PatentDe  


Dokumentenidentifikation DE69930660T2 05.04.2007
EP-Veröffentlichungsnummer 0001131408
Titel ZELLEN, KULTURVERFAHREN, UND IHRE VERWENDUNG IN AUTOLOGER TRANSPLANTATIONSTHERAPIE
Anmelder Hebe Ltd., Hamilton, BM
Erfinder DAVIES, Alison, Bridgend, Mid Glamorgan CF32 0ND, GB
Vertreter Weickmann & Weickmann, 81679 München
DE-Aktenzeichen 69930660
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 16.11.1999
EP-Aktenzeichen 999542699
WO-Anmeldetag 16.11.1999
PCT-Aktenzeichen PCT/GB99/03813
WO-Veröffentlichungsnummer 2000029551
WO-Veröffentlichungsdatum 25.05.2000
EP-Offenlegungsdatum 12.09.2001
EP date of grant 29.03.2006
Veröffentlichungstag im Patentblatt 05.04.2007
IPC-Hauptklasse C12N 5/06(2006.01)A, F, I, 20051017, B, H, EP

Beschreibung[de]

Die vorliegende Erfindung betrifft eine autologe Transplantationstherapie und insbesondere die Entnahme von Proben von eukaryontischen Geweben oder Zellen von einem gesunden Wirtsorganismus für eine nachfolgende Transplantation in diesen Wirt, nach einer zeitlichen Veränderung des Wirts, beispielsweise wenn der Bedarf auftritt, z.B. ein therapeutischer Bedarf. Die Vorteile liegen darin, dass Zellen in einem scheintoten Zustand gehalten werden (d.h. ruhende Zellen) an einem Zeitpunkt in der Zukunft manipuliert und/oder wiederbelebt werden können, wenn dies beispielsweise für eine Therapie erforderlich ist. Zellproben in einem Zustand des Scheintods können auch mittels Durchführung von mehreren Runden einer Ernte von primären Proben von derselben Organismusquelle bzw. denselben Organismusquellen vor der Manipulation und/oder Wiederbelebung angereichert werden.

Die Erhaltung und die Replikation von eukaryontischen Zellen in Kultur ist über viele Jahre praktiziert worden. Untersuchungen am Beginn dieses Jahrhunderts (Proc. Soc. Exp. Biol. Med. 4 (1907) 140; J. Exp. Med. 15 (1912) 516) haben gezeigt, dass es möglich ist, Gewebeproben von Tieren oder Menschen zu entnehmen und die Zellen daraus für unterschiedliche Zeiträume in Abhängigkeit von den Kulturbedingungen in einer in vitro-Kultur zu erhalten. Die meisten frühen Kulturen bestanden aus dem Eintauchen von tierischem Gewebe oder von Zellen in Blut oder Blutbestandteile, wie etwa Serum. Blut oder Serum war der Hauptbestandteil des Mediums, in welchem Gewebe/Zellproben kultiviert wurden. Als sich jedoch unser Wissen über die in vitro-Anforderungen von Zellen vermehrt hat, hat die Verwendung von Serum oder Blutbestandteilen in Zell/Gewebekulturmedium in dem Ausmaß abgenommen, in welchem nun vollständig definierte Medien verfügbar sind, welche alle die Nährstoffe und Zusätze enthalten, die zur Erhaltung für zumindest einige Zelltypen in Kultur notwendig sind (siehe z.B. „Freshney's Tissue Culture of Animal Cells", („Culture of Animal Cells: A Manual of Basic Technique", Wiley Liss, 1994)).

Jedoch ist das Erhalten von eukaryontischen Zellen für längere Zeiträume in Kultur stets mit Schwierigkeiten erfüllt gewesen und bleibt mit Schwierigkeiten behaftet. Das Hauptproblem ist, dass es im Allgemeinen nicht möglich ist, aus mehrzelligen Organismen entnommene eukaryontische Zellen für mehr als einige wenige Tage bis zu Wochen in einer primären Kultur zu halten. Dies rührt daher, dass Zellen in Primärkultur eine beschränkte Lebensdauer aufweisen. In einigen Fällen kann jedoch ihre Erhaltung auf unbestimmte Zeit verlängert werden. Beispielsweise kann eine einzelne Zelle oder eine Gruppe von Zellen genetische Veränderungen durchlaufen, welche ihr/ihnen eine kontinuierliche Beibehaltung der Zellreplikation in der Umgebung einer in vitro-Kultur ermöglichen. Solche genetischen Veränderungen betreffen im Allgemeinen Mutationen, welche zelluläre Protoonkogene dazu aktivieren, zu Onkogenen zu werden, und/oder Mutationen, welche die Aktivität von Tumorsupressorgenen beschränken oder zunichte machen, was zum Verlust der Hemmung der Replikation und zur Entwicklung einer zellulären Unsterblichkeit führt (Trends in Genetics 9 (1993) 138). Unser gegenwärtiges Verständnis unterstellt, dass Tumorzellen nicht aufgrund der plötzlichen Aktivierung von immortalisierenden Onkogenen Krebs verursachen, sondern aufgrund von Mutationen in Genen, welche normalerweise die Fähigkeit der Zelle zur Beschränkung ihrer eigenen Replikation regulieren. Diese genetischen Ereignisse, welche ebenso in vivo wie in vitro auftreten, haben zur Erzeugung von mehrzelligen Organismen von eukaryontischen Zelllinien geführt, welche in einer kontinuierlichen Kultur erhalten werden können („Culture of Animal Cells: A Manual of Basic Technique", Wiley Liss, 1994).

Obwohl es möglich ist, Zelllinien in Kultur zu halten, kann dies aufgrund ihrer Fähigkeit, eine kontinuierliche Replikation zu durchlaufen, von Nachteil oder unerwünscht sein. Um Resourcen einzusparen, wäre es besser, wenn es möglich wäre, Zellen zu lagern, bis sie für eine Kultur benötigt werden. Es sind Technologien entwickelt worden, welche eine solche Lagerung erlauben, wobei viele Informationen aus Untersuchungen mit prokaryontischen Organismen stammen.

Die frühe Arbeit mit prokaryontischen Organismen wie etwa Bakterien und Viren zeigte, dass es möglich war, diese für lange Zeiträume in einem Ruhezustand zu halten, ohne ihre Fähigkeit zum Überleben und zur Replikation bei der Wiederbelebung oder Revitalisierung aus ihrem Ruhezustand zu beeinflussen. Es ist gezeigt worden, dass prokaryontische Organismen durch Verwendung einer Anzahl von Verfahren, wie etwa Einfrieren, Gefriertrocknen, Trocknen oder durch Platzieren der Organismen in verschiedene organische oder anorganische Lösungen mit oder ohne nachfolgendes Einfrieren in einen Ruhezustand (Scheintod) gebracht werden können. Diese Lösungen umfassen Dimethylsulfoxid (DMSO), Ethanol, Ether, Glycerol, phosphatgepuffertes Natriumchlond und Serum, oder Gemische davon, oder eine beliebige andere Substanz, welche die Lagerfähigkeit verlängern kann, sind aber nicht auf diese beschränkt.

Viele, wenn nicht alle der Verfahren, durch welche prokaryontische Zellen in einen Ruhezustand gebracht werden oder in einem Ruhezustand gehalten werden können, sind auch bei eukaryontischen Zellen angewendet worden.

Das Erhalten von Zellen in einer Kulturumgebung ermöglicht die Durchführung von Manipulationen an Zellen in vitro und dieser Vorteil hat aud dem Gebiet der diagnostischen Technologie zur Entwicklung von Assays auf Zellbasis geführt. Es ist gezeigt worden, dass die Zellkultivierung deshalb entweder vor der Induktion der Ruhe oder nach der Zellrevitalisierung für die diagnostische Medizin ebenso wie die Grundlagenforschung wichtige Anwendungen bereistellt (Bone 22 (1998) 7; J Bone Min Res 13 (1998) 432).

Zellkulturverfahren sind außer bei der medizinischen Diagnose auch für medizinische Therapien angewendet worden. Beispielsweise ist ein Ansatz zur Linderung der Erkrankung in Fällen, bei welchen Patienten an Leukämie leiden, dass die Tumorzellen des Patienten durch Radiotherapie, Chemotherapie und/oder einen chirurgischen Eingriff ausgerottet werden. Jedoch können Radiotherapie und Chemotherapie, welche anscheinend die einzig praktischen Behandlungen für systemische und/oder metastatische Erkankungen sind, auch die normalen hämatopoietischen Nicht-Tumorzellen des Patienten zerstören oder wesentlich anreichern. Folglich ist es gängige Praxis, die abgereicherten normalen Zellen des Patienten mit denjenigen vom Knochenmark eines Spenders zu ersetzen. Der Spender ist oft ein naher Verwandter, dessen "Gewebetyp" ähnlich ist wie der des Patienten, und deshalb ist es weniger wahrscheinlich, dass das Spendergewebe vom Patienten abgestoßen wird (Adv Immunol 40 (1987) 379).

Neben der möglichen Abstoßung der implantierten Zellen durch den Wirt besteht auch das mögliche Problem der Transplantat-Wirt-Reaktion (GVH, "Graft Versus Host Disease"). Die überwältigende Mehrheit der Lymphozyten in einer Markprobe eines Spenders sind unreif und nicht in der Lage, eine komplette Immunreaktion auszulösen, ohne zuerst einen Reifungsprozess zu durchlaufen. Die Reifung tritt auf, wenn Lymphozyten durch den Thymus prozessiert werden. Wenn unreife Lymphozyten vom Spender durch den Thymus des neuen Wirts prozessiert werden, akzeptieren sie den Wirt als "eigen". Jedoch ist es unvermeidlich, dass ein Teil der Spender-T-Lymphozyten vor der Transplantation eine Reifung durch den Thymus des Donors durchlaufen haben und folglich den Empfänger als fremd erkennen könnten. Wenn dies so ist, können die reifen Spender-T-Lymphozyten versuchen, die Zellen des Wirts anzugreifen, was zu der GVH-Erkrankung führt (Immunol Rev 157 (1997) 79).

Um die Wahrscheinlichkeit zu verringern, dass das Transplantat den Wirt ablehnt, können die Markproben des Spenders beispielsweise mit Antikörpern abgefischt werden, welche reife T-Zellen spezifisch erkennen und daran binden, was deren Entfernung oder Lyse vor der Transplantation ermöglicht (Curr Op Oncol 9 (1997) 131). Deshalb ist ersichtlich, das die in vitro-Kultur von humanen Spenderzellen und deren Manipulation vor der Implantation eine anerkannte Methodik in der Transplantationstherapie ist.

Für die Behandlung von Erkrankungen wie etwa Leukämien und Lymphomen ist es oft praktischer, Spendermark bereitzustellen, bevor es für eine Transplantation in den Patienten benötigt wird. In diesen Fällen wird die Markprobe des Spenders in einen Ruhezustand versetzt, z.B. durch Zugabe von DMSO zu der Probe, gefolgt vom Einfrieren der Probe. Die Spenderprobe kann vor der Verwendung für eine Implantation in gefrorenem Zustand möglicherweise für viele Jahre mit geringer Verschlechterung gehalten werden.

Außerdem können die Spenderzellen manipuliert werden, z.B. können die reifen T-Lymphozyten entweder vor oder nach dem Einfrieren entfernt werden. Die Fähigkeit, Markproben für lange Zeiträume zu lagern, hat die Einrichtung von Banken für Spendermark zur Unterstützung von Behandlungsprogrammen für Patienten mit verschiedenen Leukämien und Lymphomen ermöglicht (Bone Marrow Transpl 17 (1996) 197).

Die Erkenntnis, dass die reifen T-Lymphozyten im Mark eines Spenders die GVH-Erkrankung verursachen und die Entwicklung von Technologien zu deren effektiver Entfernung aus dem Spendermark war hilfreich, um wesentliche Fortschritte bei der Knochenmark-Allotransplantation zu machen.

Ein Allotransplantat bedeutet definitionsgemäß Zellen oder ein Gewebe, welches zwischen unterschiedlichen Mitgliedern der gleichen Spezies implantiert oder transplantiert ist, ein Heterotransplantat ist ein Transplantat von Gewebe/Zellen zwischen Mitgliedern von unterschiedlichen Spezies und ein Autotransplantat ist ein Gewebe/Zelltransplantat von einem selbst für sich selbst.

Vor den wissenschaftlichen Fortschritten, welche die Allotransplantation für die Behandlung eines Lymphoms und von Leukämie ermöglicht haben, war eine Knochenmarktransplantation auf eine Autotransplantation beschränkt (Stem Cells 13 (Suppl 3) (1995) 63). Wie oben definiert, liegt eine Autotransplantation dann vor, wenn Zellen/Gewebe von einem Individuum entnommen werden und in das gleiche Individuum zurück implantiert werden. Eine Autotransplantation bleibt alltäglich und ist bei der Behandlung von Verbrennungen besonders relevant, wobei Haut von unbeschädigten Körperregionen entfernt wird und transplantiert wird, um den geschädigten Hautbereichen bei der Reparatur/Regeneration zu helfen (Burns 24 (1998) 46). Eine Autotransplantation ist auch bei der orthopädischen Chirurgie üblich, wobei der eigene Knochen eines Patienten, beispielsweise von der Hüfte, einer Rippe oder dem Kinn, entnommen wird und verwendet wird, um in einer anderen Körperregion, beispielsweise dem Gesicht, zur Anreicherung/Reparatur von Knochen verwendet wird (J. Oral Maxillo Surg 54 (1996) 420).

Die Autotransplantation bei der Behandlung von Leukämien und Lymphomen weist Vorteile und Nachteile auf. Der Hauptvorteil für den Patienten ist der, dass nicht das Problem einer Abstoßung auftritt (weder durch den Patienten noch durch das Implantat), wenn Zellen/Gewebe von dem Patienten in den Patienten zurückgegeben werden. Der Hauptnachteil ist jedoch, dass die transplantierten Zellen/Gewebe, welche für eine nachfolgende Implantation entfernt werden, erkrankte Zellen enthalten können. Der Wert der Autotransplantation hängt deshalb von der Fähigkeit ab, Spendergewebe zu erhalten oder zu erzeugen, welches frei von Erkrankungen ist.

Leukämien und Lymphome sind per Definition Erkrankungen, welche die Zellen des Bluts und der Lymphe betreffen, und die allgemeine medizinische Meinung ist die, dass das Ansiedeln oder Infiltrieren von erkrankten Zellen in das Knochenmark unregelmäßig auftreten kann, spezielle Knochenmarkstellen betreffen kann und/oder spät nach der Entstehung der Krankheit stattfinden kann. Somit ist das Grundprinzip für eine Autotransplantation bei Leukämie/Lymphom-Patienten, dass wenn der Patienten einmal durch eine Radiotherapie und/oder Chemotherapie zur Zerstörung der Tumorzellen behandelt worden ist, es möglich sein sollte, sein eigenes, im Wesentlichen erkrankungsfreies Knochenmark zurückzugeben.

Um weiter sicherzustellen, dass die Autotransplantatprobe im Wesentlichen frei von Erkrankungen ist, kann sie auf eine Vielzahl von Arten behandelt werden. Beispielsweise kann sie durch Abtrennen/Zerstören von restlichen Tumorzellen in der Probe gereinigt werden. Ein übliches Reinigungsverfahren ist beispielsweise die Anwendung von Tumorzell-identifizierenden Antikörpern, um die Tumorzellen in der Probe zu markieren – die Tumorzellen können dann unter Verwendung einer Zellsortierungstechnologie, wie etwa einer fluoreszenzaktivierten Zellsortierung, entfernt werden (Curr Op Hematol 4 (1997) 423).

Der Wert einer Autotransplantation für die Behandlung einer metastatischen oder systemischen Erkrankung wie etwa Leukämie und ein Lymphom bleibt jedoch fraglich, da die Spenderprobe noch immer einige Bestandteile der Erkrankung enthalten kann, welche mit gegenwärtigen Technologien nicht vollständig herausgereinigt werden können. Die Qualität des Autotransplantats hängt auch vom Status der Erkrankung im Spendermaterial ab, z.B. vom Typ und von der aggressiven Beschaffenheit der betroffenen Zellen, der Fähigkeit der erkrankten Zellen, sich im Mark anzusiedeln und der Zeit vom Entstehen derr Erkrankung bis zur Entnahme der Spenderprobe. Der Wert eines Autotransplantats ist unter solchen Umständen im Wesentlichen empirisch und variiert signifikant zwischen einzelnen Patienten, welche verschiedene Symptome einer proliferativen Erkrankung präsentieren.

Es werden weiterhin Fortschritte in der Therapie gemacht, und das bessere Verständnis von Erkrankungsprozessen hilft uns, unsere therapeutischen Ansätze zur Linderung von Erkrankung und Leiden zu modifizieren und neu zu focussieren. Solch ein Verständnis ist in großem Maße durch technologische Verbesserungen auf dem Gebiet der Molekularbiologie vorangebracht worden. Wir sind nun in einer Position, der Pathogenese von Erkrankungen auf einem molekularen Niveau zu folgen und die Bedeutung der genetischen Veranlagung eines Individuums bei der Veranlagung des Individuums für bestimmte Erkrankungen zu erkennen. Beispielsweise sind wir uns bewusst, dass einige Individuen aufgrund ihrer genetischen Struktur anfällig sind für Krebsarten, z.B. Leukämien, und Gefäßerkrankungen wie etwa eine Herzerkrankung. Sie können auch für neurodegenerative Erkrankungen, wie etwa für die Alzheimer-Krankheit und Chorea Huntington anfällig sein, ebenso wie für endokrine und exokrine Erkrankungen, wie etwa Diabetes und Hypothyroidismus, und Skeletterkrankungen, wie etwa altersbedingte Osteopänie, Osteporose, Arthritis und eine periodontale Erkrankung. Durch eine genetische Untersuchung ist es deshalb nun möglich, diejenigen Individuen zu identifizieren, welche für schwächende Erkrankungen anfällig sind.

Außerdem macht unser Wissen um das Immunsystem des Körpers, und insbesondere über die Art, auf welche es virusinfizierte Zellen und Tumorzellen erkennt und tötet, weiterhin Fortschritte. Wir wissen nun, dass zur Auslösung einer zellvermittelten Immunität eine angreifende Zelle (z.B. eine virusinfizierte Zelle oder eine Tumorzelle) ein HLA Klasse I beschränktes Tumor- oder virales Epitop zusammen mit Alarmsignalen, wie etwa GM-CSF und/oder TFN-&agr;, präsentieren muss, sodass die Antigen-präsentierenden Zellen (APC) des Immunsystems kostimulatorische Signale, wie etwa B7 und IL-12, exprimieren in Verbindung mit einem Antigen der interagierenden cytotoxischen T-Lymphozyten (CTL)-Population. Die gemeinsame Präsentation führt zur Produktion von Klonen sowohl von aktivierten als auch von Gedächtniszellen (für einen Überblick siehe Nature Medicine Vaccine Supplement 4 (1998) 525). In Abwesenheit dieser zusätzlichen Signale werden HLA-I Antigen-beschränkte T-Zellen, welche angreifende Zellen erkennen, für die Zerstörung oder Desensibilisierung prozessiert (ein Körperprozess, wahrscheinlich eingesetzt, um die Entwicklung beispielsweise einer Autoimmunerkrankung zu vermeiden). Die Induktion einer solchen Toleranz liegt entweder aufgrund von Ignoranz, Anergie oder einer physischen Deletion vor (Cold-Spring Harbour Symp Quant Biol 2 (1989) 807; Nature 342 (1989) 564; Cell 65 (1991) 305; Nature Med 4 (1998) 525). Es nun klar, dass Tumorzellen nicht automatisch Alarmsignale und/oder costimulatorische Signale gemeinsam präsentieren. Somit kann das Entstehen eines Tumors zur Ausrottung gerade der Zellen führen, welche eine zellvermittelte Immunität gegen den Tumor bereitstellen. Bei einem Patienten mit einem Krebs, einer Leukämie/einem Lymphom oder einem Sarkom usw. kann deshalb bereits automatisch die angeborene Fähigkeit zur Zerstörung des Tumors abgebaut worden sein. Wenn jedoch die erforderlichen T-Lymphozyten oder eine Probe davon vor dem Ausbruch einer proliferativen Erkrankung dem Patienten entnommen worden waren, kann die relevante T-Zellpopulation nun nach der notwendigen Kostimulation der T-Zellen dem Patienten zurückgegeben werden, um so die Erkrankung zu lindern.

Die vorliegende Erfindung basiert auf unserer Erkenntnis dieser Möglichkeit, nämlich dem Konzept der Entnahme von Zellen oder Geweben aus einem gesunden Wirtsorganismus für eine nachfolgende Transplantation in den gleichen Organismus in einem nachfolgenden autologen (autogenen) Transplantationsverfahren, wenn der Bedarf oder Wunsch danach aufkommt.

In einem Aspekt stellt die vorliegende Erfindung somit die Verwendung einer Wirtszellpopulation von ausgereiften, gesunden Lymphozytenzellen, erhalten vom Blut eines nicht erkrankten Wirtsorganismus, zur Herstellung einer Zellzusammensetzung zur Verwendung bei einer nachfolgenden autologen therapeutischen Transplantationstherapie einer Krankheit oder Erkrankung in dem Wirtsorganismus bereit, worin die Zellen vom Wirtsorganismus erhalten werden, ehe sich die Krankheit oder Erkrankung entwickelt oder manifestiert.

Ebenso wird ein Verfahren für eine autologe Transplantationstherapie offenbart, worin das Verfahren Erhalten einer Population von Wirtszellen aus einem nicht erkrankten Wirtsorganismus und Herstellen einer Zellzusammensetzung aus der Wirtszellpopulation für eine nachfolgende Transplantation in den Wirtsorganismus umfasst.

Die Beschreibung offenbart auch eine Zellzusammensetzung, umfassend eine Wirtszellpopulation, welche aus einem nicht erkrankten Wirtsorganismus erhalten wird, zur Verwendung bei einer nachfolgenden autologen Transplantationstherapie des Wirtsorganismus.

Der Wirtsorganismus kann ein beliebiger eukaryontischer Organismus sein, ist jedoch bevorzugt ein Tier bzw. Mensch, mehr bevorzugt ein Säuger und am meisten bevorzugt ein Mensch. Andere beispielhafte Wirtsorganismen umfassen Ratten, Mäuse, Schweine, Hunde, Katzen, Schafe, Pferde und Rinder.

Der Begriff "nicht erkrankt" wird hierin verwendet, um einen Zustand zu beschreiben, in welchem der Wirtsorganismus nicht an der Krankheit oder Erkrankung leidet oder deren Symptome zeigt, welche nachfolgend durch das Transplantationsverfahren behandelt werden soll.

Weiterhin ist in bestimmten Ausführungsformen der Erfindung der Wirtsorganismus bevorzugt nicht für irgend eine bestimmte Krankheit oder Erkrankung anfällig oder trägt ein Risiko dafür, beispielsweise zeigt er bevorzugt keinerlei Symptome oder Anzeichen, welche eine nachfolgende Krankheit oder Erkrankung voraussagen lassen. Ebenso leidet der Wirtsorganismus bevorzugt nicht an irgendwelchen Verletzungen oder einem Schaden, welche eine vorausgeahnte oder erwartete Erkrankung hervorrufen kann. Eine Hauptidee oder ein Konzept hinter der vorliegenden Erfindung ist es, die Wirtszellen von dem Wirtsorganismus in einem Zustand zu ernten oder zu sammeln, wenn es keine direkte Vorhersage, Andeutung oder einen Verdacht gibt, dass sich eine bestimmte Erkrankung oder Krankheit entwickeln kann, für eine Verwendung gegen ein mögliches oder unerwartetes Ereignis in der Zukunft oder ein Ereignis, welches eher einfach durch Zufall auftreten kann, als eine vorausgeahnte oder verdächtigte oder vorhergesagte Erkrankung oder ein Zustand.

Ebenso umfasst ist die Entnahme von Zellen aus einer "nicht erkrankten" Region oder aus einem Bereich des Körpers des Wirtsorganismus, auch wenn andere Bereiche oder Regionen des Körpers oder Zellen oder Gewebe des Körpers von einer Erkrankung oder Krankheit betroffen sein können. Was erforderlich ist, ist dass die entnommenen Zellen selbst gesund sind, d.h. "nicht erkrankt" gemäß der oben angegebenen Definition.

Die Zellen werden von dem Wirtsorganismus erhalten, ehe sich irgend eine Erkrankung oder Krankheit selbst entwickelt oder manifestiert, und mehr bevorzugt wenn beim Wirtsorganismus eine allgemeine gute Gesundheit vorliegt und er bevorzugt auf keinerlei Weise abwehrgeschwächt ist.

Es ist deshalb von Vorteil, wenn die Wirtszellen von Wirtsorganismen erhalten werden, wenn diese jung sind, bevorzugt in der Jugend oder im frühen Erwachsenenalter. Beim Menschen ist eine Zellentnahme im Alter von etwa 12 bis 30, bevorzugt 15 bis 25 bevorzugt. Besonders bevorzugt ist eine Entnahme im Alter von 16 oder 17 aufwärts, beispielsweise im Altersbereich von 16 bis 30, 17 bis 30 oder 18 bis 30 oder vielleicht 18 bis 35 oder 40. Es ist somit bevorzugt, dass die Zellen erhalten werden, wenn der Wirtsorganismus reif ist oder die Reife erreicht, jedoch ehe die Prozesse des Alterns oder der Seneszenz wesentlich eingesetzt haben. Insbesondere ist es bevorzugt und vorteilhaft, dass das Immunsystem des Wirtsorganismus reif oder vollständig entwickelt ist. Jedoch ist das Erhalten von Zellen außerhalb dieser Bereiche umfasst, und Zellen können in jedem Lebensstadium nach der Geburt erhalten werden, z.B. von jungen Wirtsorganismen, beispielsweise in der mittleren bis späten Kindheit oder sogar von Kleinkindern, oder von älteren Individuen, solange sie "nicht erkrankt" bleiben. Fötale Wirtsorganismen sind somit von der vorliegenden Erfindung ausgenommen und eine Entnahme von fötalen Zellen ist nicht umfasst.

Im Gegensatz zur Entnahme von Nabelschnurblut sind die Vorteile der vorliegenden Erfindung beispielsweise die, dass durch eine Entnahme von Zellen von postnatalen oder älteren Wirten ermöglicht wird, dass mehrere Proben gesammelt werden können, wobei die Gelegenheit der Lagerung einer ausreichenden Zahl von Zellen ansteigt. Außerdem überwindet die Probenentnahme von jungen oder älteren Wirten die ethischen Anforderungen, wie etwa eine informierte Einwilligung.

Eine Probenentnahme von Wirtsorganismen im Jugendalter oder von erwachsenen Wirtsorganismen ist bevorzugt, da die entnommenen Zellen, insbesondere von Blut, einen größeren Anteil von wertvollen reifen T-Zellen enthalten, welche anomale Zellpopulationen wie etwa Krebszellen oder virusinfizierte Zellen erkennen können. Wenn Blutproben verwendet werden, ist es somit vorteilhaft, dass sie von einem Individuum mit einem reifen Immunsystem entnommen werden (d.h. nicht fötal oder neonatal).

Der hierin verwendete Begriff "autolog" soll bedeuten, dass die Implantation in denselben Organismus (d.h. in dasselbe Individuum) erfolgt, von welchem die Wirtszellen entnommen wurden. Somit ist eine autogene Transplantation ("self-to self") oder Autotransplantation beabsichtigt.

"Transplantation" bezieht sich auf ein beliebiges Verfahren, welches das Einbringen von Zellen in einen Organismus betrifft. Somit ist jegliche Form einer im Fachgebiet bekannten Transplantation oder Implantation umfasst.

"Transplantationstherapie" bezieht sich auf ein beliebiges Verfahren, welches die Transplantation von Zellen betrifft. Sowohl therapeutische (z.B. kurative oder palliative, oder die Symptome lindernde) als auch prophylaktische (d.h. präventive oder protektive) Therapien sind umfasst. Der Begriff "Transplantationstherapie" umfasst somit die Transplantation von Zellen in einen Wirtsorganismus, welcher dieses benötigt, oder bei welchem aus einem beliebigen Grund ein Bedarf vorhergesagt, erwartet oder vorausgeahnt wird. Vorteilhafterweise ermöglicht die Transplantationstherapie die Behandlung oder Linderung einer Erkrankung oder Krankheit, welche sich entwickelt, oder anschließend droht, z.B. Krebs oder eine Infektion oder eine degenerative Erkrankung (z.B. neurodegenerativ).

Der hierin verwendete Begriff "Wirtsorganismus" bedeutet den Körper nach der Geburt und umfasst nicht "Abfallgewebe" oder "weggeworfenes" Gewebe, welche per se kein Teil des Körpers sind. Somit sind die Nabelschnur und die Plazenta nicht umfasst. Jedoch kann jeder beliebige Teil des tatsächlichen Körpers des Wirtsorganismus als die Quelle für Wirtszellen verwendet werden.

Ein erfindungsgemäß bevorzugter Lymphozytenzelltyp ist der T-Lymphozyt (eine T-Zelle). Reife T-Lymphozyten sind besonders bevorzugt.

Die Erkrankung oder Krankheit, welche durch die Transplantationstherapie behandelt werden kann, kann eine beliebige dem Menschen bekannte Krankheit oder Erkrankung sein. Somit ist jeder Erkrankungszustand, jede Krankheit, jede Erkrankung oder jede Anomalität des Körpers umfasst. Erwähnt werden können beispielsweise Infektionen, z.B. durch eine pathogene Aktivität auftretende Krankheiten, z.B. Bakterien-, Pilz- oder Virusinfektionen, oder Infektionen durch einen beliebigen anderen Organismus, z.B. ein Protozoon oder einen anderen Parasiten, jede magligne oder prämaligne Erkrankung, proliferative oder hyperproliferative Zustände, oder eine beliebige Erkrankung oder Krankheit, welche von einer funktionellen oder einer anderen Störung oder Anomalität herrührt oder damit verbunden ist, in den Zellen oder Geweben des Körpers, z.B. eine anomale Genexpression oder ein Zell- oder Gewebeschaden (entweder induziert oder durch innere oder äußere Ursachen hervorgerufen, z.B. durch Alterung, Verletzung, Trauma oder Infektion usw.), oder idiopathische Erkrankungen (z.B. Parkinson-Krankheit).

Vorteilhafterweise besitzt die vorliegende Erfindung einen besonderen Nutzen bei der Therapie von chronischen Zuständen (d.h. chronische Erkrankungen oder Krankheiten).

Beispielhafte Krankheiten oder Erkrankungen umfassen somit jede Krebsart (entweder von festen Geweben des Körpers (z.B. Prostata oder Mammatumore), oder von hämatopoietischen Geweben oder anderen einzelnen Zellen, insbesonderen Leukämien oder Lymphome), vaskuläre Erkrankungen, Nervenerkrankungen einschließlich insbesondere neurodegenerative Zustände, endokrine und exokrine Erkrankungen und Skeletterkrankungen, wie oben beschrieben, oder ein beliebiger anderer Zustand, welcher mit dem Altern oder der Sensezenz verbunden ist. Besonders erwähnt werden können Osteoporose und Osteoarthritis.

Die Verwendungen der Erfindung für eine Therapie von Krebs stellt eine bevorzugte Ausführungsform der Erfindung dar und umfasst Tumore von beliebigen Zellen oder Geweben des Körpers. Die Erfindung ist nicht auf eine bestimmte Krebsart beschränkt (z.B. Leukämie, Lymphom, Karzinom oder Sarkom), sie ist auch nicht auf spezielle Onkogene oder Tumorsuppressorgenepitope, wie etwa ras, myc, myb, fos, fas, Retinoblastom, p53 usw. oder andere Tumorzellmarkerepitope beschränkt, welche auf eine HLA Klasse 1-Antigen beschränkte Art präsentiert werden. Alle Tumore, wie etwa Brust-, Magen-, Darm-, Enddarm-, Lunge-, Leber-, Uterus-, Hoden-, Eierstock-, Prostata- und Gehirntumoren wie etwa Glyome, Astrocytome und Neuroblastome, Sarkome, wie etwa Rhabdomyosarkome und Fibrosarkome, werden von der erfindungsgemäßen Therapie umfasst.

Eine weitere bevorzugte Ausführungsform der Erfindung ist die Verwendung der Erfindung für die Therapie von Infektionen, insbesondere Virusinfektionen, einschließlich HIV und anderen Infektionen, welche eine latente Phase aufweisen können.

Die Wirtszellpopulation, welche erfindungsgemäß für ein nachfolgendes Transplantationsverfahren in den Wirtsorganismus verwendet wird, kann nach der Entnahme aus dem Wirtsorganismus zu jedem passenden oder gewünschten Zeitpunkt verwendet werden. In anderen Worten kann eine aus einem Individuum entfernt Gewebe- oder Zellprobe zu einem zukünftigen Zeitpunkt verwendet werden, wenn sie für eine Verwendung bei der Therapie erforderlich ist. Vorteilhafterweise ermöglicht es die Erfindung jedoch, dass die nachfolgende Transplantation nach einem andauernden Zeitintervall nach der Zellentnahme erfolgt, z.B. von 3 Monaten bis zu vielen Jahren (z.B. bis zu 80 Jahren oder mehr). Somit ermöglicht die Erfindung die Entnahme von gesunden, nicht erkrankten Zellen aus einem Individuum, welches in einem guten Gesundheitszustand oder einem guten immunologischen Zustand ist und die Verwendung viele Jahre später für eine Therapie dieses Individuums, wenn sich ein Problem entwickelt. Bevorzugte oder beispielhafte Zeitintervalle für eine nachfolgende Transplantation umfassen somit 6 Monate bis 70 Jahre, 1 bis 50 Jahre und 1 bis 30 Jahre oder 5 bis 30 Jahre. Konventionelle Cryokonservierungsbedingungen und -verfahren ermöglichen solche Zeiträume (Scand. J. Haematol. 10 (1977) 470; Int. J. Soc. Exp. Haemtol. 7 (1979) 113).

Die Wirtszellpopulation kann auf jede geeignete Art und Weise aus dem Wirtszellorganismus entnommen oder entfernt werden. Dies kann von den Zellen und der Stelle im Körper abhängen, von welchem sie erhalten werden.

Es sind kürzlich Fortschritte gemacht worden hinsichtlich der Art und Weise, auf welche Zellen für eine nachfolgende Implantation erhalten werden können. Der Beginn der Molekularbiologie hat uns geholfen, die grundlegende Biologie des Zellwachstums und der Funktion in Gesundheit und Krankheit klarer zu verstehen. Beispielsweise haben Untersuchungen der Mittel, welche die Hämatopoese regulieren, zur Isolierung einer Reihe von Faktoren geführt, welche die Proliferation und Differenzierung von Lymphozyten beeinflussen – diese umfassen die Cytokine, wie etwa die Reihe der Interleukine IL-1 – IL-18 und die Leukotriene, und Wachstumsfaktoren, wie etwa die TNFs, die TGFs, FGFs, EGFs, GM-CSF, G-CSF und andere. Eine Anzahl dieser Faktoren sind nun kommerziell und für eine klinische Verwendung verfügbar, und es wurde gezeigt, dass einige davon die Zahl der lymphozytischen Zellen und insbesondere der unreifen T-Lympozyten im peripheren Blut wesentlich vergrößert. Ihre Anwendung bei dem Wirtsorganismus bedeutet, dass es nach wenigen Tagen, um eine Wirkung zu ermöglichen, möglich ist, große Mengen der Zellen von Interesse direkt aus dem Blut des Wirts zu filtern, ohne das Erfordernis einer Markprobe (Stem Cells 15 (1997) 9). Die Technologie zum Extrahieren von Lymphozyten aus Blut durch Entnehmen von Blut bei dem Patienten, Leiten des Bluts durch einen Zellseparator und dann Rückführen des Bluts in den Patienten, alles praktisch gleichzeitig, ist seit vielen Jahren verfügbar gewesen (Practical Immunology, 3. Auflage, Blackwell Scientific Publications, 1989).

Die entnommene Wirtszellpopulation kann auf jede beliebige bekannte oder gewünschte Art und Weise für eine nachfolgende Transplantation gelagert, kultiviert, bearbeitet, manipuliert oder behandelt werden (d.h. die Zellzusammensetzung für die Transplantation herzustellen). Die Verfahren zur Handhabung, Kultivierung und Lagerung von Zellen sind im Fachgebiet allgemein bekannt und werden in der Literatur weithin beschrieben, und es kann jedes der Standardverfahren verwendet werden. Die Zellen können in jedem geeigneten oder gewünschten Medium gelagert werden, beispielsweise wie im Fachgebiet bekannt ist. (Siehe z.B. Freshney's (siehe oben) für Zellkulturerfordernisse und WO 98/33891 für die Lymphozytenpräparation).

Die Wirtszellpopulation kann geeigneterweise in einen Ruhezustand versetzt werden. Der Begriff "Ruhezustand", wie hierin verwendet, umfasst einen beliebigen Zustand eines Scheintods oder Stillstands und Verfahren, um dies zu erreichen, sind im Fachgebiet allgemein bekannt, wie oben beschrieben. Es kann ein beliebiges der bekannten Verfahren verwendet werden (siehe z.B. Freshney's, oben). Somit können die Zellen in einem ruhenden, einem inaktiven oder nicht proliferierenden Zustand gehalten oder erhalten werden.

Gemäß einem bevorzugten Verfahren werden die Zellen bevorzugt auf eine Temperatur von unter –160°C eingefroren.

Ein besonders bevorzugtes Mittel zum Erreichen eines Ruhezustands ist das Einfrieren der Zellen auf den Siedepunkt von Helium (He), d.h. bei etwa –269°C oder darunter.

Somit stellt die vorliegende Erfindung in einem weiteren Aspekt ein Verfahren bereit, worin Lymphozytenzellen in einen Ruhezustand gebracht werden und oder in einem Ruhezustand erhalten werden, wobei das Verfahren das Einfrieren der Zellen auf eine Temperatur bei oder unterhalb von –269°C umfasst.

Wie von Freshney's (siehe oben) beschrieben wird, können die Zellen in einem geeigneten Medium (z.B. mit 5 –10% DMSO) suspendiert und mit einer kontrollierten Geschwindigkeit, z.B. mit 1 °C pro Minute auf –70°C abgekühlt werden, dann in flüssigen/gasförmigen N2 übertragen werden. Solche konventionellen Verfahren können angepasst werden, um die Zellen in He/N2-Gemischen oder in He zu kühlen.

Es sind Ergebnisse erhalten worden, welche zeigen, dass durch diese Verwendung (d.h. der niederen Temperatur) Verbesserungen der langfristigen Lebensfähigkeit der Zellen erreicht werden können. Wenn dies beispielsweise über 10-20 Jahre multipliziert wird, kann diese Steigerung der Lebensfähigkeit bei der erfolgreichen Lagerung der Zellen von Bedeutung sein (siehe Beispiel 6 unten).

Alternative Verfahren zum Erreichen und/oder Erhalten eines Ruhezustands von Zellen umfassen Kühlen bei 4°C.

Falls gewünscht, können die Zellen kultiviert werden, beispielsweise als Teil eines Behandlungs- oder eines Modifikationsverfahrens (siehe unten), oder sie können expandiert werden, d.h. sie können kultiviert werden, um die Zellzahlen zu erhöhen. Beispielsweise können die Zellen durch im Fachgebiet allgemein bekannte Verfahren passagiert werden. Die Kultivierung kann vor oder nach dem Zeitraum der Wachstumsruhe erfolgen, oder sowohl als auch.

Vor der Transplantation können die Zellen auch oder alternativ irgendwie modifiziert oder manipuliert werden, z.B. genetisch oder funktionell und/oder durch Induktion oder Modulation ihrer Differenzierung. Wie oben beschrieben, ist dies erneut im Fachgebiet bekannt und es können beliebige der bekannten Verfahren oder Standardverfahren verwendet werden. (siehe z.B. WO 98/06823, WO 98/32840, WO 98/18486). Solch eine Modifikation oder Manipulation kann vor oder nach dem Ruhezustand durchgeführt werden, oder sowohl als auch. Die Modifiaktion/Manipulationen sind insofern nicht zeitlich beschränkt, dass die Reihenfolge und/oder Anzahl der Manipulationen flexibel ist.

Die genetischen Eingriffe können eine Regulation oder Modifikation der Expression von einem oder mehreren Genen umfassen, beispielsweise das Steigern oder Verringern der Genexpression, das Inaktivieren oder außer Gefecht setzen von einem oder mehreren Genen, ein Austausch eines Gens, die Expression von einem oder mehreren heterologen Genen usw. Die Zellen können auch als eine Zellkernquelle für einen Kerntransfer in Stammzellen verwendet werden.

Die Zellen können gegenüber Faktoren exponiert oder mit Faktoren in Kontakt gebracht werden, z.B. mit Cytokinen, Wachstumsfaktoren usw., welche ihr Wachstum und/oder ihre Aktivität usw. oder ihren Differenzierungszustand usw. modifizieren können. Die Zellen können auch behandelt werden, um gewünschte Zelltypen abzutrennen oder selektiv zu isolieren oder anzureichern, oder um unerwünschte Zellen abzureinigen.

Somit wird beispielsweise oben ein Modifikationsverfahren für T-Zellen beschrieben, wobei T-Zellen vor einer Transplantation kostimuliert werden.

Alternativ können hämatopoietische Zellen gemeinsam mit einem HLA Klasse I-beschränkten Tumorantigen und B7 und/oder IL12 präsentiert werden, um so sowohl aktivierte T-Zellen als auch Gedächtnis-T-Zellen zu erzeugen. Die Probe kann dann als eine prophylaktische Therapie vor dem Ausbruch einer Erkrankung in den Wirtsorganismus zurückgegeben werden. Alternativ können die gemeinsam präsentierenden Antigen-präsentierenden Zellen (APCs) zusammen mit den aktivierten T-Zellen und/oder Gedächtnis-T-Zellen in den Wirt zurückgegeben werden. Alternativ können die Zellen in vitro mit geeigneten Alarmsignalen gegenüber dem Tumor des Wirts exponiert werden, und eine gemeinsame Präsentation von kostimulatorischen Molekülen erfolgen, ehe sie in den Wirt zurückgegeben werden. Wie bei unserer WO 96/15238, welche auf eine T-Lymphozytyentherapie gerichtet ist, können die CTLs des Wirts vor dem Austausch genetisch modifiziert werden, sodass der Tumor erkannt wird. Die Alternativen in diesem Abschnitt stellen funktionelle Wechselwirkungen zwischen hämatopoietischen Zellen bereit, entweder vor einem Ruhezustand oder nach einem Ruhezustand oder gemäß einer Kombination davon.

Nach dem Ruhezustand werden die Zellen vor einer Verwendung bei der Transplantation revitalisiert. Erneut kann dies auf eine beliebige konventionelle Art und Weise erreicht werden, welche im Fachgebiet bekannt ist, und es kann ein beliebiges Verfahren zur Revitalisierung oder Wiederbelebung der Zellen verwendet werden.

Dies kann beispielsweise in geeigneter Weise erreicht werden durch Auftauen und/oder Verdünnen der Zellen, z.B. wie in den Beispielen beschrieben wird. Techniken für eine Revitalisierung sind im Fachgebiet allgemein bekannt (siehe z.B. Freshney's, oben). Die Zellen können durch sanftes Bewegen des die Zellen enthaltenden Behälters in Wasser bei 37°C aufgetaut werden, gefolgt von einer Verdünnung des DMSO auf 1 % oder darunter, beispielsweise mit Medium oder Patientenserum usw. Die Zellen können unmittelbar oder nach einer Erholungsphase in Kultur implantiert werden. Die Revitalisierung ist konzipiert, um die Brauchbarkeit der Zellen wiederherzustellen, z.B. für eine Prophylaxe oder eine kurative Therapie.

Die Erfindung betrifft die Erkenntnis, dass eine Gewebeprobe von einem nicht erkrankten Individuum in einen Ruhezustand versetzt werden kann. Das Gewebe kann dann revitalisiert werden und in das gleiche Individuum zurückgegeben werden, wenn dies zu einem späteren Zeitpunkt erforderlich ist. Das Implantieren des revitalisierten Gewebes 1, 2, 3, 4, 5, 6 oder mehrere Monate oder 1, 2, 3, 4, 5, 6 oder mehrere Jahre nach der Entnahme aus dem Patienten soll eine Erkrankung lindern oder gegen eine Erkrankung schützen, den Verlauf einer Erkrankung verlangsamen oder die Funktion des verbleibenden normalen oder geschädigten Gewebes in dem Patienten steigern und/oder unterstützen. Die Erfindung unterscheidet sich deutlich vom Einfrieren von Knochenmarkzellen von Patienten, beispielsweise mit Leukämie, und vom Einfrieren von Keimzellen, z.B. Sperma, vor der Behandlung von Patienten beispielsweise mit Leukämie im Kindesalter, da die Patienten bereits eine Erkrankung aufweisen. Es besteht auch aus dem gleichen Grund eine Abgrenzung von Patienten, welche Blut bereitstellen für eine gekühlte Lagerung für eine mögliche spätere Verwendung, beispielsweise bei einer nachfolgenden Operation. Außerdem beträgt die Dauer der Lagerung für eine mögliche Rückgabe solch einer Blutprobe im Allgemeinen nur bis zu einem Monat. Gleichermaßen können es Individuen ohne diagnostizierten Anomalität vorziehen, Blut für eine gekühlte Lagerung bereitzustellen für eine voraussichtliche Verwendung durch sie selbst vor einer Auslandsreise. Solch eine Verwendung kann die Behandlung von Hypovolämie nach einem akuten Blutverlust umfassen, welche nach einem Straßenverkehrsunfall oder einem anderen Trauma auftreten kann, dies ist jedoch erneut für einen kurzen Lagerungszeitraum von nur einem Monat, und eine Verwendung bei einer Erkrankung in der Zukunft, beispielsweise eine chronische Erkrankung, ist nicht beabsichtigt.

Es kann eine Anzahl von besonders vorteilhaften Anwendungen der Erfindung aufgezeigt werden. Zuerst stellt die Erfindung ein zukünftiges therapeutisches Verfahren für Individuen bereit, welche eine Veranlagung für Bluterkrankungen, wie etwa Leukämie oder ein Lymphom, aufweisen, welche jedoch vor der Probenentnahme asymptomatisch für die Erkrankung sind oder der Krankheit nicht unterliegen. Es wäre nützlich für solche derzeit gesunden Individuen, eine Gewebeprobe oder mehrere Gewebeproben (z.B. Knochenmark oder Blut) bereitzustellen. Die Probe/n könnte/n in einem Ruhezustand gehalten werden bis zu ihrer Verwendung an einem zukünftigen Zeitpunkt, um anomale oder verlorene Gewebe/Zellen zu ersetzen/anzureichern und die Erkrankung zu lindern, an welcher sie wahrscheinlich erkranken, nachdem die Probe entnommen wurde. Die Erfindung kann auch bei Individuen anwendbar sein, deren Umgebungen sie beispielsweise für Leukämie anfällig machen, beispielsweise Arbeiter eines Kraftwerks. Die Erfindung steht dann also allen konventionellen Lehren gegenüber, welche rückwirkende Allotransplantate oder Autotransplantate empfehlen, um eine kurative Maßnahme bei Erkrankungen, wie etwa Leukämie und einem Lymphom oder soliden Tumoren, bereitzustellen. Andere Arten einer Veranlagung sind auch innerhalb des Umfangs dieses Aspekts der Erfindung enthalten, da es in der Tat andere Faktoren gibt, beispielsweise eine Familienkrankengeschichte, welche ein Risiko einer verdächtigen Erkrankung andeuten könnte.

Eine weitere vorteilhafte Anwendungsmöglichkeit der Erfindung ist die bei der Behandlung einer HIV-Infektion oder HIV-Erkrankung. So können CD4+-Zellen von einem Individuum, welches gesund oder nicht infiziert ist, gesammelt und gelagert werden für eine nachfolgende Transplantation in das Individuum, wenn sich eine HIV-Infektion manifestiert oder wenn sich AIDS entwickelt, oder wenn die CD4+-Zellzahlen abfallen usw. Solch ein Verfahren kann attraktiv sein für ein Individuum mit einem Lebensstil, welcher es wahrscheinlich einem Risiko aussetzt, mit einer HIV-Infektion in Kontakt zu kommen.

Außerdem ist es allgemein anerkannt, dass der Alterungsprozess Individuen für eine Erkrankung anfälliger macht. Die Basis für diese Anfälligkeit scheint im Verlust der Immunfunktion zu liegen, welcher sich aus einer signifikanten Abnahme der T- und B-Zellzahlen/Aktivität während der Alterung ergibt (Mech Ageing & Dev 91 (1996) 219; Sciene 273 (1996) 70; Mech Ageing & Dev 96 (1997) 1).

Außerdem kann die Erfindung angesichts neuerer Befunde als besonders vorteilhaft angesehen werden, welche mit der Herunterregulierung der zytotoxischen T-Lymphozytenaktivität bei einer Reaktion auf HLA Klasse I-Antigen-beschränkte Tumorepitoppräsenation verbunden ist.

Die Anfälligkeit für eine Erkrankung ist besonders einschlägig, wenn ältere Patienten in einer Krankenhausumgebung beispielsweise einem chirurgischen Eingriff unterzogen werden, wo sie für opportunistische Infektionen mit ernsthaften oder sogar tödlichen Konsequenzen anfällig sind. Knochenmark- und/oder Blutproben, welche zu einem viel früheren Lebenszeitpunkt von dem Patienten entnommen wurden, wie etwa während der Jugend oder dem frühen Erwachsenenalter, wenn ihr Immunsystem reif, aber nicht beeinträchtigt ist, und welche nachfolgend in einem Ruhezustand gehalten werden, können revitalisiert werden und in den Patienten reinfundiert werden, um das Immunsystem anzukurbeln. Solch ein Ansatz würde ein Verfahren bereitstellen zum Verbessern des Immunsystems des Patienten nach dem chirurgischen Eingriff, um die Wahrscheinlichkeit von postoperativen Komplikationen zu verringern, welche durch opportunistische Infektionen verursacht werden. Die Erfindung kann deshalb als eine prophylaktische Therapie verwendet werden, z.B. für ältere Patienten, wenn sie für eine Erkrankung empfänglicher sind.

Ein anderes Gebiet, worin besondere Vorteilen der Erfindung zu sehen sind, ist die Veranlagung von Individuen für endokrine Erkrankungen im späteren Leben, wie etwa Diabetes, Hypothyroidismus oder Hypoparathyroidismus, oder der Verlust oder die Erkrankung von Skelettmaterial, was zu einer altersbedingten Osteopanie, Osteoporose, Osteoarthritis, rheumatoiden Arthritis und periodontalen Erkrankung führt. Gewebe/Zellproben könnten von diesen Individuen entnommen werden, in einem Ruhezustand gelagert werden und dann wieder in das Individuum zurückgegeben werden, ggf. nach einer Expansion in vitro, wenn dessen endokriner Zustand/Skelettzustand ein Bedürfnis anzeigt.

Weiterhin besitzt die Erfindung besondere Vorteile bei der Behandlung einer neurodegenerativen Erkrankung mit einer genetischen Komponente. Dies ist deshalb der Fall, da die Spenderzellen genetisch modifiziert werden können, entweder vor oder nach dem Ruhezustand, beispielsweise um die zukünftigen oder gegenwärtigen Wirkungen der anomalen ererbten Komponente der Erkrankung beispielsweise aufzuheben, zunichte zu machen, zu lindern oder umzukehren. Bei der Chorea Huntington enthält beispielsweise das IT15-Gen, welches für Huntingtin codiert, eine anormal große Zahl an CAG-Repeats (Cell 72 (1993), 971). Dieses dominante Gen kann in vitro inaktiviert oder ausgeschaltet werden und durch eine normale Version ersetzt werden (J. Neuro Sci: 18 (1998) 6207; Bioessays 20 (1998), 200). Die vorliegende Erfindung besitzt deshalb klare Vorteile bei der Behandlung einer neurodegenerativen Erkrankung durch Bereitstellen von implantierbarem (PNAS 89 (1992) 4187) und in diesem Falle autotransplantierbarem Material, sowohl mit und ohne vorherige Modifikation der Funktionalität, der Differenzierung oder des Genotyps der Zelle. Analoge Prinzipien treffen auf die Behandlung von anderen Erkrankungen oder Krankheiten zu.

Diese Erfindung wäre auch vorteilhaft, wenn Zellen/Gewebeproben zu spezialisierten Laboratorien transportiert werden müssen, um Manipulationen zu durchlaufen (z.B. genetische Modifikationen, z.B. eine Kerntransplantation in Stammzellen), ehe sie dem Patienten zurückgegeben werden. Oft ist es nicht möglich, die Zellen an dem Ort entweder genetisch oder funktionell oder phänotypisch zu behandeln/modifizieren, an welchem dem Patienten die Probe entnommen wird. Selbst wenn es möglich ist, muss das Verfahren nicht notwendigerweise unmittelbar initiierbar sein. Das Platzieren der Probe in einem Ruhezustand kann für das Verfahren beträchtliche Vorteile aufweisen, da die durchzuführenden Zellmanipulationen an einem Zeitpunkt durchgeführt werden können, welcher für das Management des Verfahrens geeignet ist, entweder, ehe die Zellen in den Ruhezustand versetzt werden oder nachdem sie wiederbelebt wurden, jedoch ehe sie dem Patienten zurückgegeben werden.

Die Erfindung wird auch als vorteilhaft angesehen, wenn mehrere Proben von einem einzelnen Spender benötigt werden. Die Erfindung kann verwendet werden, um durch Hinzufügen von mehreren Proben (d.h. 2 oder mehr) zu der ersten Probe einen Bestand aufzubauen, wobei alle Proben vor der Revitalisierung eines Teils oder der gesamten Sammlung für die Verwendung beispielsweise bei einer Therapie in einen Ruhezustand versetzt werden. Das Donorgewebe für eine Autotransplantation kann von Tieren oder Menschen stammen, einschließlich transgenen Tieren. Solche Tiere umfassen, sind aber nicht beschränkt auf Ratten, Mäuse, Schweine, Hunde, Katzen, Schafe, Pferde und Rinder.

Die Erfindung kann auch das Einbringen eines negativen Selektionsmarkers in alle Zellen/Gewebe umfassen, welche dazu bestimmt sind, in den Patienten zurückgegeben zu werden, was beispielsweise in WO 96/14401 („Transgenic organisms and their uses") und in WO 96/14400 („Genetically modified neural cells") beschrieben wird.

Die Erfindung wird nun ausführlicher beschrieben anhand der folgenden nicht beschränkenden Beispiele unter Bezug auf die Zeichnungen, worin:

1 ein Balkendiagramm ist, welches die Wirkung einer Reinfusion von cryokonservierten autologen weißen Blutzellen auf das Überleben von röntgenbestrahlten Ratten zeigt (Zahl der überlebenden Ratten gegen die Zeit (Wochen) nach der Bestrahlung). Die Ratten wurden unter SPF ("specific pathogen-free")-Bedingungen gehalten. Allen Ratten wurden zwei Wochen vor der Bestrahlung durch eine Herzpunktion fünf ml Gesamtblut entnommen. Die weißen Blutzellen wurden wie zuvor beschrieben von fünf der Blutproben präpariert und dann unter Verwendung von Standardverfahren (siehe Beispiel 1) cryokonserviert. Zum Zeitpunkt Null wurde allen Ratten 8 Gy Röntgenstrahlung verabreicht. Zwei Wochen nach der Bestrahlung wurden fünf Ratten (ausgefüllte Balken) mit autologen Transplantaten der aufgetauten weißen Blutzellen infundiert, und Kontrolltiere (gestreifte Balken) erhielten nur autologes Plasmavehikel. Zwei Tage später wurden alle Ratten aus den SPF-Bedingungen entfernt und in die Haupttierkäfiganlage zurückgebracht. Es wurde der Tod von Tieren durch eine opportunistische Infektion beobachtet. Das Experiment zeigte, dass eine Reinfusion von weißen Blutzellen in bestrahlte Ratten solche immungeschwächten Tiere vor einem Tod durch eine Infektion schützt.

2 ist ein Balkendiagramm, welches die Erhaltung von autologen veränderten T-Lymphozyten in transplantierten Ratten von bis zu sechs Monate nach der Implantation zeigt, über die gesamte Dauer der Untersuchung (Anzahl der Ratten gegen die Zeit (Monate)). Fünf ml peripheres Blut wurden von jeder der zehn Ratten durch Herzpunktur entnommen. Die weißen Blutzellen wurden aus den Proben, wie in Beispiel 1 beschrieben, angereichert und dann genetisch verändert, sodass sie das Hygromycinresistenzgen enthielten (WO 96/15238). Die Zellen wurden, wie zuvor beschrieben, cryokonserviert. Sechs Monate nach der Cryokonservierung wurden die Zellen aufgetaut und es wurde eine autologe Reinfusion durchgeführt. Das Vorliegen von DNA, welche für das Hygromycinrestistenzgen codiert, wurde in dreimonatigen Intervallen durch PCR analysiert. Das Experiment zeigt das anhaltende Vorliegen von Zellen, welche das Hygromycinresistenzgen enthalten.

3 ist ein Balkendiagramm, welches die Ergebnisse einer identischen Studie wie der in 2 beschriebenen Studie zeigt, außer dass der Schritt der genetischen Veränderung statt vor dem Arbeitsgang der Cryokonservierung danach durchgeführt wurde. Das Vorliegen von DNA, welche für das Hygromycinresistenzgen codiert, wurde in dreimonatigen Intervallen analysiert. Es wurden ähnliche Ergebnisse erhalten wie diejenigen, welche bei einer Veränderung vor der Konservierung gefunden wurden, angezeigt durch das verlängerte Überleben der Zellen nach der Rückgabe in den Wirt.

Beispiel 1 Überleben einer Infektion durch eine vorausblickende autologe Implantation von gefrorenen gelagerten Spenderzellen (i) Entnommene Proben

In dieser Untersuchung wurden sowohl männliche als auch weibliche Wistar-Ratten verwendet. Es wurde eine Anzahl von Standardverfahren angewandt, um entweder Knochenmarkproben oder periphere Blutproben zu extrahieren (siehe unten). Ein Hinweis auf diese Verfahren ist in Texten der Humanchirurgie oder Tierchirurgie zu finden, wie etwa die Texte von Waynforth und Flecknell („Experimental und Surgical Technique in the Rat", 2. Auflage, Academic Press, 1992).

(ii) Verfahren der Probenentnahme

In Kürze, die Tiere wurden mit Chloroform anästhesiert und die Anästhesie wurde mit Halothan aufrechterhalten. Die Knochenmarkzellen und/oder Blutzellen wurden unter Verwendung von Standardverfahren entnommen. Alle Entnahmen wurden unter Anästhesie durchgeführt. Blut wurde durch Herzpunktion entnommen oder durch Exposition der Halsader, gefolgt von einer Blutextraktion daraus. Mark wurde nach einer Hinterbeinamputation aus dem Femur entnommen, und von der Tibia und Fibula des amputierten hinteren Beins (Practical Immunology, 3. Auflage, Blackwell Scientific Publications, 1989). Für eine Markentnahme wurde das Femur und/oder die Tibia der Ratte exponiert und die Knochenmarkzellen wurden unter Verwendung einer oder mehrerer Einwegknochenpunktionsnadeln oder einer „Islam"-Knochenmarkerntenadel oder einem Äquivalent davon für Ratten entfernt. Es wurde an mehreren Bereichen des Knochens eine Entnahme durchgeführt, um so eine geeignete Ernte von Markzellen für den zukünftigen Bedarf bereitzustellen. Alternativ wurde eine Rippenbiopsie durchgeführt, was für die Entnahmen von Knochenzellen des CFU-F ("colony forming units-fibroblast)-Typs besonders vorteilhaft war. Beim Menschen wird normalerweise aus dem Beckenkamm entnommen.

(iii) Markzellenpräparation

Die Knochenmarkzellen wurden, nachdem sie entnommen waren, in Kulturmedium suspendiert und von Fettmaterialien abgetrennt, insbesondere wie zuvor für die Entnahme von humanen Zellen beschrieben wurde (Bone 22 (1998) 7). Die resultierende Zellsuspension wurde in einen Universalbehälter übertragen und ungestört für 10 Minuten (min) stehengelassen, nach diesem Zeitraum wurden die Fettablagerungen, welche auf die Oberfläche aufgeschwommen waren, entfernt. Die vom Mark stammenden Zellen wurden in ein Zentrifugenröhrchen übertragen und mit 100 × Schwerkraft (g) für 5 min rotiert, um die Zellen zu ernten. Das Medium und die Fettablagerungen wurden erneut entfernt und das Zellpellet wurde in 5 ml frischem Kulturmedium resuspendiert. Die resuspendierten Zellen wurden auf einen 70%igen Percoll-Gradienten geladen, welcher bei 460 g für 15 min zentrifugiert wurde. Nach der Zentrifugation wurden die oberen 25% des Gradientenvolumens entfernt, welche die benötigten Markzellen enthielten. Zu dieser Suspension wurde ein gleiches Volumen frisches Medium zugegeben und die Suspension wurde bei 100 g für 10 min zentrifugiert. Das resultierende Zellpellet wurde in frischem Medium respuspendiert und es wurde durch mehrmaliges Passieren der Zellen durch eine Nadel mit dem Maß 19 eine Einzelzelllösung erhalten. Die Zahl der lebensfähigen Zellen wurde dann durch Trypan-Blau (1% w/v)-Ausschluss bestimmt.

Alternativ wurde keine Abtrennung der Fettzellen aus den entnommenen Markzellen durchgeführt und die gesamte Probe wurde für den Ruhezustand präpariert. Durch Markentnahme konnten sowohl hämatopoietisch abgeleitete als auch mesenchymal abgeleitete Gewebe erhalten werden, sodass außer den Zellen des Immunsystems auch Zellen erhalten werden konnten, welche zu Osteoblasten, Chondroblasten, Myoblasten, Fibroblasten und/oder Adipocyten werden konnten. Die mesenchymalen Zellen können beispielsweise dadurch abgetrennt werden, dass ihre Adhärenzeigenschaften ausgenützt werden. Platzieren der entnommenen Zellen auf Standardgewebekultur-Plastikgegenstände für unterschiedliche Zeitdauern führt zu Adhärenz der mesenchymalen Zellpopulation an den Kunststoff, wobei die hämatopoietischen Zellen in Suspension bleiben. Die unterschiedlichen Zelltypen können dann physikalisch durch Abschütten des Überstands getrennt werden.

Alle die obigen Verfahren sind dem Fachmann allgemein bekannt.

(iv) Periphere Blutentnahme

Entsprechende Proben von mononukleären Zellen (weißen Blutzellen) wurden alternativ durch periphere Blutentnahme erhalten. Es ist allgemein anerkannt, dass hämatopoietische Stammzellen, Vorläufer von T-Lymphozyten und reife T-Lymphozyten im peripheren Blut anwesend sind, was die mononukleären peripheren Blutzellen für eine Transplantation geeignet macht.

Peripheres Blut wurden auch von Ratten entnommen, welchen eine intraperitoneale Injektion/intraperitoneale Injektionen entweder eines Granulozytenkolonie-stimulierenden Faktors (G-CSF) oder eines GranulozytenMakrophagenkolonie-stimulierenden Faktors (GM-CSF) oder von Hämatopoietin für die Dauer von bis zu 96 Stunden vor Probenentnahme verabreicht wurde/n. Die mononukleären peripheren Blutzellen wurden 1 bis 4 Tage nach der Verabreichung von G-CSF/GM-CSF entnommen. Es ist gezeigt worden, dass G-CSF und GM-CSF die mononukleäre periphere Blutzellpopulation vermehrt, welche hämatopoietische T-Lymphozyten und ihre Vorläufer und Stammzellen ebenso wie andere Blutzellen umfasst. Dieser Ansatz hilft deshalb, in vivo vor ihrer Entnahme aus dem Körper die Menge der Zellen zu steigern, welche für eine nachfolgende Transplantation benötigt werden. Die Verwendung von Mitteln, wie etwa G-CSF, GM-CSF, Hämatopoietin oder Kombinationen davon 3 – 4 Tage vor der Entnahme des Bluts durch eine Apharese ist ein gegenwärtig verwendetes Verfahren, um periphere Blutstammzellen für eine humane Therapie zu erhalten, und kann erfindungsgemäß verwendet werden (Stern Cells 15 (1997) 9).

(v) Isolierung und Lagerung der entnommenen Zellen

Es wurde peripheres Blut entweder von nicht behandelten oder mit GM-CSF/G-CSF-behandelten Ratten entnommen und die weißen Blutzellen wurden direkt unter Verwendung von Standardverfahren präpariert. In Kürze, Blutproben wurden in heparinisierten Röhrchen platziert und es wurden durch Differenzialzentrifugation auf einem Dichtegradienten hochreine Lymphozytenpräparationen erhalten. Nach der Zentrifugation wurde die die weißen Blutzelle enthaltende Leukozytenmanschette („Buffy Coat"), welche klar sichtbar war, in einem frischen Cryokonservierungsbehälter platziert (Practical Immunology, 3. Auflage, Blackwelle Scientific Publications, 1989).

Alternativ wurden Markzellproben (entweder nicht abgetrennte Proben oder Proben, welche in die unterschiedlichen Zelltypen aufgetrennt waren, z.B. Fettzellen/Nicht-Fettzellen, mesenchymale Zellen/hämatopoietische Zellen) in frischen Cryokonservierungsbehältern platziert.

Zu den Blut- oder Markproben wurde autologes Plasma mit 20% v/v DMSO (oder Variationen eines DMSO-Volumens von 5-50%) bis zu einem Endvolumen zugegeben, welches die DMSO-Konzentration auf ungefähr 8,25% brachte (oder Variationen des DMSO-Volumens von 8-50%). Die Proben wurden dann gekühlt und langsam eingefroren, sodass alle 1-2 min ungefähr ein Grad Celsius verloren ging, bis sie ungefähr minus 50°C erreichten. Sie wurden dann für eine Langzeitlagerung bei ungefähr minus 196°/269°C bis zum Bedarf in gasförmigem/Flüssigphasen-Stickstoff/Helium oder gasförmigem und/oder flüssigem Stickstoff übertragen, gefolgt von gasförmigem und/oder flüssigem Helium.

Den behandelten Ratten wurden mehrere Wochen der Erholung gelassen, ehe sie einer erneuten Behandlung (Behandlungen) unterzogen wurden.

(vi) Ergänzung des Immunsystems

Eine Gruppe von 10 behandelten Ratten erhielt eine ablative Dosis (8 Gy) einer Ganzkörperbestrahlung, um so die gegenüber Bestrahlung sensitiven Zellpopulationen zu zerstören. Es ist gezeigt worden, dass die gegebene Strahlungsdosis das Immunsystem beeinträchtigt, welches in hohem Maße strahlungsempfindlich ist, sodass die Tiere bald nach der Behandlung leicht an einer Infektion sterben (Practical Immunology, 3. Auflage, Blackwell Scientific Publications, 1989). Die Entfernung des Thymus kann eine ähnliche Wirkung aufweisen.

Markzellen oder weiße Zellen werden aus gefrorenem Zustand aufgetaut, mit sanfter Bewegung des Cryoröhrchens in einem Becher mit Wasser mit 37°C.

Dann wurde Medium zugegeben, um das DMSO zu verdünnen, z.B. 10-fach, und die Zellen wurden durch Zentrifugation bei 400 g sanft pelletiert. Die Zellen wurden in einem kleinen Volumen von autologem Plasma resuspendiert, ehe sie mittels Infusion in das Tier zurückgegeben wurden.

Von den 10 bestrahlten Tieren wurden 5 zwei Wochen nach der Bestrahlung autologe Implantate verabreicht, und alle Ratten wurden in die Haupttierkäfiganlage der Einheit zurückgebracht. Innerhalb von drei Monaten waren die 5 nicht autotransplantierten Ratten an einer Infektion gestorben, jedoch die 5 autotransplantierten Ratten überlebten alle die folgenden sechs Monate der Untersuchung (siehe 1).

Beispiel 2 Autologe Implantation von genetisch veränderten gefroren gelagerten Spenderlymphozyten

In dieser Untersuchung wurden sowohl männliche als auch weibliche Wistar-Ratten verwendet, und die Markzellen und/oder mononukleären peripheren Blutzellproben wurden wie in Beispiel 1 beschrieben entnommen. Die mononukleären Zellen wurden genetisch so verändert, dass sie die a- und b-Ketten des T-Zellrezeptors exprimieren, welche in Kombination das Mage-1-Tumorantigen erkennen. Die genetische Konstruktion stellte auch eine Hygromycinresistenz der veränderten Zellen bereit und wird ferner in WO 96/15238 – "Targeted T-lymphocytes", hierin enthalten, beschrieben.

Proben der veränderten Zellen wurden dann für Zeiträume von bis zu sechs Monaten cryokonserviert, ehe sie, wie in Beispiel 1 beschrieben, revitalisiert/wiederbelebt wurden und als autologe Implantate verwendet wurden. Ratten mit autologen Implantate wurden zu verschiedenen Zeiten nach der Implantation getötet und ihr Blut wurde durch Herzpunktion ausgeblutet. Genomische DNA, welche für das Hygromycinresistenzgen codiert, welches nur in den veränderten Zellen vorlag, wurde durch die Polymerase-Kettenreaktion (PCR) nachgewiesen, wie zuvor beschrieben („PCR. A Practical Approach", IRL Press, 1991). In Kürze, mononukleäre periphere Blutzellen wurden durch Differenzialzentrifugation auf einem Dichtegradienten isoliert. Die Leukozytenmanschette wurde abgetrennt und genomische DNA wurde durch Phenol/Chloroform-Extraktion, gefolgt von einer Ethanol-Präzipitation und Resuspension in sterilem Wasser präpariert (Sambrook et al., Molecular Cloning, A Laboratory Manual, Vol. 1-3, Cold Spring Harbour Laboratory Press, 1989). Die genomische DNA wurde durch PCR in Gegenwart von Oligonukleotidprimern amplifiziert, welche so konzipiert waren, dass sie eine Sequenz von 272 Basenpaaren des Hygromycinresistenzgens erkennen (bezüglich der PCR Bedingungen siehe McPherson et al., „PCR. A Practical Approach", IRL Press, 1993). Die Hygromycinprimer zum Nachweis der Hygromycingensequenz mit 1,023 kb Größe waren wie folgt:

GAATTCAGCGAGAGCCTGAC (linker Primer 5'-3')

GATGTTGGCGACCTCGTATT (rechter Primer 5'-3')

Eine Probe des PCR-Produkts wurde mittels eines ein 4%igen Agarosegels einer Elektrophorese unterzogen und das Fragment des Hygromycinresistenzgens mit 272 Basenpaaren wurde durch UV-Durchleuchtung nach dem Färben des Gels mit Ethidiumbromid identifziert. Die Möglichkeit der Identifizierung des Hygromycingens in den Rattenblutproben wird in 2 dargestellt.

Beispiel 3 Genetische Veränderung und autologe Implantation von gelagerten gefrorenen Spenderlymphozyten

Beispiel 3 wurde wie Beispiel 2 durchgeführt, außer dass die Zellen für die autologe Implantation vor der genetischen Veränderung cryokonserviert wurden. Die Proben wurden wie in Beispiel 1 beschrieben vor der Autotransplantation aufgetaut. Die Ergebnisse des Erhaltens der Genexpression im Autotransplantat über die Zeit sind in 3 angegeben.

Beispiel 4 Syngene und autologe Transplantation von stromalen Markzellen in jungen und älteren Ratten

Für diese Untersuchungen wurde ein Inzuchtstamm von Sprague Dawley-Ratten verwendet. Suspensionen von Knochenmarkzellen (2 × 106 Zellen pro ml) wurden von Rippen- (auch Femur-) Biopsien präpariert, welche jungen Ratten (8 Wochen alt) und älteren Ratten (60 Wochen alt) entnommen wurden. Zellproben wurden mit 400 × Schwerkraft zentrifugiert und das resultierende Zellpellet (die resultierenden Zellpellets) wurden in 10% DMSO in autologem Plasma resuspendiert, gefolgt von einer Cryokonservierung in flüssigem Stickstoff und/oder gefolgt von flüssigem Helium.

Die Zellproben wurden zwischen 3 Monate und 2 Jahre nach der Cryokonservierung revitalisiert und im Kulturmedium mit 2 × 106 pro ml suspendiert. Zu jeder Probensuspension wurde eine einzelne poröse Hydroxyapatitplatte zugegeben und für 24 Stunden dann belassen, um eine Adhäsion der Zellen an die Platte zu ermöglichen – unter Erzeugung einer Zell/HA-Mischung. Die Mischungen wurden dann subkutan entweder als autogene oder syngene Implantate implantiert. Die Implantate wurden nach 8 Wochen entfernt und einer histologischen Analyse unterzogen, und Osteocalcin und alkalische Phosphatase wurden gemessen.

Die Experimentgruppen waren wie folgt:

  • (1) Markzellen, entnommen von jungen Ratten im Alter von 8 Wochen, wurden mit porösem Hydroxyapatit (HA) für 24 Stunden inkubiert, um eine Mischung aus Knochenzellen/HA zu bilden. Die Mischungen wurden dann entweder (a) autogen implantiert oder (b) syngen in Ratten des gleichen Alters implantiert oder (c) in Ratten im Alter von 60 Wochen implantiert oder (d) in Ratten im Alter von 104 Wochen implantiert.
  • (2) Markzellen, entnommen von alten Ratten im Alter von 60 Wochen wurden mit porösem Hydroxyapatit für 24 Stunden inkubiert unter Bildung einer Mischung aus Markzelle/HA. Die Mischungen wurden dann entweder (a) autogen implantiert oder (b) syngen in Ratten im Alter von 8 Wochen implantiert oder (c) syngen in Ratten im Alter von 60 Wochen implantiert oder (d) syngen in Ratten im Alter von 104 Wochen implantiert.
  • (3) Markzellen, entnommen von jungen Ratten im Alter von 8 Wochen wurden wie beschrieben cryokonserviert. Nach 96 Wochen Cryokonservierung wurden die Zellen revitalisiert und für 24 Stunden mit porösem Hydroxyapatit inkubiert unter Bildung einer Mischung Markzelle/HA. Die Mischungen wurden dann entweder (a) autogen implantiert (wobei die behandelten Ratten 104 Wochen alt waren) oder (b) syngen in Ratten im Alter von 104 Wochen implantiert oder (c) syngen in Ratten im Alter von 8 Wochen implantiert.
  • (4) Markzellen, entnommen von alten Ratten im Alter von 60 Wochen wurden wie beschrieben cryokonserviert. Nach 44 Wochen Cryokonservierung wurden die Zellen revitalisiert und mit porösem Hydroxyapatit für 24 Stunden inkubiert unter Bildung einer Mischung aus Markzellen/HA. Die Mischungen wurden dann entweder (a) autogen implantiert (die behandelten Ratten waren 104 Wochen alt) oder syngen in Ratten im Alter von 104 Wochen implantiert oder (c) syngen in Ratten im Alter von 8 Wochen implantiert.

Ergebnisse

Eine qualitative histologische Analyse zeigte einen klaren Unterschied zwischen der Fähigkeit von jungen und alten Markszellen, eine neue Knochenbildung entweder in autogenen oder syngenen Implantaten zu induzieren. 40% der Mischungen aus alten Markzellen/HA zeigten bei einer Implantation entweder in junge oder alte Ratten keine Knochenbildung, wohingegen in allen Mischungen, welche junge Markzellen enthielten, Knochen gebildet wurden. Das Ergebnis war identisch bei Mischungen, worin die Markzellen vor der Implantation cryokonserviert und revitalisiert worden waren.

Unterschiede in der Osteocalcin-Expression und der Aktivität der alkalischen Phosphatase zwischen Mischungen, welche aus jungen und alten Markzellen gebildet wurden, waren höchst signifikant. Im Durchschnitt war die Osteocalcin-Expression in den Mischungen mit jungen Zellen im Vergleich zu Mischungen, welche alte Zellen enthielten, 8-10 mal höher. Das Verhältnis von 8-10 des exprimierten Osteocalcins zwischen Mischungen, welche junge Zellen enthielten, im Vergleich mit Mischungen, welche alte Zellen enthielten, zeigte keine wesentliche Variation aufgrund der Cryokonservierung und Revitalisierung oder dadurch, dass statt einer syngenen eine autologe Transplantation durchgeführt wurde.

Es war auch eine Variation der Aktivität der alkalischen Phosphatase zwischen Mischungen zu sehen, welche entweder junge oder alte Zellen umfassten. Mischungen, welche junge Zellen umfassten, besaßen die 4-6-fache Aktivität der alkalischen Phosphatase bezogen auf Mischungen mit alten Zellen. Ähnlich wie bei der Osteocalcin-Untersuchung wurde durch die Cryokonservierung der Zellen vor der Bildung der Mischungen oder dadurch, dass statt einer syngenen Transplantation eine Autotransplantation durchgeführt wurde, keine wesentliche Veränderung dieses Verhältnisses bewirkt.

Tabelle 1 unten offenbart die Verhältnisse der beobachteten Osteocalcin-Expression zwischen den unterschiedlichen Gruppen.

Tabelle 2 unten offenbart die Verhältnisse der Expression der alkalischen Phosphatase, welche zwischen den unterschiedlichen Gruppen beobachtet wurde:

Ähnliche Unterschiede in der Fähigkeit zur Knochenbildung und im Osteocalcin („bone-gla-protein") und der Aktivität der alkalischen Phosphatase zwischen Markzellen von jungen und alten Ratten sind unabhängig von Unoue et al (1997) unter Verwendung von syngenen Ratten berichtet worden. Jedoch haben Inoue et al nicht über die Wirkungen der Cryokonservierung auf die osteogene Fähigkeit von jungen und alten Zellen berichtet, und ob dieser deutliche Unterschied der ostoegenen Fähigkeit in jungen und alten Zellen für autogene Transplantate gilt.

Beispiel 5 Autologe Implantation von neuralen Zellen in adulte Ratten

Adulte Ratten im Alter von 3 Monaten wurden in einen Stereotaxisrahmen platziert und es wurde die Schädelfläche über dem Lateralventrikel auf dem Niveau des Bregma entfernt. Eine stumpfe, sterile Glasmikropipette (ID = 100 mm) wurde 1,4 mm lateral zur Mittellinie in das Gehirn eingeführt. Die Pipette wurde in den dorsalen Teil des Lateralventrikels abgesenkt, an diesem Punkt wurde unter kontrolliertem Saugen eine kleine Menge Zerebrospinalflüssigkeit (CSF) entnommen. Noch immer unter kontrolliertem Saugen wurde die Pipette weiter gesenkt, sodass sie durch die ventrikularen, subventrikularen und anderen Schichten des neuralen Gewebes geführt wurde, welche sich an jeder Seite des Lateralventrikels befinden. Eine Suspension von Gewebe, Zellen und CSF wurde in dem Teil der Pipette mit einem großen Durchmesser gesammelt. Am Ende der Biopsie wurde die Suspension zerrieben (manchmal mit einem vorhergehenden enzymatischen Verdau, beispielsweise mit Trypsin) und in kleine Gewebekulturflaschen mit Medium entlassen. Solch ein Medium umfasste ein Gemisch von Dulbecco's modifiziertem Eagle-Medium und Ham's F12 (50/50 v/v), ergänzt mit L-Glutamin (2 mM), Penicillin : Streptomycin (100 IU/ml : 10 mg/ml) und modifizierter Stammlösung (PNAS USA 76 (1979) 514; J Neurophysiol 40 (1981) 1133) mit 10 ng/ml Epidermiswachstumsfaktor (EGF), 5 ng/ml basischem Fibroblastenwachstumsfaktor (FGF) oder dergleichen. Manchmal wurde auch eine Transmembrancokultur mit replikativen neuralen Zellen oder konditioniertes Medium von solchen Zellen verwendet, um das Überleben der neu dissoziierten adulten Zellen zu unterstützen.

Die Cluster von replizierenden Zellen wurden expandiert und durch Teilen in 4 -6 Teile, gefolgt von einer erneuten Ausplattierung „passagiert". Dies ermöglichte eine verlängerte Expansion. Zellcluster oder von diesen abgeleitete mechanisch dissoziierte Zellen wurden entweder in diesem Stadium oder nach der Differenzierung (siehe unten) in Medium mit 10% DMSO und unter Verwendung von konventionellen Verfahren eingefroren. Sie wurden dann in gasförmigem/Flüssigphase-Stickstoff platziert, gefolgt von einer längeren Lagerung in gasförmigem/Flüssigphase-Helium für Zeiträume von bis zu oder einschließlich einem Jahr.

Aufgetaute gefrorene replikative Zellen oder Zellen von dissoziierten replikativen Clustern wurden in Rollerröhren erneut ausplattiert und im gleichen Medium, aber ohne EGF für die nächsten paar Tage differenziert. Einige Zellen wurden in Gegenwart von Medium differenziert, welches durch konfluente (aber noch immer replikative) Striatumzellen konditioniert wurde, um sowohl Unterstützung als auch Faktoren zum Steuern der Differenzierung/Induktion bereitzustellen. Danach wurden die resultierenden differenzierten Zellcluster (ungefähr 1 Million Zellen) in die originalen Donorratten injiziert, welche 10 Tage zuvor unilateral durch Intrastriatuminjektion von Ibotensäure verletzt worden waren. Alternativ wurden die Zellen wie oben beschrieben eingefroren und dann aufgetaut und in das verletzte Striatum injiziert. Drei Monate später wurden die Tiere durch Perfusion fixiert und die Transplantate wurden durch Immunhistochemie analysiert.

Überlebende Implantate wurden in allen transplantierten Tieren gefunden. Die Implantate haben sich gut in das Striatum des Wirts integriert, obwohl sie noch immer klar als ein Bereich abgegrenzt waren, durch welchen myelierte Faserbündel meistens nicht hindurch wuchsen. Der Anteil der überlebenden Implantate wurde nicht dadurch beeinflusst, ob die Spenderzellen in irgendeinem Stadium eingefroren worden waren. Tatsächlich besaßen diejenigen Tiere mit Zellen, welche ein Einfrierverfahren unterlaufen hatten, größere Implantate als diejenigen mit nicht eingefrorenen Zellen, und die Expression von Neurofilament in solchen implantierten Zellen schien auch stärker und umfangreicher zu sein. Gleichermaßen konnte eine gewisse GFAF-Expression in dem Implantat gesehen werden.

Beispiel 6 Wirkungen der Lagerungstemperatur auf die Lebensfähigkeit der Zellen nach einem Jahr

Doppelte Aliquots der Zellen der gezeigten Art wurden durch die im Text beschriebenen Verfahren eingefroren und am Ende einer einstündigen Kühlung bei 1 °C pro Minute wurden sie für 1 Stunde in flüssigem Stickstoff platziert. Zu diesem Zeitpunkt wurde eines von jedem Paar der Aliquots durch die im Text beschriebenen Verfahren aufgetaut und im Hinblick auf die Lebensfähigkeit der Zellen unter Verwendung von Ethidiumbromid-Ausschluss/Acridinorange-Aufnahme analysiert (Brain Res 331 (1985) 251). Das andere Aliquot wurde für ungefähr ein Jahr in flüssigem Helium platziert und dann aufgetaut und die Lebensfähigkeit der Zellen wurde durch das gleiche Verfahren bewertet. Die Ergebnisse sind in Tabelle 3 unten gezeigt. Abgebildet sind die Mittelwerte und SEM von 6 Probenpaaren, und sie werden als Anteil der Zellen ausgedrückt, welche nach 1 Stunde in flüssigem Stickstoff überlebten. Es ist zu sehen, dass die niedere Temperatur zu einer kleinen, aber signifikanten Verbesserung der langfristigen Lebensfähigkeit der Zellen führen kann.

Beispiel 7 Wirkungen der Lagerungstemperatur auf die Lebensfähigkeit von Zellen nach zwei Jahren

Die „einjährige" Untersuchung von Beispiel 6 wurde wiederholt, wobei ein Aliquot der Zellen für 2 Jahre in flüssigem Helium gelagert wurde. Die Zellen wurden dann aufgetaut und die Lebensfähigkeit der Zelle wurde, wie in Beispiel 6 beschrieben, bewertet. Die Ergebnisse sind in Tabelle 4 gezeigt. Abgebildet sind die Mittelwerte und SEM von 6 Probenpaaren, und sie werden als Anteil der Zellen ausgedrückt, welche nach 1 Stunde in flüssigem Stickstoff überleben. Es ist zu sehen, dass nach einer Lagerung von zwei Jahren ähnlich gute Ergebnisse der Lebensfähigkeit erhalten werden können.


Anspruch[de]
Verwendung einer Wirtszellpopulation von ausgereiften, gesunden Lymphozytenzellen, erhalten vom Blut eines nicht erkrankten Wirtsorganismus, zur Herstellung einer Zellzusammensetzung zur Verwendung bei einer nachfolgenden autologen therapeutischen Transplantationstherapie einer Krankheit oder Erkrankung des Wirtsorganismus, worin die Zellen vom Wirtsorganismus erhalten werden, ehe sich die Krankheit oder Erkrankung entwickelt oder manifestiert. Verwendung nach Anspruch 1, worin die Wirtszellen von dem Wirtsorganismus in einem Stadium geerntet werden, in dem es keine direkte Vorhersage, keine Hinweis oder Verdacht gibt, dass sich die Krankheit oder Erkrankung entwickeln kann. Verwendung nach Anspruch 1 oder Anspruch 2, worin der Wirtsorganismus ein Mensch ist. Verwendung nach einem der Ansprüche 1 bis 3, worin der Wirtsorganismus zu dem Zeitpunkt, an dem die Zellen erhalten werden, juvenil, adoleszent oder adult ist. Verwendung nach einem der Ansprüche 1 bis 4, worin das Immunsystem des Wirtsorganismus zu dem Zeitpunkt, an dem die Zellen erhalten werden, ausgereift ist. Verwendung nach einem der Ansprüche 1 bis 5, worin das das Immunsystem des Wirtsorganismus zu dem Zeitpunkt, an dem die Zellen erhalten werden, nicht beeinträchtigt ist. Verwendung nach einem der Ansprüche 1 bis 6, worin die Lymphozytenzellen T-Lymphozytenzellen sind. Verwendung nach einem der Ansprüche 1 bis 7, worin die Therapie eine Therapie eines chronischen Zustands ist. Verwendung nach einem der Ansprüche 1 bis 7, worin die Therapie eine Krebstherapie ist. Verwendung nach einem der Ansprüche 1 bis 7, worin die Therapie für eine HIV-Infektion oder für AIDS ist. Verwendung nach Anspruch 10, worin die Wirtszellpopulation CD4+-Zellen umfasst. Verwendung nach einem der Ansprüche 1 bis 11, worin die Wirtszellpopulation in einem Ruhezustand gehalten wird. Verwendung nach einem der Ansprüche 1 bis 12, worin die Wirtszellpopulation eine genetisch modifizierte Zelle umfasst. Verwendung nach einem der Ansprüche 1 bis 13, worin die Wirtszellpopulation nach dem Entfernen aus dem Wirt und vor einer Transplantation durch Einfrieren der Zellen gelagert wird. Verwendung nach Anspruch 14, worin die Wirtszellpopulation auf etwa –269°C oder weniger eingefroren wird. Verfahren zur Herstellung und/oder zum Halten von Lymphozytenzellen im Ruhezustand, wobei das Verfahren Einfrieren der Lymphozytenzellen auf eine Temperatur von –269°C oder weniger umfasst. Verfahren nach Anspruch 16, worin die Lymphozytenzellen aus Blut erhalten werden. Verfahren nach Anspruch 16 oder Anspruch 17, worin die Lymphozytenzellen T-Lymphozytenzellen sind.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com