlich.

Immunmodulierende Proteine, für die kodierende Nucleotidsequenzen exprimierbar von mutierten Herpesvirusvektoren, wie hierin beschrieben, getragen werden, können beispielsweise auf nützliche Weise aus Sequenzen bestehen, die für die Spezies, die die Impfung mit den rekombinanten Viren erhalten soll, nativ sind; sie können z.B. ein immunmodulierendes Protein vom menschlichen Typ zur Behandlung eines menschlichen Individuums sein.

Das bzw. die Proteine kann/können in bestimmten Beispielen der Erfindung so gewählt werden, dass sie die Wirkung des mutierten Herpesvirus als Immunogen, z.B. als Vakzine, verstärken. Potenzielle Gefahren, die mit der Expression solcher Proteine in einem vollständig replizierenden Virus einhergehen, können durch die Defektivität des verwendeten Vektors, der hierin beschrieben wird, vermieden werden.

Beispiele für nützliche immunmodulierende Proteine umfassen Cytokine, Chemokine, Komplementkomponenten, akzessorische und adhäsive Immunsystemmoleküle und ihre Rezeptoren mit menschlicher oder nichtmenschlicher tierischer Spezifität. Nützliche Beispiele umfassen GM-CSF, IL-2, IL-12, OX40, OX40L (gp34), Lymphotactin, CD40 und CD40L. Weitere nützliche Beispiele umfassen Interleukine wie z.B. Interleukine 1 bis 15, Interferon-&agr;, -&bgr; oder -&ggr;, Tumornekrosefaktor, Granulozyten-Makrophagen-Koloniewachstum stimulierenden Faktor (GM-CSF), Makrophagen-Koloniewachstum stimulierenden Faktor (M-CSF), Granulozyten-Koloniewachstum stimulierenden Faktor (G-CSF), Chemokine wie z.B. Neutrophil-aktivierendes Protein (NAP), als chemisches Attraktans wirkender und aktivierenden Faktor für Makrophagen (MCAF), RANTES, Makrophagen-Entzündungspeptide MIP-1a und MIP-1b, Komplementkomponenten und ihre Rezeptoren oder ein akzessorisches Molekül wie z.B. B7.1, B7.2, ICAM-1, 2 oder 3 und Cytokinrezeptoren. OX40 und OX40-Ligand (gp34) sind weitere nützliche Beispiele für immunmodulierende Proteine. Immunmodulierende Proteine können für verschiedene Zwecke menschliche oder nichtmenschliche Spezifität aufweisen und können für vorliegende Zwecke, je nach Situation und je nach Eignung, von extrazellulären Domänen und anderen Fragmenten mit der Bindungsaktivität der natürlich vorkommenden Proteine und Muteinen davon und ihren Fusionsproteinen mit anderen Polypeptidsequenzen, z.B. mit konstanten Immunglobulinschwerkettendomänen, repräsentiert werden. Werden Nucleotidsequenzen, die für mehr als ein immunmodulierendes Protein kodieren, insertiert, so können sie beispielsweise mehr als ein Cytokin oder eine Kombination von Cytokin(en) und akzessorischen/adhäsiven Molekülen) umfassen.

Immunantwort, die durch die Verwendung solcher Vektoren, die für solche Produkte kodieren, hervorgerufen wird, kann Immunantworten mehrerer verschiedener Typen umfassen, die durch das Virus stimuliert werden können, z.B. eine Antwort gegen ein viral kodiertes Protein und/oder eine Antwort gegen ein Wirtsantigen, die eine Antwort ist, die durch den viralen Vektor oder durch die Expression des heterologen Gens, für das dieser kodiert, stimuliert wird. Zu den Verwendungen der mutierten Virusvektoren wie hierin beschrieben zählen z.B. der Schutz eines Individuums einer empfindlichen Spezies vor Infektion durch ein entsprechendes Wildtypvirus, wenn das Individuum damit behandelt wird, z.B. damit infiziert wird, z.B. durch direkte Immunisierung.

Das genetische Material, das für ein immunmodulierendes Protein kodiert, kann im mutierten viralen Genom als exprimierbarer offener Leseraster getragen werden, der für ein Hybrid- oder Fusionsprotein kodiert, das eine Polypeptidregion umfasst, die Homologie zu einem und Funktionalität eines immunmodulierenden Proteins aufweist und an eine Polypeptidregion mit einer anderen Homologie und gegebenenfalls einer anderen Funktionalität gebunden ist. Das immunmodulierende Protein kann beispielsweise das gp34-Protein, das als Bindungspartner für menschliches Ox-40 identifiziert ist, sein, dieses Protein umfassen oder in seiner Funktionalität diesem Protein entsprechen (siehe W. Godfrey et al., J. Exp. Med. 180(2), 757–762 (1994), und die darin zitierten Verweise, einschließlich S. Miura et al., Mol. Cell Biol. 11(3), 1313–1325 (1991)). Die Version dieser Proteinfunktionalität, für die in diesem mutierten viralen Genom kodiert werden kann, kann der natürlichen gp34-Sequenz selbst oder einem Fragment davon oder einem hybriden Expressionsprodukt, z.B. basierend auf der (C-terminalen) extrazellulären. (Bindungs-) Domäne von gp34, fusioniert an ein anderes Protein, z.B. an die konstante Region einer Immunglobulinschwerkette, wie menschliches IgG1, z.B. mit der extrazellulären Domäne von gp34 (ein Typ-2-Membranprotein) fusioniert mit ihrem N-Terminus an den C-Terminus der konstanten Immunglobulindomäne, entsprechen.

Andere der immunmodulierenden Proteine können auch in solchen Derivat- und Hybridformen getragen und exprimiert werden. Es gilt auch zu verstehen, dass Mutationen der Aminosäuresequenzen solcher immunmodulierenden Proteine umfasst sein können. Hierin umfasst sind Proteine mit mutierten Sequenzen, sodass diese z.B. bezüglich Sequenzfunktion und antigener Eigenschaft mit einem Protein, das die entsprechende verwandte Sequenz aufweist, homolog bleiben. Solche Mutationen können vorzugsweise z.B. Mutationen sein, die konservative Aminosäureänderungen umfassen, z.B. Änderungen zwischen Aminosäuren mit umfassend ähnlichen Moleküleigenschaften. Beispielsweise kann ein Austausch innerhalb der aliphatischen Gruppe Alanin, Valin, Leucin und Isoleucin als konservativ erachtet werden. Manchmal kann eine Substitution von Glycin anstelle eines dieser Elemente auch als konservativ betrachtet werden. Ein Austausch innerhalb der aliphatischen Gruppe Aspartat und Glutamat kann auch als konservativ betrachtet werden. Ein Austausch innerhalb der Aminogruppe Asparagin und Glutamin kann auch als konservativ betrachtet werden. Ein Austausch innerhalb der Hydroxygruppe Serin und Threonin kann ebenfalls als konservativ betrachtet werden. Ein Austausch innerhalb der aromatischen Gruppe Phenylalanin, Tyrosin und Tryptophan kann auch als konservativ betrachtet werden. Ein Austausch innerhalb der basischen Gruppe Lysin, Arginin und Histidin kann auch als konservativ betrachtet werden. Ein Austausch innerhalb der schwefelhältigen Gruppe Methionin und Cystein kann ebenfalls als konservativ betrachtet werden. Manchmal kann eine Substitution innerhalb der Gruppe Methionin und Leucin auch als konservativ betrachtet werden. Bevorzugte konservative Substitutionsgruppen sind Aspartat-Glutamat; Asparagin-Glutamin; Valin-Leucin-Isoleucin; Alanin-Valin; Phenylalanin-Tyrosin; und Lysin-Arginin. In anderer Hinsicht können mutierte Sequenzen Insertionen und/oder Deletionen umfassen.

In bestimmten Beispielen kann das immunmodulierende Protein ein Cytokin, vorzugsweise Granulozyten-Makrophagen-Koloniewachstum stimulierenden Faktor (GM-CSF), z.B. murinen oder vorzugsweise menschlichen GM-CSF, umfassen.

Murine und menschliche GM-CSFs sind beide bekannt: das murine GM-CSF-Gen kodiert für ein Polypeptid mit 141 Aminosäuren, wobei das reife sekretierte Glykoprotein je nach Glykosylierungsgrad ein Molekulargewicht von zwischen 14 und 30 kDa aufweist. GM-CSF ist im Allgemeinen ein Element der hämatopoetischen Wachstumsfaktorfamilie und wurde zuerst über seine Fähigkeit definiert und identifiziert, in vitro Koloniebildung in hämatopoetischen Vorläufern zu stimulieren. GM-CSF ist ein potenter Aktivator von Neutrophilen, Eosinophilen und Makrophagen-Monozyten-Funktion, der Migration, Phagozytose, Expression von Haupthistokompatibilitätskomplex (MHC) fördert und eine Kaskade bioaktiver Moleküle initiiert, die das Immunsystem weiter stimulieren. GM-CSF wird zur Zeit für die Behandlung von Neutropenie nach erfolgter Chemotherapie sowie als Adjuvans im Rahmen von Krebstherapie klinisch getestet.

Die verwendete heterologe Nucleotidsequenz kann ein heterologes Gen, Genfragment oder eine Kombination von Genen umfassen, vorausgesetzt, sie kodiert für ein immunmodulierendes Protein wie zuvor definiert.

Gemäß den Beispielen der Erfindung können Kombinationen von zwei oder mehr immunmodulierenden Proteinen für die hierin beschriebenen Zwecke innerhalb eines Virusvektors kodiert werden, oder es kann ein Gemisch aus zwei oder mehreren Vektoren, die jeweils zumindest ein Gen enthalten, das für ein unterschiedliches immunmodulierendes Produkt kodiert, verwendet werden. In bestimmten Beispielen, die ausschließlich als Veranschaulichung und nicht als Einschränkung bereitgestellt werden, können Kombinationen, die IL2, GMCSF, Lymphotactin und/oder CD40L einbinden, miteinander oder mit anderen der oben genannten immunmodulierenden Proteine verwendet werden. Jede der anderen binären Kombinationen der oben erwähnten immunmodulierenden Proteine wird ebenfalls durch diese Offenbarung bereitgestellt und liegt im Schutzumfang dieser Offenbarung.

Beispiele für mutiertes Herpesvirus, wie hierin bereitgestellt, können in der Lage sein, eine anfällige Spezies zu schützen, die damit gegen eine Infektion durch das entsprechende Wildtypvirus immunisiert wird. Das mutierte Virus kann auch eine Mutation aufweisen, die es ihm ermöglicht, Expression von Antigen, das beispielsweise einem anderen Pathogen, z.B. einem bakteriellen oder viralen Pathogen, entspricht, in Wirtszellen hervorzurufen und es dadurch in die Lage versetzt, Immunität gegen solch ein anderes Pathogen in einem Wirt einer empfindlichen Spezies zu verleihen, der mit solch einem mutierten Virus immunisiert ist.

Beispiele für solche Antigene sind Papillomavirusproteine L1 und L2, HIV-Proteine, gag, pol, env und nef, Chlamydien-Antigene (wie z.B. das Chlamydien-"Major Outer Membrane Protein", MOMP) und Chlamydien-Hitzeschockproteine.

Alternativ dazu kann das Antigen ein tumorassoziiertes Antigen sein, wodurch die Anti-Tumor-Aktivität der CTLs, die mit Tumorzellverarmung assoziiert ist, gesteigert wird. Es wurde erkannt, dass spezifische Cytokine wie Tumornekrosefaktor-&agr;, Interferon-&ggr;, Interleukin-2, Interleukin-4 und Interleukin-7 in dieser Hinsicht besonders nützlich sind. Tumorassoziierte Antigene und ihre Rolle in der Immunbiologie bestimmter Krebsarten wird beispielsweise von P. van der Bruggen et al., Current Opinion in Immunology 4(5), 608–612 (1992), erläutert. Bestimmte Beispiele für solche Antigene, die für die Verwendung im Zusammenhang mit der vorliegenden Anmeldung in Betracht gezogen werden, sind E6- und E7-Antigene von menschlichem Papillomavirus (insbesondere z.B. der Typen 6, 11, 16, 18 usw.); von Epstein-Barr-Virus abstammende Proteine, z.B. jene, die in den Verweisen 24 und 25 in P. van der Bruggen et al. (s.o.) identifiziert werden; Antigene der MAGE-Reihe, wie sie von T. Boon, Adv. Cancer Res. 58, 177–210 (1992) identifiziert werden; und/oder MZ2-E und andere Antigene, wie sie von P. van der Bruggen et al., Science 254, 1643–1647 (1991), identifiziert werden; Melanomproteine, z.B. menschliche Tyrosinase; und Mucine wie z.B. jene, die von P.O. Livingston in: Current Opinion in Immunology 4(5), 624–629 (1992), identifiziert werden; z.B. MUC1, identifiziert von J. Burchell et al., Int. J. Cancer 44, 691–696 (1989).

Im Allgemeinen kann mutiertes Virus auf einem Herpesvirus wie z.B. Herpes-Simplex-Virus basieren. Das erste Gen, auf das oben Bezug genommen wurde, kann das Glykoprotein-gH-Gen sein.

Die Defekte im ersten Gen können Deletion oder vollständige oder teilweise Deaktivierung umfassen. Das Gen kann beispielsweise durch jegliche Mutationen, die die Expression blockieren, z.B. Punkt- oder Promotormutationen oder deaktivierende Insertionsmutationen, deaktiviert werden. Vorzugsweise ist das erste Gen zur Gänze deletiert.

Heterologe Nucleotidsequenzen, die in das Genom bestimmter Beispiele für das mutierte Herpesvirus insertiert sind, können in infizierten Zellen, z.B. an der Stelle der Inokulation, exprimiert werden und können während der Latenzzeit in infizierten Neuronen exprimiert werden. Expression der heterologen Nucleotidsequenz kann auf zwei Ebenen reguliert werden, durch Selektion eines geeigneten Promotors und durch die inhärenten Einschränkungen des mutierten Virus selbst. Die heterologe Sequenz kann der Steuerung eines von mehreren verschiedenen bekannten viralen Promotoren, z.B. eines CMV-IE-Promotors, oder der Steuerung eines bekannten Säugetierpromotors, z.B. eines gewebespezifischen Promotors, unterstellt werden. Das Ausbreiten des mutierten Virus innerhalb des Wirts wirkt selbsteinschränkend, und daher ist die Expression der heterologen Nucleotidsequenz in solchen Fällen auf die Dauer der intrazellulären Expression an der Inokulationsstelle eingeschränkt. Ein geeigneter Promotor, induzierbar oder konstitutiv, viralen oder zellulären Ursprungs, kann ausgewählt werden, um präzisere Regulierung von Genexpression und Proteinkonzentration zu ermöglichen. Die Gensequenz kann ihre native Form aufweisen oder modifiziert sein, um die Lokalisierung des Proteins innerhalb eines spezifischen Zellkompartiments zu ermöglichen.

In einer bevorzugten Ausführungsform wird die heterologe Nucleotidsequenz, die für ein immunmodulierendes Protein kodiert, in das Genom des mutierten Herpesvirus an der Stelle des ersten Gens insertiert: Am meisten bevorzugt ersetzt sie dieses erste Gen, das zur Gänze deletiert ist, vollständig. Auf diese Weise wäre es, selbst wenn ein unerwünschtes Rekombinationsereignis stattfinden sollte, das zur neuerlichen Insertion des ersten Gens aus einer Wildquelle in das mutierte Virus führen würde, am besten geeignet, die insertierte heterologe Nucleotidsequenz zu eliminieren. Dies würde die Möglichkeit ausschließen, dass ein replikationsfähiger viraler Träger für die heterologe Nucleotidsequenz produziert werden könnte. Solch ein Rekombinationsereignis tritt im Allgemeinen sehr selten auf, doch in dieser Ausführungsform würden die abträglichen Wirkungen eines solchen Auftretens minimiert werden.

Ein Vorteil der immunogenen Beispiele der Erfindung ist die Bereitstellung von intrazellulärer Antigenzufuhr, die sowohl antikörper- als auch zellvermittelte Immunität und die Produktion von wirksamen örtlichen Cytokinkonzentrationen in der Gegenwart von Antigen ohne gleichzeitiges Induzieren von systemischer Toxizität stimulieren kann. Die Expression von GM-CSF in einem Tier, das mit solch einem viralen Vektor geimpft wurde, beispielsweise in Zellen des behandelten Tiers, die mit dem Vektor infiziert wurden, die als ein Resultat der Gegenwart eines für GM-CSF kodierenden Gens im infizierenden Virusvektor auftritt, kann das Niveau von spezifischer und/oder neutralisierender Antikörperantwort des geimpften Tiers auf Virus- oder Tumorantigene nützlich steigern.

Die Kombination von Cytokin und Antigen kann die Wirtantwort auf das assoziierte Antigen steigern. Dies kann wiederum die Immunogenität von schwach immunogenen Proteinen erhöhen und kann eine Dosisreduktion mit wirksameren Antigenen ermöglichen.

Beispiele für mutierte Herpesviren, die hierdurch bereitgestellt werden, können als Immunogene, z.B. zur prophylaktischen oder therapeutischen Verwendung zur Induktion einer Immunantwort in einem damit behandelten Individuum, verwendet werden. Ausführungsformen der Erfindung stellen auch die Verwendung eines mutierten Virus, das dadurch bereitgestellt wird, bei der Herstellung eines Immunogens wie z.B. einer Vakzine zur therapeutischen oder prophylaktischen Verwendung bereit. Eine bestimmte Anwendung liegt im Bereich von Tumortherapie, wie zuvor erläutert, worin beispielsweise, wie erwähnt, die Rolle des Immunogens darin liegen kann, eine Immunantwort zu stimulieren, die gegen endogene Tumorantigene gerichtet ist.

Die vorliegende Erfindung stellt auch ein Immunogen wie z.B. eine Vakzine bereit, die ein mutiertes Herpesvirus, das darin bereitgestellt wird, umfasst, z.B. ein immunogenes Präparat wie z.B. eine Vakzine, die solch ein mutiertes Virus zusammen mit einem pharmazeutisch annehmbaren Vehikel, wie es z.B. bei der Herstellung von Lebendvakzinen verwendet wird, umfasst und gegebenenfalls ein Adjuvans einbinden kann.

Das mutierte Virus kann beispielsweise in einer Dosis zu einem immunogenen oder Vakzinenpräparat formuliert werden, die beispielsweise bis zu etwa 5 × 107 pfu, z.B. bis zu etwa 5 × 106 pfu oder bis zu etwa 5 × 105 pfu, des mutierten Virus enthält.

Die mutierten Herpesviren, wie sie hierin bereitgestellt werden, können durch ein Verfahren hergestellt werden, das die Kultur von Zellen umfasst, die mit dem mutierten Virus infiziert wurden, wobei die Zellen auch ein Gen exprimieren, das das erste defekte vitale Gen komplementiert, sodass die Produktion infektiöser Viruspartikel, die das defekte Genom enthalten, und das Gewinnen des mutierten Virus aus der Kultur ermöglicht werden.

In immunogenen Beispielen für die hierin offenbarten Herpesviren kann ein zweites vitales Gen, das normalerweise so wirkt, dass eine Wirtimmunantwort gegen Virus, das solch ein zweites Gen trägt, herabreguliert wird, deaktiviert, z.B. deletiert, werden, und das resultierende mutierte Virus wird als sicherer Vektor für die Zufuhr eines Proteins wie z.B. eines immunstimulierenden Proteins oder eines Antigens, das normalerweise für das Virus fremd ist, zum Immunsystem eines infizierten Wirts verwendet: Dies kann durch Insertieren von Nucleinsäuresequenzen, die für solch ein Protein kodieren, in das Genom des Virus auf eine Weise, die ihre Expression während der Infektion von Wirtszellen durch das Virus hervorrufen, erreicht werden. Ein Gen, das für ein erwünschtes Fremdantigen kodiert, kann beispielsweise auf wirksame Weise durch Klonieren des erwünschten Gens, das benachbart zu einem viralen Promotor liegt, um eine DNA-Kassette zu erhalten, die das Gen und den Promotor enthält; durch Klonieren der Kassette in ein geeignetes Plasmid; und durch Co-Transfizieren des Plasmids in eine komplementierende Zelllinie zusammen mit der DNA, die aus dem mutierten Virus mit seinem Defekt in einem Gen, dessen Produkt durch die Zelllinie bereitgestellt wird, gereinigt wurde; und durch Screenen auf rekombinantes Virus; insertiert werden. Ein Beispiel für die Anwendung eines gewissermaßen analogen Verfahrens wird beispielsweise in der WO 92/05263 (Immunology Ltd: Inglis et al.) in Bezug auf ein Gen, das für SIV-gp120-Antigen kodiert, beschrieben.

Solche Beispiele für genetisch funktionsgestörte Herpesvirusvektoren können in Verfahren zur Bereitstellung eines Immunstimulus in einem behandelten menschlichen oder nichtmenschlichen tierischen Individuum, z.B. zu Zwecken der Krebsimmuntherapie, verwendet werden. Die Verwendung der Vektoren kann entweder direkt, z.B. durch Verabreichung an das Individuum, z.B. in die Stelle eines festen Tumors, oder indirekt erfolgen.

Die Verwendung des Vektors kann beispielsweise Folgendes umfassen:

  • (i) das Kontaktieren eines defekten Virusvektors ex vivo mit einem Präparat aus Zellen, die nach Infektion mit dem Vektor in der Lage sind, in einem zu behandelnden Individuum einen Immunstimulus bereitzustellen; und
  • (ii) die Verwendung der infizierten Zellen, um im zu behandelnden Individuum einen Immunstimulus bereitzustellen, z.B.

    (a) durch direkte Verabreichung der infizierten Zellen in Form einer Vakzine, z.B. nach Deaktivierung vor der Verabreichung, z.B. nach Bestrahlung, oder

    (b) durch indirekte Verwendung der Zellen, um ex vivo immunkompetente Zellen wie z.B. Zellen des Immunsystems des zu behandelnden Individuums zu primen oder stimulieren, gefolgt von neuerlicher Verabreichung der immunkompetenten Zellen z.B. ohne gleichzeitige Verabreichung von Virus oder virusinfizierten Zellen. Sämtliche Zellen, die in diesem Zusammenhang unerwünscht sind, können beispielsweise durch ein Reinigungsverfahren, das Negativverarmung umfasst, z.B. durch selektive Entfernung von Zellen eines unerwünschten Typs z.B. mit entsprechenden Antikörpern oder anderen Bindemitteln, entfernt werden.

Zellen, die ex vivo mit dem Herpesvirusvektor infiziert werden, können entweder autologe Zellen oder heterologe Zellen, z.B. heterologe Zellen, die aus einem oder mehreren unterschiedlichen Individuen mit einem Leiden, das jenem zu behandelnden Leiden ähnlich ist, erhalten wurden, sein. Die Zellen können einem einzelnen Zelltyp angehören oder sie können ein Gemisch von Zelltypen darstellen, z.B. können sie Zellen einer oder mehrerer verschiedener Zelllinien umfassen, die aus klinischen Tumorproben erstellt wurden. Somit können beispielsweise im Fall, in dem es einen Immunstimulus zu initiieren gilt, der gegen Melanomzellen gerichtet ist, die heterologen Zellen Melanomzellen aus einem oder mehreren Individuen mit Melanom, die nicht das zu behandelnde Individuum sind, oder einschließlich des zu behandelnden Individuums sein. Entsprechende Anpassungen können für andere Spezifitäten des Immunstimulus vorgenommen werden.

Die infizierten Zellen zur Verabreichung, um einen Immunstimulus bereitzustellen, können vorzugsweise vor der Verabreichung, z.B. durch Bestrahlung, deaktiviert werden. Sie können vorzugsweise ausreichend lange vor der Deaktivierung inkubiert werden, um zu ermöglichen, dass sie das heterologe Gen exprimieren, das vom viralen Vektor getragen wird.

Gemäß den Beispielen der Erfindung wird auch ein dosiertes oder kalibriertes Präparat aus Vektor-infizierten, gegebenenfalls deaktivierten Zellen zur Verabreichung an ein Individuum, das es hinsichtlich eines Immunstimulus zu behandeln gilt, bereitgestellt, das bezogen auf die Dosierung, z.B. unter Bezugnahme auf die Anzahl oder Konzentration der infizierten Zellen, die es enthält, oder unter Bezugnahme auf die Menge an heterologem Genprodukt, das es exprimiert, kalibriert wurde.

Alternativ dazu können die genetisch funktionsgestörten Herpesvirusvektoren zur In-vivo-Verabreichung einer Menge oder Konzentration des Virusvektors verwendet werden, um Tumorzellen, z.B. Zellen eines festen Tumors wie beispielsweise eines Melanoms, in vivo zu kontaktieren und dadurch zu infizieren.

Zu den Zellen, die auf diese Weise nützlich behandelt werden können, zählen beispielsweise maligne Zellen aus Menschen und nichtmenschlichen Tieren, insbesondere beispielsweise maligne Zellen, die mit Blutzellen verwandt sind, z.B. Leukämiezellen, z.B. CD34+-Zellen (hämatopoetische Zellen) (siehe z.B. Zelltypen, wie sie von R. Jurecic et al., Kapitel 2, 7–30, in 'Somatic Gene Therapie', CRC Press, P.L. Chang (Hrsg.) (1995), genannt werden).

Immunologische Behandlung von Tumoren unter Verwendung von Cytokinen wird von N. Tahara et al., Kap. 15, 263–285, in 'Somatic Gene Therapy', CRC Press, P.L. Chang (Hrsg.) (1995), erläutert. Die hierin beschriebenen Vektoren können in den immunologischen Anwendungen der Cytokine und Verfahren zur Behandlung, die in dem oben genannten Bericht von N. Tahara et al. erläutert werden, unter Verwendung geeigneter Anpassungen und Modifikationen, wie Fachleuten auf dem Gebiet der Erfindung ohnedies ersichtlich sein wird, angewandt werden.

Die Erfindung findet ferner auch Anwendung in vitro, beispielsweise bei In-vitro-Behandlungen wie Expansion von T-Zellen wie z.B. virusspezifischen zytotoxischen T-Zellen. Zwei Komplikationen zahlreicher immununterdrückender oder zytotoxischer Behandlungen sind generalisierte Virämie nach Virusinfektionen und Expansion von virustransformierten Zellen als Resultat von Reaktivierung latenter Viren. Dies ist auf die Tatsache zurückzuführen, dass der normale Mechanismus zur Kontrolle solcher Infektionen infolge der Behandlung inhibiert ist. Eine mögliche Lösung für dieses Problem ist die In-vitro-Produktion der geeigneten zytotoxischen T-Zellen, die in der Lage sind, die virusinfizierten Zellen zu steuern. Dies kann durch Isolieren der peripheren mononuklearen Blutzellen oder Lymphozyten oder T-Zellen vor der Behandlung des Patienten und durch Stimulieren solcher Zellen in vitro mit einem Präparat aus Lebendvirus erfolgen. Es ist erforderlich, Lebendvirus zu verwenden, da zytotoxische T-Zellen im Allgemeinen gegen Peptide gerichtet sind, die aus Fremdproteinen stammen, die innerhalb der das Antigen präsentierenden Zelle synthetisiert werden: deaktiviertes Virus oder einzelne Proteine sind zum Hervorrufen zytotoxischer T-Zell-Antworten sehr schlecht geeignet. Die aktivierten Zellen werden anschließend in Kultur über einen Zeitraum von mehreren Wochen unter weiterer Stimulierung mit Antigen und einem Wachstumsfaktor wie z.B. Interleukin-2 ausgebreitet. Es gibt jedoch das Bedenken, dass verbleibendes Lebendvirus in der Zellkultur vorhanden sein könnte, wenn die CTLs in den Patienten neuerlich per Infusion eingeführt werden. Die Verwendung eines funktionsgestörten Herpesvirus, das in der Lage ist, CTL-Aktivität zu induzieren, jedoch nicht in der Lage ist, sich innerhalb des Patienten auszubreiten, sofern es unbeabsichtigt zusammen mit den in vitro vermehrten Zellen verabreicht wird, kann somit einen Vorteil gegenüber einem System bieten, das replikationsfähiges Virus verwendet.

Somit stellt die Erfindung ferner ein Verfahren zur Produktion von virusspezifischen zytotoxischen T-Zellen bereit, das folgende Schritte umfasst:

  • (a) das Isolieren einer Probe von mononuklearen Blutzellen, Lymphozyten oder T-Zellen aus einem Patienten;
  • (b) das Kultivieren der Probe in vitro in Gegenwart eines mutierten Herpesvirus, das hinsichtlich eines ersten Gens, das zur Produktion von infektiösem Virus essenziell ist, defekt ist und das gegebenenfalls eine heterologe Nucleotidsequenz umfasst, die für ein immunmodulierendes Protein kodiert; und
  • (c) das neuerliche Einführen per Infusion von kultivierten Zellen in den Patienten.

Bestimmte virale Herpesvektoren, die von der vorliegenden Erfindung bereitgestellt werden, können auch bei Gentherapie, z.B. korrigierender Gentherapie, eingesetzt werden. In einer solchen Anwendung kann der Vektor ferner für ein Gen kodieren, das mittels korrigierender Gentherapie zugeführt wird, z.B. für ein für ADA kodierendes Gen oder ein anderes Gen, das zu einem Zweck, wie z.B. oben erwähnt, verabreicht wird. Ein wie hierin beschriebener Vektor, der für das immunmodulierende Protein TGF-&bgr; kodiert, kann insbesondere als Vektor für korrigierende Gentherapie geeignet sein, um die Antwort des behandelten Individuums, das üblicherweise entweder direkt mit einem hierin bereitgestellten Vektor oder mit, autologen oder heterologen, Lebendzellen nach ihrer Infektion mit dem Vektor behandelt wird, herabzuregulieren. Negative immunmodulierende Wirkungen können durch diese oder eine andere geeignete Auswahl an immunmodulierenden Proteinen bereitgestellt werden. Eine weitere Auswahl von immunmodulierenden Proteinen für diese Anwendung kann beispielsweise wie folgt lauten: Inhibierung von Th1-Wirkungen kann mit Vektoren erzielt werden, die für Th2-Cytokine kodieren, oder umgekehrt; beispielsweise mit einem Vektor, der für IL10 kodiert, gegen Th1-Wirkungen und einem Vektor, der für IFN-&ggr; kodiert, gegen Th2-Wirkungen. Die Immunantwort kann ferner unter Verwendung eines Vektors, der für beispielsweise ein Immun-herabregulierendes Gen von viralem oder anderem pathogenem Ursprung kodiert, z.B. eines Vektors, der für ein Herpes-ICP47-Gen (aus HSV1 oder HSV2) oder darüber hinaus für ein anderes bekanntes, Immun-herabregulierendes Gen, z.B. E3-gp19k von Adenovirus (siehe G. Fejer et al., J. Virol. 68, 5871–5881 (1994)), kodiert, herabreguliert werden. Verfahren zur Gentherapie aus der Literatur, z.B. aus USP 5.399.346 (W.F. Anderson et al.), können an die Verwendung der hierin bereitgestellten Vektoren angepasst werden.

Alternativ dazu können die hierin offenbarten Systeme verwendet werden, um immunmodulierende Proteine, insbesondere authentische Säugetierproteine, zu exprimieren. Zahlreiche Expressionssysteme sind zur Herstellung klinisch relevanter Proteine verfügbar. Das ausgewählte Expressionssystem und insbesondere der verwendete Organismus zeigen großen Einfluss auf die endgültigen Eigenschaften des Proteins, mit möglichem Einfluss auf Molekulargewicht und Glykosylierungsgrad, Immunogenität, Toxizität und Potenz. GM-CSF wurde in E.-coli- (R.T. Libby et al, DNA (6. Juni 1987)), Hefe- (V. Price et al., Gene 55, 2–3 (1987)) und Säugetierzellkultursystemen erfolgreich hergestellt, wobei jedoch beachtliche Unterschiede bezüglich Ausbeute, Produktkapazität und daher auch Kosten, Toxizität und In-vivo-Clearance-Raten zu beobachten sind (R.T. Dorr, Clin. Ther. 1993 (Jan.–Feb.), 15; D. Hovgaard, Eur. J. Hematology 1993 (Jan.), 50). Diese Parameter können wiederum die wirtschaftliche und technische Praktikabilität der Behandlung einer bestimmten Erkrankung mit einem Proteinprodukt beeinflussen.

Um die vorliegende Erfindung ausführlicher darzustellen, werden Ausführungsformen als Beispiele, jedoch keineswegs als Einschränkung beschrieben. Die Konstruktion und Eigenschaften eines gH-defekten Virus werden von Forrester et al., J. Virol. 66, 341 (1992), in der WO 92/05263 und in der WO 94/21807 beschrieben. Darüber hinaus können sämtliche genetische Manipulationsverfahren gemäß Standardverfahren, wie sie in "Molecular Cloning: A Laboratory Manual", Sambrook, Fritsch & Maniatis (Hrsg.), Cold Spring Harbor Laboratory Press (1989), beschrieben werden, durchgeführt werden.

Die Beispiele werden nicht einschränkend durch Verweis auf die beiliegenden Zeichnungen veranschaulicht, worin die 1 bis 6 Diagramme sind, die die Konstruktion der Plasmide pIMMB45, pIMMB56, pIMMB46, pIMC14, pIMR1 bzw. pIMR3 veranschaulichen. 7 ist ein Rekombinationsdiagramm, das die einführende Beschreibung der Erfindung veranschaulicht.

Die nachstehende Beschreibung umfasst insbesondere:

die Konstruktion von gH-deletiertem HSV1 und HSV2, die für (murinen) GM-CSF an der Deletionsstelle des gH-Gens kodieren und in der Lage sind, Expression von GM-CSF in einer infizierten Zelle hervorzurufen;

das Testen der Wirkung eines solchen Vektors als Immunogen (Vakzine);

die Konstruktion von gH-deletiertem HSV2, das für menschlichen GM-CSF an der Deletionsstelle des gH-Gens kodiert und in der Lage ist, Expression von GM-CSF in einer infizierten Zelle hervorzurufen; und

die Konstruktion von gH-deletiertem HSV2, das für menschliches IL-2 an der Deletionsstelle des gH-Gens kodiert und in der Lage ist, Expression von IL-2 in einer infizierten Zelle hervorzurufen.

Konstruktion von gH-deletiertem HSV1 und gH-deletiertem HSV2, die GM-CSF exprimieren

Das gH-deletierte HSV1-Virus und das gH-deletierte HSV2-Virus wurden in den komplementierenden Zelllinien vermehrt. Diese Zelllinien wurden gentechnisch verändert, sodass sie das HSV-1-gH-Gen bzw. das HSV-2-gH-Gen exprimieren. Solche Zelllinien können wie in der WO 94/05207 und der WO94/21807 und den darin zitierten Verweisen beschrieben konstruiert werden. Der folgende Abschnitt stellt eine nähere Beschreibung der Konstruktion geeigneter Zelllinien bereit und beginnt mit der Konstruktion bestimmter Plasmide.

Quelle für Virus-DNA:

Ist virale HSV-DNA erforderlich, so kann diese beispielsweise (im Fall von HSV2) aus dem Stamm HG52 mittels des Verfahrens von Walboomers & Ter Schegget, Virology 74, 256–258 (1976), oder durch geeignete Anpassungen dieses Verfahrens hergestellt werden. Eine ausgewählte Stammlösung des HG52-Stamms wird am Institute of Virology, MRC Virology Unit, Church Street, Glasgow, Schottland, UK, aufrechterhalten. Die DNA anderer HSV-2-Stämme ist in dieser Region wahrscheinlich sehr ähnlich, und Stämme G und MS beispielsweise sind bei der ATCC, Rockville, Manland, USA, erhältlich.

Konstruktion von Plasmid pIMC05

Ein 4,3 kb umfassendes Sst-1-Fragment, das für das HSV-1- (HFEM) gH-Gen und den Stromab-HSV-1-gD-Promotor (–392 bis + 11) kodiert, wurde aus dem Plasmid pgDBrgH (Forrester et al., s.o.) ausgeschnitten und in pUC119 (Vieira & Messing, 1987) kloniert, um Plasmid pUC119gH zu produzieren. Eine Not-1-Stelle wurde in Plasmid pUC119pH mittels ortsgerichteter Mutagenese, 87 by stromab vom gH-Stoppcodon, eingeführt. Das resultierende Plasmid, pIMC03, wurde verwendet, um ein Not-1-Sst-1-Fragment zu bilden, das gepaart und in den eukaryotischen Expressionsvektor pRc/CMV (Invitrogen Corporation), vorverdaut mit Not 1 und Nru 1, um den CMV-IE-Promotor zu entfernen, eingeführt wurde. Das resultierende Plasmid pIMC05 enthält das HSV-1-gH-Gen unter der Transkriptionssteuerung des virusinduzierbaren gD-Promotors und von BGH (bovines Wachstumshormon) poly A. Es enthält auch das Neomycinresistenzgen zur Selektion von G418-resistenten stabilen Zelllinien.

Konstruktion einer gH-deletierten HSV-1-komplementierenden Zelllinie

Das Plasmid pIMC05 wurde unter Verwendung des CaPO4-Verfahrens (Sambrook, Fritsch & Maniatis, A Laboratory Manual, Cold Spring Harbor Laboratory Press) in Vero- (ATCC-Nr. 88020401) Zellen transfiziert. Die Zellen wurden durch Verdünnungsklonieren in Gegenwart von G418 selektiert, und eine klonale Zelllinie wurde isoliert. Nach der Ausbreitung und dem Einfrieren wurden die Zellen in 24-Well-Platten überimpft und auf ihre Fähigkeit getestet, das Wachstum von gH-negativem Virus durch Infektion mit SC16&Dgr;gH (Forrester et al., s.o.) bei 0,1 pfu/Zelle zu unterstützen. Virusplaques wurden 3 Tage nach der Infektion beobachtet, was die Expression des gH-Gens bestätigte.

Konstruktion einer BHK-TK-Zelllinie

Diese Zellen wurden durch Transfektion von Plasmid pIMC05 in Thymidinkinasenegative (TK) BHK-Zellen (ECACC Nr. 85011423) in derselben Weise, wie für gH-deletierte HSV-1- und gH-deletierte HSV-2-Komplementärzellen beschrieben wurde, produziert.

Konstruktion von Plasmid PIMC08

Plasmid pIMMB24, das das HSV-2-gH-Gen enthält, wird aus zwei benachbarten BamHI-Fragmenten von HSV-2-Stamm 25766 konstruiert. Die Plasmide wurden als pTW49, das das BamHI-R-Fragment mit etwa 3484 Basenpaaren enthielt, und als pTW54, das das BamHI-S-Fragment mit etwa 3311 Basenpaaren enthielt, bezeichnet, die beide in die BamHI-Stelle von pBR322 kloniert wurden. Äquivalente Plasmide können leicht aus zahlreichen verfügbaren Stämmen oder klinischen Isolaten von HSV-2 kloniert werden. Das 5'-Ende des HSV-2-Gens wird aus pTW54 unter Ver- wendung von BamHI und KpnI ausgeschnitten, um ein 2620 Basenpaare umfassendes Fragment zu bilden, das gelgereinigt wird. Das 3'-Ende des HSV-2-gH-Gens wird aus pTW49 unter Verwendung von BamHI und SalI ausgeschnitten, um ein 870 Basenpaare umfassendes Fragment zu bilden, das ebenfalls gelgereinigt wird. Die zwei Fragmente werden in pUC119 kloniert, das mit SalHI und KpnI verdaut wurde. Dieses Plasmid enthält nun das gesamte HSV-2-gH-Gen.

Plasmid pIMC08, das das HSV-2- (Stamm 25766) gH-Gen enthält, wurde wie folgt konstruiert. Plasmid pIMMB24 wurde mit NcoI und BstXI verdaut, und das den zentralen Abschnitt des gH-Gens enthaltende Fragment wurde aus einem Agarosegel gereinigt. Das 5'-Ende des Gens wurde aus zwei Oligonucleotiden CE39 und CE40 rekonstruiert, die eine Bindungssequenz, begrenzt durch HindIII- und NcoI-Stellen, bilden.

Das 3'-Ende des Gens wurde aus zwei Oligonucleotiden CE37 und CE38 rekonstruiert, die eine Bindungssequenz, begrenzt durch BstXI- und NotI-Stellen, bilden.

Die zwei Oligonucleotidlinker und das gereinigte NcoI-BstXI-gH-Fragment wurden in einer Dreifachligation in HindIII-NotI-verdautes pIMC05 kloniert, wodurch das HSV-1-gH-Gen durch das HSV-2-gH-Gen ersetzt wurde. Das resultierende Plasmid wurde als pIMC08 bezeichnet.

Konstruktion einer gH-deletierten HSV-2-Komplementärzelllinie

Das Plasmid pIMC08 enthält das HSV-2-gH-Gen unter der Transkriptionskontrolle des virusinduzierbaren gD-Promotors und BGH- (bovines Wachstumshormon) poly- A. Es enthält auch das Neomycinresistenzgen zur Selektion von G418-resistenten stabilen Zelllinien. Das Plasmid pIMC08 wurde unter Verwendung des CaPO4-Verfahrens (Sambrook, Fritsch & Maniatis, A Laboratory Manual, Cold Spring Harbor Laboratory Press) in Vero- (ATCC-Nr. 88020401) Zellen transfiziert. Zellen wurden durch Verdünnungsklonieren in Gegenwart von G418 selektiert, und eine klonale Zelllinie wurde isoliert. Nach Ausbreitung und Einfrieren wurden diese Zellen, bezeichnet als CR2-Zellen, in 24-Well-Platten überimpft und mit dem gH-deletierten HSV-1 (SC16 gH) mit 0,1 pfu/Zelle infiziert. Virusplaques wurden 3 Tage nach der Infektion beobachtet, was die Expression des gH-Gens bestätigte.

Konstruktion rekombinanter Plasmide a) pIMMB56+

pIMMB56+ ist ein Vektor mit einer IacZ-Kassette, flankiert durch HSV-2-Sequenzen von beiden Seiten des gH-Gens. Er wird wie folgt hergestellt: die zwei PCR-Fragmente, die mit den Oligos MB97-MB96 und den Oligos MB57-MB58 gebildet werden, werden mit den Restriktionsenzymen verdaut, die für die Stellen geeignet sind, die in die PCR-Oligonucleotide eingebunden wurden. Das MB97-MB96-Fragment wird mit HindIII und HpaI verdaut. Das MB57-MB58-Fragment wird mit HpaI und EcoRI verdaut. Diese Fragmente werden in den Vektor pUC119 ligiert, der mit HindIII und EcoRI verdaut wurde. Das resultierende Plasmid wird als pIMMB45 bezeichnet (1).

Die zur PCR verwendeten Oligonucleotide sind nachstehend gezeigt:

Um einfache Detektion der Rekombinanten aus der ersten Phase zu ermöglichen, wird das E.-coli-&bgr;-Galactosidase-Gen unter der Steuerung eines SV40-Promotors in pIMMB45 insertiert. Der SV40-Promotor plus &bgr;-Galactosidase-Gen wird aus dem Plasmid pCH110 (Pharmacia) unter Verwendung von BamHI und Tth III 1 ausgeschnitten. Die Enden werden unter Verwendung des Klenow-Fragments von DNA-Polymerase aufgefüllt. Das Fragment wird gelgereinigt. Das Plasmid pIMMB45 wird mit HpaI verdaut, mit Calf Intestinal Alkaline Phosphatase (CIAP) phosphatiert, um Selbstligation zu unterbinden, und gelgereinigt. Die gelgereinigten Fragmente werden dann miteinander ligiert, um Plasmid pIMMB56+ zu produzieren (siehe 2).

b) pIMMB46

pIMMB46 enthält Sequenzen, die das HSV-2-gH-Gen flankieren, mit einer zentralen einmaligen HpaI-Stelle. Jegliches Gen, das in diese Stelle kloniert wird, kann durch Rekombination in das HSV-2-Genom am gH-Locus insertiert werden. Ist das Virus ein TK-negatives gH-negatives Virus (beispielsweise unter Verwendung des oben beschriebenen pIMMB56+-Plasmids gebildet), so ersetzt das Plasmid das 3'-Ende des TK-Gens, wodurch TK-Aktivität wiederhergestellt und Selektion auf TK-positives Virus ermöglicht wird.

Die durch die Oligos MB94-MB109 und die Oligos MB57-MB108 gebildeten zwei PCR-Fragmente werden mit den Restriktionsenzymen verdaut, die für die Stellen geeignet sind, die in die PCR-Oligonucleotide eingebunden wurden. Das MB94-MB109-Fragment wird mit HindIII und HpaI verdaut. Das MB57-MB108-Fragment wird mit HpaI und EcoRI verdaut. Diese Fragmente werden dann in den Vektor pUC119 ligiert, der mit HindIII und EcoRI verdaut wurde. Das resultierende Plasmid wird als pIMMB46 bezeichnet (siehe 3). Die verwendeten Oligonucleotide sind die folgenden:

c) pIMC14

Das Plasmid pRc/CMV (Invitrogen Corporation) wurde mit den Restriktionsenzymen NruI, PvuII und BsmI verdaut, und ein 1.066 Basenpaare umfassendes NruI-PvuII-Fragment wurde aus einem Agarosegel isoliert. Das Fragment wurde in HpaI-verdautes pIMMB46 kloniert (siehe 4). Das Resultat davon wird als pIMC14 bezeichnet.

Das pRc/CMV-Fragment enthält den frühen Zytomegalievirus-Hauptzwischenpromotor (CMV-IE-Promotor) und die Poly-A-Additionsstelle von bovinem Wachstumshormon (BGH). Dieses Plasmid, pIMC14, ist ein allgemeines rekombinantes Plasmid mit einzelnen Stellen zur Insertion von Fremdgenen, die dann zu einem HSV-2-gH-deletierten DISC-Vektor rekombiniert werden können.

d) pIMR1

Das Plasmid pIMR1 ist ein rekombinanter Vektor zur Insertion des murinen GM-CSF-Gens unter der Steuerung des CMV-IE-Promotors in einen DISC-HSV-2-Vektor. pIMC14 wird mit XbaI verdaut, mit CIAP phosphatiert, gelgereinigt, und die überstehenden Enden werden mit Klenow-Polymerase bündig gemacht. Das murine GM-CSF-Gen wird aus dem Plasmid pGM 3.2FF (bezeichnet als pGM 3.2 in Gough et al., EMBO Journal 4, 645–653 (1985)) (oder aus dem entsprechenden Plasmid, das wie nachstehend beschrieben konstruiert wird) durch ein Zweiphasen-Verfahren ausgeschnitten. Zuerst wird pGM 3.2FF mit EcoRI verdaut, und ein 1.048 Basenpaare umfassendes Fragment wird gelgereinigt. Dieses Fragment wird dann mit HinfI und StuI verdaut. Das 495 Basenpaare umfassende Fragment wird gelgereinigt, und die Enden werden mit Klenow-Polymerase repariert. Dieses Fragment wird dann in Mehrfach-Klonierungsstellen von pIMC14, hergestellt wie oben beschrieben, kloniert. Das resultierende Plasmid wird als pIMR1 bezeichnet (siehe 5).

Ein alternatives Plasmid, das mit pGM 3.2 äquivalent ist, kann wie folgt konstruiert werden.

Eine Bibliothek von cDNA-Klonen wird aus einer klonierten T-Lymphozytenlinie (aus einem BALB/c-Mäusestamm) wie z.B. LB3 (Kelso et al., J. Immunol. 132, 2932 (1984)) konstruiert, in der die Synthese von GM-CSF durch Concanavalin A induzierbar ist. Die Bibliothek wird mittels Koloniehybridisierung mit einer Sequenz, die für das murine GM-CSF-Gen spezifisch ist, durchsucht (siehe Gough et al., EMBO J. 4, 645 (1985), für die Sequenz). Ein Beispiel für ein in diesem Fall einsetzbares Oligonucleotid ist 5' TGGATGACAT GCCTGTCACA TTGAATGAAG AGGTAGAAGT 3'. Klone mit über 1 kb werden ausgewählt und sequenziert, um zu überprüfen, ob sie GM-CSF sind. Diese Vorgänge können wie in "Molecular Cloning: A Laboratory Manual", Sambrook, Fritsch & Maniatis (Hrsg.), Gold Spring Harbor Laboratory Press, beschrieben durchgeführt werden. Solch ein Vorgang führt zu einem Klon, der die vollständige GM-CSF-Sequenz aufweist, die mit HinfI und StuI, wie für pGM 3.2 beschrieben, ausgeschnitten werden kann.

e) pIMR3

In Plasmid pIMR1 geht dem offenen Leseraster für das GM-CSF-Gen ein kurzer offener Leseraster (ORF) mit 15 Basenpaaren voraus. Da es als möglich angenommen wurde, dass dies die Expression von GM-CSF stören könnte, wurde das Plasmid pIMR1 insofern verändert, dass dieser kleine Leseraster entfernt wurde. pIMR1 wurde mit NotI und PpuMI verdaut. Der verdaute Vektor wurde mit alkalischer Phosphatase aus Kälberdarm (CIAP) phosphatasiert und gelgereinigt. Die Sequenzen zwischen den zwei Restriktionsenzymstellen wurden durch ein kurzes Stück doppelsträngiger DNA ersetzt, das durch Anellieren der zwei Oligonucleotide CE55 und CE56 gebildet wurde:

CE55 GGCCGCTCGAACATGGCCCACGAGAGAAAGGCTAAG

CE56 GACCTTAGCCTTTCTCTCGTGGGCCATGTTCGAGC

Die Oligonucleotide wurden so konstruiert, dass sie überstehende Enden aufwiesen, die mit den NotI- und PpuMI-Enden, die durch den Verdau von pIMR1 gebildet wurden, kompatibel waren. Die zwei Oligonucleotide wurden anelliert, phosphoryliert und in NotI-PpuMI-verdautes pIMR1 ligiert. Der resultierende Vektor wurde als pIMR3 bezeichnet. Die Sequenzen in der relevanten Region werden nachstehend gezeigt:

Um ein HSV-1-DISC-Virus herzustellen, das das GM-CSF-Protein exprimiert, wurde eine andere Reihe von Plasmiden erstellt:

f) pIMMB34

Dies ist ein Rekombinationsvektor, der Sequenzen enthält, die das HSV-1-gH-Gen flankieren. Die linken Flankierungssequenzen deaktivieren das TK-Gen, das benachbart zum gH-Gen liegt. Die zwei PCR-Fragmente, die durch die Oligos MB97-MB100 und die Oligos MB61-MB58 gebildet werden, werden mit den Restriktionsenzymen, die für die Stellen geeignet sind, die in die PCR-Oligonucleotide eingebunden wurden, verdaut. Das MB97-MB100-Fragment wird mit HindIII und HpaI verdaut. Das MB61-MB58-Fragment wird mit HapI und EcoRI verdaut. Diese Fragmente werden dann in den Vektor pUC119 ligiert, der mit HindIII und EcoRI verdaut wurde. Das resultierende Plasmid wird als pIMMB34 bezeichnet. Die verwendeten Oligonucleotide sind folgende:

g) pIMMB55+

Um eine einfache Detektion der Rekombinanten der ersten Phase zu ermöglichen, wird das E.-coli-&bgr;-Galactosidase-Gen unter der Steuerung eines SV40-Promotors in pIMMB34 insertiert. Der SV40-Promotor plus &bgr;-Galactosidase-Gen wird aus dem Plasmid pCH110 (Pharmacia) unter Verwendung von BamHI und Tth III 1 ausgeschnitten. Die Enden werden unter Verwendung des Klenow-Fragments von DNA-Polymerase aufgefüllt. Das Fragment wird gelgereinigt. Das Plasmid pIMMB34 wird mit HpaI verdaut, mit alkalischer Phosphatase aus Kälberdarm (CIAP) phosphatasiert, um Selbstligation zu unterbinden, und gelgereinigt. Die gelgereinigten Fragmente werden dann miteinander ligiert, um das Plasmid pIMMB55+ zu bilden.

h) pIMMB63

pIMMB63 wird aus HSV-1-Stamm-KOS-(m)-DNA gebildet. pIMMB63 enthält Sequenzen, die das HSV-1-gH-Gen flankieren, mit einer zentralen einmaligen HpaI-Stelle. Jegliches Gen, das in diese Stelle kloniert wird, kann durch Rekombination in das HSV-1-Genom am gH-Locus insertiert werden. Ist das Virus ein TK-negatives Virus (das beispielsweise unter Verwendung des oben beschriebenen pIMMB55+-Plasmids gebildet wurde), so ersetzt das Plasmid das 3'-Ende des TK-Gens, wodurch TK-Aktivität wiederhergestellt und Selektion auf TK-positives Virus ermöglicht wird.

Die durch die Oligos MB98-MB63 und die Oligos MB61-MB58 gebildeten zwei PCR-Fragmente werden mit den Restriktionsenzymen verdaut, die für die Stellen geeignet sind, die in die PCR-Oligonucleotide eingebunden wurden. Das MB98-MB63-Fragment wird mit HindIII und HpaI verdaut. Das MB61-MB58-Fragment wird mit HpaI und EcoRI verdaut. Diese Fragmente werden dann in den Vektor pUC119 ligiert, der mit HindIII und EcoRI verdaut wurde. Das resultierende Plasmid wird als pIMMB63 bezeichnet. Die verwendeten Oligonucleotide sind die folgenden:

i) pIMX1.0

Dieses Plasmid ist ein allgemeines Rekombinationsplasmid mit einmaligen Stellen für die Insertion von Fremdgenen, die dann zu einem HSV-1-gH-deletierten DISC-Vektor rekombiniert werden. Das Plasmid pRc/CMV wurde mit NruI und PvuII und einem 1.066 by umfassenden Fragment verdaut, das CMV-IE-Promotor und ein polyA-Signal enthält, wurde mit Klenow-Polymerase stumpfendig abgeschlossen und in die einmalige HpaI-Stelle von Plasmid pIMMB63 insertiert. Dieses Plasmid wird als pIMX1.0 bezeichnet. Die mehrfache Klonierungsstelle zwischen dem CMV-IE-Promotor und dem polyA-Signal ist für das Klonieren anderer Gene in das Plasmid und das darauf folgende Einführen in DISC HSV-1 ideal geeignet.

j) pIMX3.0

Das Plasmid pIMX3.0 ist ein Rekombinationsvektor für die Insertion von murinem GM-CSF unter der Steuerung von CMV-IE-Promotor in die deletierte gH-Region von Typ-1-DISC-HSV. Dieses Plasmid wurde durch Insertieren des murinen GM-CSF, der aus Plasmid pGM 3.2FF (s.o.) mit SmaI und DraI ausgeschnitten worden war, in die einmalige BsaBI-Stelle von pIMX1.0 konstruiert. Dieses Plasmid pIMX3.0 ist die HSV-1-Entsprechung zu pIMR3.

Konstruktion eines rekombinanten Virus

Rekombinantes Virus, das GM-CSF exprimiert, wurde in zwei Phasen hergestellt. In der ersten Phase wurden das gH-Gen und ein Teil des TK-Gens durch eine "IacZ-Kassette" ersetzt, die aus dem SV40-Promotor, der das E.-coli-IacZ-Gen steuert, bestand. Dieses Virus ist ein TK-minus-Phänotyp und ergibt auch blaue Plaques, wenn es unter einem Überzug, der das farbbildende Substrat X-gal enthält, gezüchtet wird. Dieses rekombinante Virus kann nun in geeigneter Weise zur Insertion von Fremdgenen am gH-Locus verwendet werden. Gene werden in Verbindung mit dem fehlenden Teil des TK-Gens insertiert. Zugleich wird die IacZ-Kassette entfernt. Diese Viren können auf Basis eines TK-positiven Phänotyps und einer weißen Farbe unter X-gal selektiert werden.

a) Konstruktion einer Rekombinante der ersten Phase mit SV40-IacZ-Kassette statt gH

Rekombinantes Virus wurde durch Transfektion von vitaler DNA mit dem Plasmid pIMMB56+ (für HSV-2) oder pIMMB55+ (für HSV-1) konstruiert. Vitale DNA wird an einem Natriumiodidgradienten, wie von Walboomers & Ter Schegget, Virology 74, 256–258 (1976), beschrieben, gereinigt.

Rekombination wird wie folgt durchgeführt:

a) Erste Phase

Ein Transfektionsgemisch wird durch Vermischen von 5 &mgr;g vitaler DNA, 0,5 &mgr;g linearisierter Plasmid-DNA (linearisiert durch Verdau mit dem Restriktionsenzym ScaI) in 1 ml HEBS-Puffer (137 mM NaCl, 5 mM KCl, 0,7 mM Na2HPO4, 5,5 mM Glucose, 20 mM Hepes, pH 7,05) hergestellt. 70 &mgr; von 2 M CaCl2 werden zugetropft und sanft vermischt. Das Medium wird aus einer subkonfluenten 5-cm-Schale von CR1- oder CR2-Zellen entfernt, und 500 &mgr;l&mgr;l des Transfektionsgemisches werden zu jeweils zwei Schalen zugesetzt. Die Zellen werden bei 37 °C 40 min lang inkubiert, wonach 4 ml Wachstumsmedium, das 5 % fötales Kälberserum (FCS) enthält, zugesetzt werden. 4 h nach dem Zusatz des Transfektionsgemisches wird das Medium entfernt, und die Zellen werden mit serumfreiem Medium gewaschen. Die Zellen werden dann mit 500 &mgr;l 15%igem Glycerin pro Schale 2 min lang unter "Schock" versetzt. Das Glycerin wird entfernt, die Zellen werden zweimal mit serumfreiem Medium gewaschen, und Wachstumsmedium, das 5 % FCS enthält, wird zugesetzt.

Nach 4–7 Tagen, wenn ein vollständiger vitaler zytopathogener Effekt (CPE) beobachtet wird, werden die Zellen in das Medium geschabt, bei 2.500 U/min 5 min lang bei 4 °C zentrifugiert und in 120 &mgr;l Eagles Minimal Essential Medium (EMEM) resuspendiert. Dies ist nun eine rohe Virusstammlösung, die Wildtyp- und rekombinantes Virus enthält. Die Stammlösung wird tiefgefroren, aufgetaut und beschallt sowie auf Rekombinanten von CR1-Zellen in einem Verdünnungsbereich gescreent. Das Medium enthält 10 &mgr;g/ml Acyclovir, um auf TK-minus-Virus zu selektieren. Nach dem Zusatz der Virusverdünnungen werden die Zellen mit Medium, das 1 % bei niedriger Temperatur erstarrender Agarose enthält, überzogen. Nach dem Auftreten viraler Plaques etwa nach 3 Tagen wird ein zweiter Überzug aus Agarose, die 330 &mgr;g/ml XgaI sowie 10 &mgr;g/ml Acyclovir enthält, zugesetzt. Blaue Plaques werden innerhalb von 48 Stunden selektiert und auf 24-Well-Platten (1 cm2 pro Well), die CR1-Zellen enthalten, übertragen. Die Plaques werden bis zu vollem CPE gezüchtet und durch Abschaben in das Medium geerntet. Es werden mehrerer Durchgänge an Plaque-Reinigung durchgeführt, bis eine reine Virusstammlösung erhalten wird.

Die Struktur der Rekombinante der ersten Phase wird wie folgt bestätigt. Natriumiodid-gereinigte virale DNA wird wie zuvor beschrieben hergestellt und mit BamHI verdaut. Dieser Verdau wird an einem Agarosegel getrennt und auf eine Nylonmembran übertragen. Diese wird mit einem radioaktiv markiertem DNA-Fragment, das zu den Sequenzen an beiden Seiten des gH-Gens homolog ist, sondiert.

b) Zweite Phase

Rekombination erfolgt wie zuvor unter Verwendung von viraler DNA aus der Rekombinante der ersten Phase und dem Plasmid pIMR3 (für HSV-2) oder pIMX3.0 (für HSV-1). Nach der anfänglichen Ernte von Virus werden TK-positive rekombinante Viren durch Wachstum auf BHK-gH-positiven TK-negativen Zellen in Gegenwart von 0,6 &mgr;M Methotrexat, 15 &mgr;M Thymidin, 9,5 &mgr;M Glycin, 4,75 &mgr;M Adenosin und 4,75 &mgr;M Guanosin selektiert. Drei Durchgänge dieses Selektionsverfahrens werden in 6-Well-Platten (10 cm2 pro Well) durchgeführt. In jeder Phase werden die infizierten Zellen durch Abschaben in das Medium, Zentrifugieren und Resuspendieren in 200 &mgr;l EMEM geerntet. Nach der Beschallung werden 50 &mgr;l hiervon zu frischen BHK-gH-positiven TK-negativen Zellen zugesetzt, und die Selektion wird fortgesetzt.

Nach der abschließenden Selektion werden die virusinfizierten Zellen wie zuvor beschrieben geerntet und auf gH-deletierte HSV1-komplementäre Zellen gescreent. Überzüge werden wie zuvor zugesetzt, und weiße Plaques werden in Gegenwart von XgaI selektiert. Plaques werden wie zuvor ausgewählt und dreimal auf den gH-deletierten HSV1-komplementären Zellen Plaque-gereinigt.

Die Struktur der viralen DNA wird wie zuvor beschrieben analysiert.

Testen des Vakzinenpotenzials des gH-deletierten, GM-CSF exprimierenden mutierten Virus

Das gH-deletierte, GM-CSF exprimierende mutierte Virus kann auf seine Wirksamkeit als Vakzine unter Verwendung eines Mausmodellsystems, wie es von Farrell et al., J. Virol. 68, 927–932 (1994), beschrieben wird, getestet werden. Gruppen von Mäusen werden durch Hautritzung an der Ohrmuschel mit variierenden Dosen im Bereich von 102 bis 106 plaquebildenden Einheiten (pfu) an gH-deletiertem mutiertem Virus, GM-CSF exprimierendem Virus, dem gH-deletierten, GM-CSF exprimierenden mutierten Virus und der gH-Revertante geimpft. Eine Kontrollgruppe wird mit PBS geimpft. Nach 3 Wochen werden die Mäuse in der gegenüberliegenden Ohrmuschel mit 106 pfu an Wildtyp-HSV-1 (Stamm SC16) geimpft. Fünf Tage nach dem Challenge werden die Mäuse getötet, die dem Challenge unterzogenen Ohren entfernt und bei –70 °C eingefroren. Die Ohren werden homogenisiert, und die Menge an infektiösem Challenge-Virus im Ohr wird durch Plaque-Titration bestimmt. Die Reduktion der Virustiter in den geimpften Gruppen von Mäusen, verglichen mit den PBS-behandelten Kontrollen ist ein Maß für den Schutz, der durch die Virusvakzine bereitgestellt wird. Es ist bekannt, dass das gH-deletierte Virus in Gegenwart von infektiösem Virus bei einer Impfdosis von 5 × 105 pfu vollständig beseitigen kann, während sogar bei 5 × 104 pfu eine 1000fache Reduktion beobachtet wird. Dass die gH-deletierte, GM-CSF exprimierende Mutante einen erhöhten Schutzgrad ergeben kann, kann durch Beobachtung von vollständigem Schutz vor jedem beliebigen infektiösem Virus bei geringeren Challenge-Dosen als im Fall der mit gH-deletiertem mutiertem Virus geimpften Mäuse und einer größeren Reduktion der infektiösen Virustiter im Vergleich zu den PBS-geimpften Kontrollen getestet werden. Das gH-deletierte GM-CSF-tragende Virus kann ein höheres Niveau an Antikörper-Antwort im Vergleich mit einem gH-deletierten Virus, das das GM-CSF-Gen nicht trägt, ergeben.

GM-CSF-Test

Cos-1-Zellen (ECACC Nr. 88031701) werden mit Plasmid-DNA unter Verwendung von DEAE-Dextran, wie in Gene Transfer and Expression, A Laboratory Manual, Michael Kriegler, beschrieben, transfiziert. Überstände aus transfizierten Cos-1-Zellen oder infizierten CR2-Zellen werden mittels Bioassay auf GM-CSF-Aktivität gescreent. Eine auf IL-3/GM-CSF reaktive murine hämatopoetische Zelllinie, bezeichnet als C2GM, wurde von Dr. E. Spooncer, Paterson Institute for Cancer Research, Christie Hospital, UK, erhalten. Die Zelllinie C2GM wird in Fischers-Medium mit 20 % Pferdeserum, 1 % Glutamin und 10 % konditioniertem Zellmedium aufrechterhalten. Das konditionierte Zellmedium wird aus exponentiell wachsenden Kulturen von Wehi-3b-Zellen (ECACC Nr. 86013003) erhalten, die murines IL-3 in das Medium sekretieren. Wehi-3b-Zellen werden in RPMI-1640-Medium, 10 % FCS und 1 % Glutamin gehalten.

Die obigen Beispiele beziehen sich auf die Schaffung von HSV-1- und HSV-2-Mutanten, die gH-negativ sind und GM-CSF exprimieren.

Die obige Beschreibung kann an die Konstruktion von Vektoren, die verschiedene immunmodulierende Proteine exprimieren, beispielsweise wie im Folgenden beschrieben, leicht angepasst werden:

Konstruktion von gH-deletierten HSV2-Vektoren, die menschlichen GM-CSF exprimieren

Menschlicher GMCSF und sein Gen werden von M. Cantrell et al., PNAS 82, 6250–6254 (1985); F. Lee et al., PNAS 82, 4360–4364 (1985); G. Wong et al., Science 228, 810–815 (1985), beschrieben.

DNA zum Klonieren ist durch die Verwendung von PCR und Oligonucleotiden auf standardmäßige Weise erhältlich, und eine gentechnisch veränderte Version des Gens ist auch im Handel bei R&D Systems Europe Ltd, Abingdon, OX14 3YS UK erhältlich.

Das Gen kann zum Klonieren durch gentechnisches Verändernder DNA-Enden, um sicherzustellen, dass eine natürliche Leadersequenz und das Startsignal für Expression in einem Säugetiersystem am 5'-Ende vorhanden sind, und, für die vorliegenden Zwecke, durch Zusetzen komplementärer Enden, um (am 5'-Ende) mit einer HindIII-Stelle und (am 3'-Ende) mit einer EcoRI-Stelle übereinzustimmen, vorbereitet werden.

Das vorbereitete Gen kann dann in einen Klonierungsvektor pcDNA3 (Invitrogen Corporation) zwischen den HindIII- und EcoRI-Stellen ligiert und kloniert werden. Der resultierende Vektor wird als pcDNA3-hGMSCF bezeichnet. Dieser kann mit EcoRI und anschließend mit HindIII verdaut, stumpfendig gemacht und wie zuvor beschrieben in den Vektor pIMC14 kloniert werden (anstelle des murinen Gens, wie es im oben beschriebenen Beispiel verwendet wird).

Der resultierende Klonierungsvektor mit hGMCSF kann dann in angepassten Varianten der übrigen Verfahren, die hierin bereits beschrieben wurden, verwendet werden, beispielsweise um einen gH-deletierten, defekten HSV2-Virusvektor, der für menschlichen GMCSF kodiert, an der Deletionsstelle des gH-Gens zu bilden.

Konstruktion von gH-deletierten HSV2-Vektoren, die menschliches IL-2 exprimieren

Menschliches IL-2 und sein Gen werden von T. Taniguchi et al., Nature 302 (5906), 305–310 (1983), sowie in der EMBL-Sequenz HSIL02 (mRNA, die für IL2 kodiert) beschrieben; siehe auch R. Devos et al., Nucl. Acids Res. 11(13), 4307–4323 (1983) (die sich auf bakterielle Expression beziehen).

DNA zum Klonieren ist z.B. aus T-Zellen unter der Verwendung von PCR und Oligonucleotiden auf übliche Weise erhältlich, und eine gentechnisch veränderte Version des Gens ist auch im Handel bei R&D Systems Europe Ltd., Abingdon, OX14 3YS, UK, erhältlich.

Das Gen kann zum Klonieren durch gentechnisches Verändern der DNA-Enden, um sicherzustellen, dass eine natürliche Leadersequenz und das Startsignal für Expression in einem Säugetiersystem am 5'-Ende vorhanden sind, und, für die vorliegenden Zwecke, durch Zusetzen komplementärer Enden, um (am 5'-Ende) mit einer HindIII-Stelle und (am 3'-Ende) mit einer EcoRI-Stelle übereinzustimmen, vorbereitet werden.

Das vorbereitete Gen kann dann in einen Klonierungsvektor pcDNA3 (Invitrogen Corporation) zwischen den HindIII- und EcoRI-Stellen ligiert und kloniert werden. Der resultierende Vektor wird als pcDNA3-hIL02 bezeichnet. Dieser kann mit EcoRI und anschließend mit HindIII verdaut, stumpfendig gemacht und wie zuvor beschrieben in den Vektor pIMC14 kloniert werden (anstelle des murinen GMCSF-Gens, wie es im oben beschriebenen Beispiel verwendet wird).

Der resultierende Klonierungsvektor mit menschlichem IL-2 kann dann in angepassten Varianten der übrigen Verfahren, die hierin bereits beschrieben wurden, verwendet werden, beispielsweise um einen gH-deletierten, defekten HSV2-Virusvektor, der für menschlichen IL-2 kodiert, an der Deletionsstelle des gH-Gens zu bilden.

Die Verfahren können leicht an andere Interleukine, Cytokine, Chemokine, z.B. IL-12, Lymphotactin und CD40L, unter vielen anderen, angepasst werden.

Somit kann beispielsweise unter Verwendung der viralen Vektoren, die hierin speziell beschrieben werden, ein Patient zu prophylaktischen oder therapeutischen Zwecken wie z.B. jenen, die hierin erwähnt wurden, durch die Verabreichung eines Immunogens oder einer Vakzine immunisiert werden, das bzw. die ein mutiertes Virus umfasst, das ein defektes Genom in Bezug auf ein selektiertes Gen aufweist, das zur Produktion von infektiösem Virus essenziell ist, sodass das Virus normale Zellen infizieren und Replikation und Expression viraler Antigen-Gene in diesen Zellen erfahren kann, jedoch keine normalen infektiösen Viren produzieren kann, worin das Genom auch eine heterologe Nucleotidsequenz aufweist, die in ihrer Funktion ein immunmodulierendes Protein, vorzugsweise an der Stelle des defekten essenziellen Gens, exprimiert.

Fachleute können diese Beschreibung einfach an die Herstellung anderer mutierter Viren anpassen, die hinsichtlich eines ersten Gens defekt sind, das für die Produktion von infektiösem Virus essenziell ist, sodass das Virus normale Zellen infizieren und Replikation und Expression von viralem Antigen in diesen Zellen erfahren kann, jedoch das genannte infektiöse Virus nicht produzieren kann, und die auch eine heterologe Nucleotidsequenz exprimieren, die für ein immunmodulierendes Protein kodiert.

Zahlreiche andere mutierte Viren können auf Grundlage von Deletion oder einer anderen Art von Deaktivierung (beispielsweise) der folgenden essenziellen Gene in den folgenden Viren und Virustypen hergestellt werden:

In Herpes-Simplex-Viren können essenzielle Gene wie z.B. gB, gD, gL, ICP4, ICP8 und/oder ICP27 gleichfalls wie das oder anstelle des gH-Gen(s), das in den obigen Beispielen verwendet wurde, deletiert oder in anderer Weise deaktiviert werden. In anderen Herpesviren können bekannte, essenzielle Gene, wie z.B. jegliche bekannte essenzielle Homologe zu den gB-, gD-, gL-, gH-, ICP4-, ICP8- und/oder ICP27-Genen von HSV, für Deletion oder eine andere Art von Deaktivierung ausgewählt weiden. Zytomegalievirus kann z.B. durch Deletieren oder anderweitige Aktivierung von Genen, die für temperaturempfindliche Mutationen, wie sie gemäß Dion et al., Virology 158, 228–230 (1987), identifizierbar sind, verantwortlich sind, auf genetischem Wege funktionslos gemacht werden.

In Pockenviren wie dem Vakziniavirus können genetisch funktionslos gemachte Viren durch Deletieren oder anderweitige Deaktivierung eines Gens wie z.B. eines von jenen, die als essenziell identifiziert wurden oder als solche identifiziert wurden, die konditionell-letale, temperaturempfindliche Mutanten entstehen lassen, wie z.B. in Goebel et al., Virology 179, 249ff (1990), beschrieben, gebildet werden.

Genetisch funktionslos gemachtes SV40-Virus kann durch Deletieren oder anderweitige Deaktivierung z.B. der T-Antigen-kodierenden Region gebildet werden.

Adenovirus Typ 5 kann beispielsweise durch Deletieren oder anderweitige Deaktivierung von essenziellen Genen wie z.B. jenen, die in den oben in der Einführung genannten Verweisen identifiziert wurden, genetisch funktionslos gemacht werden.

Diese Beispiele können auch auf hierin erwähnte Verwendungen angewandt werden.


Anspruch[de]
Mutiertes Herpesvirus mit einem Genom, das in Bezug auf ein ausgewähltes Gen, das zur Herstellung von infektiösen neuen Viruspartikeln wesentlich ist, defekt ist und das heterologes genetisches Material in sich trägt, das für ein Immunmodulationsprotein kodiert, sodass das mutierte Virus normale Wirtszellen infizieren kann und darin Expression des heterologen genetischen Materials, das für ein Immunmodulationsprotein kodiert, verursachen kann, wobei jedoch das mutierte Virus keine Produktion von infektiösen neuen Viruspartikeln verursachen kann, außer wenn das Virus rekombinante komplementierende Wirtszellen infiziert, die gebildet wurden, um ein Gen zu tragen und es exprimieren zu können, das die Funktion des essenziellen Virusgens liefert; wobei die Insertionsstelle des heterologen genetischen Materials, das für das Immunmodulationsprotein kodiert, an der Stelle des Defekts im ausgewählten essenziellen Virusgen liegt. Mutiertes Virus nach Anspruch 1, worin der Defekt in einem Virus-Glykoproteingen liegt. Mutiertes Virus nach Anspruch 1, das eine Mutante von Herpes-Simplex-Virus (HSV) ist. Mutiertes Virus nach einem der Ansprüche 2 oder 3, worin der Defekt in einem Herpesvirus-Glykoproteingen liegt, das Glykoprotein gH, gD, gB oder gL entspricht. Mutiertes Virus nach einem der vorangehenden Ansprüche, worin das heterologe genetische Material für ein Protein kodiert, das aus Cytokinen, Chemokinen, Komplementkomponenten, Immunsystem-Hilfsmolekülen und Rezeptoren dafür mit menschlicher oder nicht-menschlicher tierischer Spezifität ausgewählt ist. Mutiertes Virus nach einem der vorangehenden Ansprüche, worin das heterologe genetische Material für ein aus GM-CSF, IL-2, IL-12, OX40, OX40L (gp34) und CD40L ausgewähltes Protein kodiert. Verwendung eines mutierten Virus nach einem der Ansprüche 1 bis 6 als einen viralen Vektor bei der Herstellung eines Medikamentes zur prophylaktischen oder therapeutischen Verwendung zur Steigerung einer Wirt-Immunantwort in einer damit behandelten Person. Verwendung nach Anspruch 7, worin die Immunantwort gegen ein heterologes Antigen gerichtet ist, das kein Immunmodulationsprotein ist und durch das mutierte Virus kodiert wird. Verwendung eines mutierten Virus nach einem der Ansprüche 1 bis 6 bei der Herstellung einer Vakzine zur therapeutischen oder prophylaktischen Verwendung bei Tumortherapie. Verwendung eines mutierten Virus nach einem der Ansprüche 1 bis 6 bei der In-vitro-Vermehrung von (z.B. virusspezifischen) zytotoxischen T-Zellen. Verwendung eines mutierten Virus nach einem der Ansprüche 1 bis 6 bei der Herstellung eines Medikamentes zur therapeutischen oder prophylaktischen Korrektur-Gentherapie. Mutiertes Virus nach einem der Ansprüche 1 bis 6 zur Verwendung in einem Verfahren zur Bereitstellung eines Immunstimulus in einem behandelten Menschen oder nicht-menschlichem Tier, worin das Verfahren folgende Schritte umfasst:

(i) Kontaktieren des mutierten Virus ex vivo mit einem Präparat von Zellen, die in der Lage sind, nach Infektion mit dem Virusvektor einen Immunstimulus in einer zu behandelnden Person bereitzustellen; und

(ii) Verwendung der infizierten Zellen zur Bereitstellung eines Immunstimulus in der zu behandelnden Person.
Mutiertes Virus nach Anspruch 12, worin die infizierten Zellen verwendet werden, um durch direkte Verabreichung der infizierten Zellen in Form einer Vakzine z.B. nach Deaktivierung vor der Verabreichung, z.B. nach Bestrahlung, einen Immunstimulus in der zu behandelnden Person bereitzustellen. Mutiertes Virus nach Anspruch 12, worin die infizierten Zellen verwendet werden, um einen Immunstimulus in der zu behandelnden Person bereitzustellen, und dies durch Verwendung der Zellen, um ex vivo immunkompetente Zellen wie z.B. Zellen des Immunsystems der zu behandelnden Person zu primen oder zu stimulieren, woraufhin neuerliche Verabreichung der immunkompetenten Zellen z.B. ohne gleichzeitige Verabreichung von Virus oder virusinfizierten Zellen erfolgt. Mutiertes Virus nach Anspruch 14, worin die Zellen, die ex vivo mit dem Virusvektor infiziert werden, autologe Zellen sind. Mutiertes Virus nach Anspruch 14, worin die Zellen, die ex vivo mit dem Virusvektor infiziert wurden, heterologe Zellen sind und z.B. Zellen einer Tumorzelllinie umfassen.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com