PatentDe  


Dokumentenidentifikation DE69636052T2 12.04.2007
EP-Veröffentlichungsnummer 0000811064
Titel MPL-LIGANDEN ANALOGA
Anmelder Amgen Inc., Thousand Oaks, Calif., US
Erfinder ELLIOTT, Steven G., Newbury Park, CA 91320, US
Vertreter BOEHMERT & BOEHMERT, 80336 München
DE-Aktenzeichen 69636052
Vertragsstaaten AT, BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 13.02.1996
EP-Aktenzeichen 969066174
WO-Anmeldetag 13.02.1996
PCT-Aktenzeichen PCT/US96/02492
WO-Veröffentlichungsnummer 1996025498
WO-Veröffentlichungsdatum 22.08.1996
EP-Offenlegungsdatum 10.12.1997
EP date of grant 19.04.2006
Veröffentlichungstag im Patentblatt 12.04.2007
IPC-Hauptklasse C07K 14/52(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 5/10(2006.01)A, L, I, 20051017, B, H, EP   A61K 38/19(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]

Die vorliegende Erfindung betrifft mpl-Ligandenanaloga mit mindestens einer veränderten O- oder N-verknüpften Glykosylierungsstelle. Die Erfindung betrifft auch DNA-Sequenzen, welche diese mpl-Ligandenanaloga kodieren und rekombinante Plasmide und Wirtszellen zur Expression der Analoga.

Hintergrund der Erfindung

MGDF oder Megakaryozytenwachstums- und Entwicklungsfaktor (megacaryocyte growth and development factor) ist ein kürzlich kloniertes Zytokin, das der wichtigste Regulator der Konzentrationen an Blutplättchen in der Zirkulation zu sein scheint. Siehe Bartley, T.D. et al., Cell 77: 1117–1124 (1994); Lok, S. et al., Nature 369: 565–568 (1994); de Sauvage, F.J. et al., Nature 369: 533–538 (1994); Miyazake, H. et al., Exp. Hematol. 22: 838 (1994); und Kutter, D.J. et al., PNAS USA, 91: 11104–11108 (1994). MGDF wird, wie in Bartley, T.D. et al., Cell 77: 1117–1124 (1994) beschrieben, auch als Thrombopoetin (TPO), mpl-Ligand oder Megapoetin bezeichnet. Hier wird die Bezeichnung „mpl-Ligand" allgemein verwendet werden, um alle Polypeptide zu bezeichnen, welche den mpl-Rezeptor aktivieren, einschließlich TPO und MGDF. Der mpl-Rezepor ist ein Zelloberflächenprotein, das als Folge einer Aktivierung zur Produktion und/oder Entwicklung von Megakaryozyten und Blutplättchen führt. Siehe WO 92/07074.

„mpl-Ligandenanaloga" sind Polypeptide, die sich von nativen Sequenzen auf eine Weise unterscheiden, welche die Anzahl, die Lage oder die Art von Kohlenhydratbindungsstellen betrifft. Derartige Polypeptide sind ein Aspekt der vorliegenden Erfindung. Der reife native menschliche mpl-Ligand ist ein Protein mit insgesamt 332 Aminosäuren. Die Sequenz diese Proteins (angefügt an eine Führersequenz aus 21-Aminosäuren) und die korrespondierende cDNA werden hier in 1 gezeigt (SEQ. ID Nr. 1 und 2).

Für einen rekombinanten mpl-Liganden, der sowohl in Ovarialzellen vom chinesischen Hamster (Chinese hamster ovary, CHO) als auch in E. coli produziert wurde, ist gezeigt worden, dass er eine biologische Aktivität aufweist, Megakaryozyten und/oder Blutplättchen in vivo in Mäusen, Ratten und Affen spezifisch zu stimulieren oder ihre Zahl zu erhöhen. Siehe z.B. Hunt, P. et al., Blood 84 (10): 390A (1994). Menschliche mpl-Ligandenmoleküle, die trunkiert worden sind (im Vergleich zu dem Protein mit 332 Aminosäuren, welches durch die cDNA im Menschen kodiert wird), so dass sie sich über mindestens 151 Aminosäuren erstrecken, beginnend in der Aminosäureposition 22 in 1, behalten ihre biologische Aktivität in vivo bei. 2 (SEQ. ID Nr. 3 und 4) zeigt ein Beispiel eines trunkierten mpl-Ligandenmoleküls, welches in der reifen Form 174 Aminosäuren und biologische Aktivität aufweist. In 2 wird gezeigt, dass das Protein mit 174 Aminosäuren an eine N-terminale Führersequenz mit 21 Aminosäuren angefügt ist. Diese Molekül wurde verwendet, um einige der unten im Abschnitt „Beispiele" dargestellten mpl-Ligandenanaloga zu erzeugen. Andere Analoga beruhen auf den Aminosäuren 1-199, 1-191 und 1-183 in 1. Es ist auch möglich, bis zu sechs der ersten Aminosäuren am N-Terminus des reifen mpl-Ligandenproteins mit der menschlichen Sequenz zu entfernen und die biologische Aktivität zu erhalten. Deshalb scheint es, dass die biologische Aktivität innerhalb der Aminosäuren 7-151 (einschließlich) der reifen Aminosäuresequenz des in 1 gezeigten menschlichen mpl-Liganden bewahrt wird.

Im Allgemeinen sind viele Zelloberflächen- und sekretorische Proteine, die durch eukaryotische Zellen produziert werden, durch eine oder mehrere Oligosaccharidgruppen modifiziert. Diese Modifikation, die als Glykosylierung bezeichnet wird, kann die physikalischen Eigenschaften von Proteinen erheblich beeinflussen und kann auch für die Proteinstabilität, Sekretion und subzelluläre Lokalisierung wichtig sein. Eine ordnungsgemäße Glykosylierung kann für die biologische Aktivität wesentlich sein. Tatsächlich liefern einige Gene von eukaryotischen Organismen Proteine, die aufgrund ihrer fehlenden Glykosylierung mit wenig oder ohne Aktivität gewonnen werden, wenn sie in Bakterien (z.B. E. coli.) exprimiert werden, denen die zelluläre Ausrüstung zum Glykosylieren von Proteinen fehlt.

Eine Glykosylierung findet an speziellen Orten oder Stellen entlang des Polypeptid-Rückgrats statt und ist üblicherweise von zweierlei Art: O-verknüpfte Oligosaccharide werden an Serin-(Ser) oder Threonin-(Thr) Reste angefügt, während N-verknüpfte Oligosaccharide (Ketten) an Asparagin-(Asn) Reste angefügt werden, wenn sie Teil der Sequenz Asn-X-Ser/Thr sind, wobei X jede Aminosäure sein kann mit Ausnahme von Prolin. X ist vorzugsweise eine der 19 natürlich vorkommenden Amionsäuren, Prolin nicht gezählt. Die Strukturen von N-verknüpften und O-verknüpften Oligosacchariden und der Zuckerreste, die bei jeder Art gefunden werden, sind verschieden. Eine Art von Zucker, der gewöhnlich bei beiden gefunden wird, ist N-Acetylneuraminsäure (hier im Folgenden als Sialinsäure bezeichnet). Sialinsäure ist gewöhnlich der terminale Rest von sowohl N-verknüpften als auch O-verknüpften Oligosacchariden und aufgrund ihrer negativen Ladung kann sie dem Glykoprotein saure Eigenschaften verleihen.

Wie hier verwendet, sind „Glykosylierungsstellen" Aminosäurereste, die strukturell zu einer Verknüpfung mit Glykosylresten in der Lage sind, auch wenn derartige Stellen tatsächlich mit einem Glykosylrest verknüpft sein können oder auch nicht. Wie oben erwähnt, sind O-verknüpfte Stellen entweder Ser- oder Thr-Reste, wobei N-verknüpfte Stellen entweder Asn-X-Ser oder Asn-X-Thr sind, wobei X als jede Aminosäure mit Ausnahme von Pro definiert ist (vorzugsweise eine der 19 natürlich vorkommenden Aminosäuren mit Ausnahme von Pro). Ob eine vorgegebene Stelle mit einer Glykosylkette glykosyliert ist, wird durch die Wirtszelle, in der das Molekül exprimiert wird, die Aminosäuren, die dieser Stelle benachbart sind und anderen Faktoren bestimmt.

Wie hier verwendet, wird die Anzahl an „Ketten", die an ein vorgegebenes mpl-Ligandenanalogon angefügt sind, der durchschnittlichen Anzahl an Kohlenhydrat (d.h. Glykosyl-) Ketten, die an ein vorgegebenes mpl-Ligandenmolekül, das durch eine bestimmte Wirtszelle exprimiert wird, entsprechen. Vor allem werden die Glykosylierungsstellen bei natürlichem und entsprechendem, rekombinantem mpl-Liganden im Allgemeinen dieselben sein, während die Anzahl an Ketten möglicherweise variieren wird, was davon abhängt, ob die bestimmte Wirtszelle, die zur rekombinanten Expression verwendet wird, Glykosylketten an dieselben Stellen wie die natürliche Quelle anfügt oder nicht. Wann immer hier ein Vergleich zwischen rekombinanten und natürlichen mpl-Ligandenanaloga vorgenommen wird, wird dieselbe Aminosäurenzahl verglichen werden, ohne Rücksicht darauf, ob die natürliche Quelle tatsächlich ein mpl-Ligandenmolekül mit dieser Länge produziert. Folglich bezieht sich der Begriff „natürlich" auf die Sequenz, die in einer bestimmten Spezies (wie etwa dem Menschen) eingesetzt wird, anstatt auf die Länge des Moleküls, das tatsächlich in einer solchen natürlichen Quelle exprimiert wird.

Der natürlich vorkommende mpl-Ligand ist ein glykosyliertes Molekül. Das Glykosylierungsmuster von natürlichem mpl-Liganden weist einen Bezug zu zwei Schlüsseldomänen auf, die in dem mpl-Liganden gefunden worden sind. Die Sequenz der ersten ungefähr 151 Aminosäuren von reifem menschlichen mpl-Liganden, die einem aktiven Teilbereich des Moleküls entspricht, trägt eine bemerkenswerte Homologie zu Erythropoetin (EPO), einem Zytokin, das in der Lage ist, die Produktion von Erythrozyten zu stimulieren, und wird als die „EPO-artige" Domäne von menschlichem mpl-Liganden bezeichnet. Die verbleibenden Aminosäuren des reifen Proteins machen eine sogenannte „N-verknüpfte Kohlenhydrat"-Domäne aus, da sie die meisten, wenn nicht alle der natürlichen Stellen für eine N-verknüpfte Glykosylierung einschließen. In menschlichem mpl-Liganden gibt es sechs N-verknüpfte Glykosylierungsstellen, die alle in der N-verknüpften Glykosylierungsdomäne enthalten sind. Beide Domänen enthalten O-verknüpfte Glykosylierungsstellen. Es gibt schätzungsweise 12-14 O-verknüpfte Glykosylierungsketten in dem Molekül. Experimentelle Nachweise mit menschlicher mpl-Liganden-DNA, die rekombinant in CHO-Zellen exprimiert wurde, zeigen, dass in der EPO-artigen Domäne mindestens zwei O-verknüpfte Stellen in den Positionen 1 (Ser) und 37 (Thr) glykosyliert sind.

Glykoproteine, wie etwa der mpl-Ligand, können in zwei verschieden geladenen Formen unter Verwendung von Techniken, wie etwa der isoelektrischen Fokusierung (IEF), aufgetrennt werden. Beispielsweise haben verschiedene Gruppen über IEF-Studien an rohen und teilweise gereinigten Erythopoetin-Präparationen berichtet (Lukowsky et al., J. Biochem. 50: 909 (1972); Shelton et al., Biochem. Med. 12: 45 (1975); Fuhr et al., Biochem. Biophys. Res. Comm. 98: 930 (1981).

Trotz der oben dargestellten Information zu der Glykosylierung von mpl-Ligandenmolekülen, bleibt ein Bedarf bestehen, mpl-Ligandenmoleküle mit einem anderen Glykosylierungsmuster zu erhalten, die biologische Aktivität beibehalten oder bei denen die biologische Aktivität verbessert ist.

Demgemäß ist eine Aufgabe der vorliegenden Erfindung, neue glykosylierte mpl-Ligandenmoleküle verfügbar zu machen, die als mpl-Ligandenanaloga bezeichnet werden. Eine weitere Aufgabe dieser Erfindung ist es, pharmazeutischen Zusammensetzungen, welche derartige Moleküle enthalten, und Verfahren zum Behandeln von Zuständen, die durch mpl-Ligand behandelbar sind, mit den mpl-Ligandenanaloga dieser Erfindung verfügbar zu machen.

Kurzfassung der Erfindung

Gemäß der vorliegenden Erfindung wird ein Analogon des Megakaryozytenwachstums- und Entwicklungsfaktors (MGDF) verfügbar gemacht, wobei

  • (a) das MGDF-Analogon eine Aminosäuresequenz umfasst, die ausgewählt ist aus der Gruppe, bestehend aus in SEQ. ID Nr. 1 gezeigten Aminosäuresequenzen 7-151 bis einschließlich 1-332.
  • (b) das MGDF-Analogon mindestens eine hinzugefügte N-verknüpfte Glykosylierungsstelle in der Sequenz von Aminosäuren aufweist,
  • (c) das MGDF-Analogon mindestens eine hinzugefügte Kohlenhydratkette aufweist, die an die hinzugefügte N-verknüpfte Glykosylierungsstelle angefügt ist, und
  • (d) das MGDF-Analogon eine biologische Aktivität aufweist, welche die Megakaryozyten oder Blutplättchen spezifisch stimuliert oder ihre Anzahl erhöht,
  • (e) das MGFD-Analogon ausgewählt ist aus der Gruppe, bestehend aus

    [Asn30, Thr32]-mpl-Ligand;

    [Asn82, Ala83]-mpl-Ligand;

    [Asn120, Thr122]-mpl-Ligand;

    [Asn53, Thr55]-mpl-Ligand;

    [Asn58, Thr60]-mpl-Ligand;

    [Asn30, Thr32, Asn120, Thr122]-mpl-Ligand;

    [Asn54, Ser56]-mpl-Ligand;

    [Asn52, Thr54]-mpl-Ligand;

    [Asn55'(i), Thr57]-mpl-Ligand;

    [Asn30, Ser32, Asn120, Ser122]-mpl-Ligand;

    [Thr163, Asn164]-mpl-Ligand;

    [Asn30, Thr32, Asn120, Thr122, Asn5(i), Thr57]-mpl-Ligand;

    [Asn30, Thr32, Asn55(i), Thr57, Thr163, Asn164]-mpl-Ligand;

    [Asn56]-mpl-Ligand;

    [Thr163, Asn164, Thr166]-mpl-Ligand; und

    [Asm30, Thr32, Asn120, Thr122, Asn55, Thr57, Thr163, Asn164, Thr166]-mpl-Ligand, und
  • (f) das MGDF-Analogon eine Aminosäuresequenz aufweist, die ausgewählt ist aus folgenden:

    mpl-Ligand 1-332 Aminosäuren 1-332 aus 1

    mpl-Ligand 1-199 Aminosäuren 1-199 aus 1

    mpl-Ligand 1-191 Aminosäuren 1-191 aus 1

    mpl-Ligand 1-183 Aminosäuren 1-183 aus 1

    mpl-Ligand 1-174 Aminosäuren 1-174 aus 1

    mpl-Ligand 1-163 Aminosäuren 1-163 aus 1

    mpl-Ligand 1-153 Aminosäuren 1-153 aus 1

    mpl-Ligand 1-152 Aminosäuren 1-152 aus 1

    mpl-Ligand 1-151 Aminosäuren 1-151 aus 1

    mpl-Ligand 7-332 Aminosäuren 7-332 aus 1

    mpl-Ligand 7-191 Aminosäuren 7-191 aus 1

    mpl-Ligand 7-199 Aminosäuren 7-199 aus 1

    mpl-Ligand 7-183 Aminosäuren 7-183 aus 1

    mpl-Ligand 7-174 Aminosäuren 7-174 aus 1

    mpl-Ligand 7-163 Aminosäuren 7-163 aus 1

    mpl-Ligand 7-153 Aminosäuren 7-153 aus 1

    mpl-Ligand 7-152 Aminosäuren 7-152 aus 1

    mpl-Ligand 7-151 Aminosäuren 7-151 aus 1

Die Erfindung umfasst weiterhin DNA-Sequenzen, welche derartige mpl-Ligandenanaloga kodieren, und rekombinante Plasmide und Wirtszellen zur Expression der Analoga.

In allen der oben beschriebenen Fälle führt die Änderung an einer Glykosylierungsstelle zu einer Änderung der Anzahl, Menge, Lage oder Art (N- versus O-) der Glykosylketten in dem sich ergebenden mpl-Ligandenanalogon und dieses behält die biologische Aktivität des mpl-Liganden bei, d.h. das Analogon kann den mpl-Rezeptor noch aktivieren. Die Aktivierung des mpl-Rezeptors bedeutet, dass die Megakaryozytopoese verstärkt ist, wodurch es zu einer Zunahme der Blutplättchen in vivo kommt.

Kurze Beschreibung der Zeichnungen

1 zeigt die DNA- und Aminosäuresequenz von nativem menschlichem mpl-Liganden, einschließlich einem Signalpeptid (Amionsäuren-21 bis -1) und der reifen Aminosäuresequenz (1-332).

2 zeigt die DNA- und Aminosäuresequenz des mpl-Liganden, die mit den Aminosäuren 1-174 der Sequenz des menschlichen reifen mpl-Liganden entspricht, die an ein Signalpeptid mit 21 Aminosäuren angefügt ist. Bei den Sequenzen, welche die kodierende Regionen flankieren, sind XbaI- und SalI-Klonierungsstellen an den 5'- bzw. 3'-Enden eingefügt.

3 zeigt einen Western blot von durch E. coli und CHO-Zellen exprimiertem mpl-Liganden. MK steht für Met-Lys, das an den N-Terminus vom mpl-Liganden zur Expression in E. coli angefügt ist und unter Verwendung einer Dipeptidase, wie Cathepsin C, abgespaltet werden kann. Ein Molekül, bei dem MK entfernt worden ist, wird als des MK bezeichnet. Eine Behandlung mit den Glykosidasen Neuraminidase und O-Glykanase wird angegeben.

4 zeigt die Aktivität in vivo von durch E. coli und CHO-Zellen exprimiertem mpl-Liganden in normalen Mäusen, bezogen auf die Zahl der Blutplättchen. Diese Daten zeigen, dass der glykosylierte mpl-Ligand (CHO-Material) eine Aktivität aufweist, die der des nicht-glykosylierten (E. coli) Materials überlegen ist. Dies kann ein Ergebnis der erhöhten Halbwertszeit des glykosylierten Materials sein. Beispielsweise steht CHO 332 für die Aminosäuren 1-332 des in CHO-Zellen exprimierten menschlichen mpl-Liganden (1).

5 zeigt eine Western blot-Analyse von COS-Zellüberständen von rekombinantem menschlichem mpl-Liganden und den Analoga 4, 6, 7, 9, 10 und 11. Die Konstruktion dieser Analoga wird im Beispiel 4 beschrieben. Die Analoga 4, 7, 10 weisen mindestens eine zusätzliche Kohlenhydratkette auf, wie durch eine geringere Gelmobilität nachgewiesen wird. Die Analogonnummern entsprechen den Analogonnummern, die in Tabelle 1 verfügbar gemacht werden (z.B. entspricht die Nummer 11 dem Analogon N11). In Tabelle 1 ist N1 die Kontrolle.

6 zeigt eine Western blot-Analyse von COS-Zellüberständen von rekombinantem menschlichem mpl-Liganden und den Analoga 4, 5, 13, 14 und 15. Die Konstruktion der Analoga wird im Beispiel 4 beschrieben. Die Analoga 4, 13, 14 und 15 wiesen mindestens eine zusätzliche Kohlenhydratkette auf, wie durch eine geringere Gelmobilität nachgewiesen wird.

7 zeigt eine Western blot-Analyse von COS-Zellüberständen von menschlichem mpl-Liganden und angegebenen mpl-Ligandenanaloga nach Behandlung mit N-Glykanase. Die Ergebnisse zeigen, dass die Analoga verschiedene Glykosylierungsmuster aufweisen.

8 zeigt die Ergebnisse eines Biotests zum Wachstum menschlicher Megakaryozyten mit mpl-Ligandenanaloga. Die Tafeln A und D sind die positiven bzw. negativen Kontrollen. Das in Tafel A abgebildete Well erhielt 37, 5 pg Wildtyp (d.h. natürliche Sequenz) mpl-Ligand 1-174 COS-1-konditioniertes Medium und zeigt ein wesentliches Megakaryozytenwachstum. Das Well in Tafel D erhielt 1,5 &mgr;l COS-1-konditioniertes Medium ohne Liganden (Mock) und zeigte kein Wachstum. In dem Tafeln B und C werden die mpl-Liganden 1-174-Analoga 7 bzw. 10 gezeigt. Das Well in Tafel B erhielt 9,0 pg mpl-Ligand COS-1-konditioniertes Medium, während das Well in Tafel C 27 pg erhielt, und beide zeigten ein ausgezeichnetes Megakaryozytenwachstum.

9 zeigt eine Western blot-Analyse von CHO-mpl-Ligand 1-174 und den Analoga N4 und N15 (siehe Tabelle 1). Eine geringere Gelmobilität zeigte, dass das Analogon N4 (4B) ein zusätzliches Oligosaccharid aufweist, während das Analogon N15 (15-8) zwei zusätzliche Oligosaccharide aufweist.

10 zeigt einen Western blot von durch CHO-Zellen produzierten mpl-Ligandenanaloga mit und ohne Behandlung mit N-Glykanase, wie angegeben. Ein geringere Gelmobilität nach Behandlung mit N-Glykanase zeigte das Vorhandensein von N-verknüpftem Oligosaccharid.

11 zeigt die Blutplättchenzählungen von Mäusen, die mit verschiedenen Formen des mpl-Liganden in verschiedenen Dosen behandelt wurden. Die Daten zeigen, dass zunehmende Mengen an N- und/oder O-verknüpftem Kohlenhydrat zu einer gesteigerten Aktivität in vivo führen.

12 zeigt eine Western blot-Analyse von durch COS-Zellen produziertem mpl-Liganden 1-174 zusammen mit den Analoga N10, N15, N33, N39, N31 und N40. Die Anzahl an hinzugefügten N-verknüpften Glykosylstellen wird ebenfalls angegeben. Die Figur zeigt, dass ein Zunehmen der Anzahl an N-verknüpften Stellen die Mobilität des mpl-Liganden aufgrund zunehmender Mengen an N-verknüpftem Kohlenhydrat reduziert.

13 zeigt eine Western blot-Analyse von in COS-Zellen produziertem mpl-Liganden 1-174 zusammen mit den Analoga N15, N29, N30 und N38. Die Anzahl der N-verknüpften Glykosylketten ist ebenfalls angegeben.

Genaue Beschreibung der Erfindung

Der Gegenstand der Erfindung macht mpl-Liganden mit Glykosylierungsstellen verfügbar, die sich von denen eines natürlichen mpl-Liganden mit einer entsprechenden Sequenz unterscheiden. Vorzugsweise sind die resultierenden Moleküle solche, die zusätzliche Glykosylierungsstellen aufweisen, die durch Glykosylketten nach Expression in einer Säugetierzelle (wie etwa COS; CHO und menschliche Zellen) besetzt sind.

In einer ersten Ausführung bezieht sich der Gegenstand der Erfindung auf mpl-Ligandenanaloga, die eine Aminosäuresequenz umfassen, welche mindestens eine hinzugefügte, mindestens eine deletierte und/oder mindestens eine hinzugefügte und deletierte Stelle zur Glykosylierung im Vergleich zu dem entsprechenden mpl-Liganden mit natürlicher Sequenz aufweisen. Die hinzugefügte oder deletierte Stelle bzw. die hinzugefügte(n) oder deletierte(n) Stelle(n) zur Glykosylierung können zu einer größeren oder geringern Anzahl an Kohlenhydratketten und höherem oder geringerem Sialinsäuregehalt im Vergleich zu dem entsprechenden mpl-Liganden mit natürlicher Sequenz, insbesondere eines menschlichen mpl-Liganden, führen. Eine Kombination aus einer Deletion an einer Stelle und einer Hinzufügung einer anderen Stelle würde zu keiner Netto-Änderung der Anzahl an Stellen führen, jedoch zu einer Änderung des Orts und/oder der Art der Stelle. Derartige kombinierte Austauschanaloga sind ebenfalls von dieser Erfindung umfasst.

Unter einem anderen Aspekt der oben beschriebenen Ausführung bezieht sich der Gegenstand der Erfindung auf mpl-Ligandenanaloga, welche Aminosäuresequenzen umfassen, welche einen Austausch von einer oder mehreren N- oder O-verknüpften Glykosylierungsstellen durch eine oder mehrere nicht natürlich vorkommende Stellen einschließt. Folglich kann eine N-verknüpfte Stelle durch eine davon verschiedene N-verknüpfte Stelle ersetzt sein; eine N-verknüpfte Stelle kann durch eine O-verknüpfte Stelle ersetzt sein; eine O-verknüpfte Stelle kann durch eine davon verschiedene O-verknüpfte Stelle ersetzt sein; und/oder eine O-verknüpfte Stelle kann durch eine N-verknüpfte Stelle ersetzt sein. Der Austausch von einer Stelle durch eine andere Stelle an im Wesentlichen demselben Ort kann zum Ergebnis haben, dass die Glykosylierungseffizienz an dieser Stelle zunimmt oder sie kann andere Wirkungen haben. Beispielsweise wird hier der Nachweis geführt, dass ein Thr-Rest anstelle eines Ser-Restes die Glykosylierungseffizienz an O-verknüpften Stellen erhöht.

Der Begriff „mpl-Ligand", wie hier verwendet, schließt den natürlich vorkommenden mpl-Liganden, Trunkierungen vom natürlich vorkommenden mpl-Liganden ebenso wie nicht natürlich vorkommende Polypeptide mit einer Aminosäuresequenz und einer Glykosylierung ein, welche die des natürlich vorkommenden mpl-Liganden ausreichend kopiert, um den Besitz einer biologischen Aktivität zum spezifischen Stimulieren des Wachstums, der Entwicklung und/oder Produktion von Megakaryozyten und/oder Blutplättchen zu erlauben. mpl-Ligandenanaloga, die auf mindestens den Aminosäuren 7-151 bis zu den Aminosäuren 1-332 in 1 beruhen, werden bevorzugt.

In einer bevorzugten Ausführung ist der mpl-Ligand das Produkt der Expression einer exogenen DNA-Sequenz, die in eine eukaryotische Wirtszelle transfiziert worden ist; d.h., in einer bervorzugten Ausführung ist der mpl-Ligand ein „rekombinatneter mpl-Ligand". Die bevorzugte eukaryotische Wirtszelle ist eine Säugetierzelle, besonders zu bevorzugen sind CHO-Zellen. Der rekombinante mpl-Ligand wird vorteilhafterweise gemäß den hier beschriebenen Vorgehensweisen und den hier zitierten Publikationen im Hinblick auf das Klonieren und die Expression des mpl-Liganden hergestellt.

mpl-Ligandenmoleküle weisen auf der Grundlage der hier dargestellten 1 die folgenden Aminosäuresequenzen auf: mpl-Ligand 1-332 Aminosäuren 1-332 aus FIG. 1 mpl-Ligand 1-199 Aminosäuren 1-199 aus FIG. 1 mpl-Ligand 1-191 Aminosäuren 1-191 aus FIG. 1 mpl-Ligand 1-183 Aminosäuren 1-183 aus FIG. 1 mpl-Ligand 1-174 Aminosäuren 1-174 aus FIG. 1 mpl-Ligand 1-163 Aminosäuren 1-163 aus FIG. 1
mpl-Ligand 1-153 Aminosäuren 1-153 aus FIG. 1 mpl-Ligand 1-152 Aminosäuren 1-152 aus FIG. 1 mpl-Ligand 1-151 Aminosäuren 1-151 aus FIG. 1 mpl-Ligand 7-332 Aminosäuren 7-332 aus FIG. 1 mpl-Ligand 7-191 Aminosäuren 7-191 aus FIG. 1 mpl-Ligand 7-199 Aminosäuren 7-199 aus FIG. 1 mpl-Ligand 7-183 Aminosäuren 7-183 aus FIG. 1 mpl-Ligand 7-174 Aminosäuren 7-174 aus FIG. 1 mpl-Ligand 7-163 Aminosäuren 7-163 aus FIG. 1 mpl-Ligand 7-153 Aminosäuren 7-153 aus FIG. 1 mpl-Ligand 7-152 Aminosäuren 7-152 aus FIG. 1 mpl-Ligand 7-151 Aminosäuren 7-151 aus FIG. 1

Es sollte beispielsweise beachtet werden, dass die mpl-Liganden 1-183, 1-191, 7-183 und 7-191 eine oder zwei zusätzliche natürlich vorkommende Glykosylierungsstellen an deren C-Terminus im Vergleich zu kürzeren Sequenzen aufweisen. In jedem der oben genannten Fälle kann weiterhin Met-Lys in den N-Terminus eingeschlossen sein.

Die spezifischen in vitro-Aktivitäten, auf die hier Bezug genommen wird, sind Messungen von relativen spezifischen in vitro-Aktivitäten, und sie sind keine Messungen von absoluten spezifischen in vitro-Aktivitäten. Zum Zweck dieser Anmeldung werden die spezifischen Aktivitäten nur verwendet, um die relativen Aktivitäten von mpl-Ligandenanaloga zu vergleichen, die unter Verwendung desselben Tests und unter Verwendung derselben Bedingungen, einschließlich demselben internen Standard, getestet worden sind, und welche dieselbe Analyse der Daten aufweisen, die verwendet wurden, um die spezifische Aktivität zu berechnen, etc.

Wie hier verwendet, beziehen sich die Ausdrücke „Analogon vom mpl-Liganden" oder „mpl-Ligandenanalogon" auf einen mpl-Liganden mit einer oder mehreren Änderungen in der Aminosäuresequenz vom mpl-Liganden, die zu einer Änderung in der Art (N- oder O-verknüpft, was die Menge an angefügtem Kohlenhydrat beeinflussen kann), Anzahl oder dem Ort von Stellen für das Anfügen von Kohlenhydraten führt. In einer bevorzugten Ausführung führt die Änderung der Glykosylierungsstelle(n) zu einer Änderung der Anzahl der Glykosylketten, die an das mpl-Ligandenmolekül angefügt sind. In einer besonders bevorzugten Ausführung fügt die Änderung in der Glykosylierungsstelle bzw. den Glykosylierungsstellen mindestens eine (im Allgemeinen 1-6, vorzugsweise 1-5, besonders bevorzugt 2-4) Glykosylketten hinzu, und am stärksten bevorzugt wird die Kette bzw. werden die Ketten durch eine N-Bindung hinzugefügt. In einer anderen besonders bevorzugten Ausführung behält das mpl-Ligandenanalogon mindestens äquivalente biologische Aktivität in vivo im Vergleich zu dem mpl-Liganden mit natürlicher Sequenz (z.B. menschlicher mpl-Ligand) bei und kann eine wesentlich höhere Aktivität in vivo besitzen, wie in Tests zur biologischen Aktivität gemessen wurde. Derartige Tests schließen solche ein, die eine Produktion von Megakaryozyten oder Blutplättchen detektieren.

Um derartige Analoga vom mpl-Liganden herzustellen, werden sie vorzugsweise durch ortsgerichtete Mutagenese, die zu Additionen, Deletionen oder Substitutionen von Aminosäureresten führen, die Stellen, die für eine Glykosylierung verfügbar sind, hinzufügen, eliminieren oder verändern, erzeugt. „Verändert" bedeutet, dass eine Stelle deletiert worden ist, während eine andere an demselben oder einem anderen Ort wie die deletierte Stelle hinzugefügt worden ist. Allerdings wird durch diejenigen, die auf dem Fachgebiet sachkundig sind, anerkannt werden, dass andere Verfahren zu einem Gen führen könnten, welches dieselbe Aminosäuresequenz kodiert, und derartige Verfahren sind hier umfasst. Die sich ergebenden Analoga können weniger oder mehr (vorzugsweise mehr) angefügte Kohlenhydratketten als der natürliche menschliche oder rekombinante mpl-Ligand aufweisen.

Eine Addition von einer oder mehreren Kohlenhydrat-(d.h. Glykosyl-) Ketten an dem mpl-Liganden ist ein wichtiger Gegenstand dieser Erfindung. mpl-Ligandenanaloga mit mehr Kohlenhydratketten als denen, die in der entsprechenden natürlich vorkommenden Aminosäuresequenz (z.B. 1-332 oder 1-174 etc.) gefunden werden, werden durch Hinzufügen von Glykosylierungsstellen, welche die sekundäre oder tertiäre Konformation nicht auf eine Weise stören, welche die biologische Aktivität wesentlich reduziert, erzeugt. Wie hier verwendet, bezieht sich der Begriff „natürlich vorkommender" mpl-Ligand auf eine Aminosäuresequenz, welche die entsprechende Anzahl an Aminosäuren wie das relevante Analogon aufweist, selbst wenn die jeweilige Länge der mpl-Ligandenspezies in der nativen Spezies nicht tatsächlich exprimiert wird. Vorteilhafterweise weist das Analogon des mpl-Liganden bis zu sechs zusätzliche Stellen für eine N-Glykosylierung oder O-Glykosylierung auf, was zu einer Addition von 1 bis zu 6 zusätzlichen N-verknüpften oder O-verknüpften Kohlenhydratketten (oder eine Kombination davon) führt.

Beispielsweise wird ein Pro in Position 30 durch ein Asn ersetzt, und ein Val in Position 32 wird durch ein Thr ersetzt, um die Sequenz Asn-Glu-Thr zu ergeben, welche als eine neue Stelle zur N-Glykosylierung (Analogon N4 unten; siehe Tabelle 1) dient.

Es können auch Analoga konstruiert werden, die zwei oder mehrere zusätzliche N-verknüpfte Ketten durch Kombinieren von Mutationen aufweisen; beispielsweise können die Analoga N4 und N10, die in Tabelle 1 beschrieben werden, kombiniert werden, um ein Analogon mit zwei zusätzlichen Stellen zur Kohlenhydrat-Addition zu liefern (d.h. Analogon N15 in Tabelle 1). Auf eine ähnliche Weise können Analoga mit 3 oder mehr hinzugefügten Ketten konstruiert werden. Wie durch diejenigen, die auf dem Fachgebiet sachkundig sind, anerkannt werden wird, schließt der Gegenstand der Erfindung viele andere Analoga vom mpl-Liganden mit verschiedenen Stellen zur Glykosylierung (in Bezug auf Anzahl, Art oder Ort der Stelle) ein. Die mpl-Ligandenanaloga dieser Erfindung sind in jedem Fall besonders zu bevorzugen auf der Grundlage eines mpl-Liganden mit einer menschlichen Aminosäuresequenz (siehe 1 und 2); allerdings werden Analoga, die auf mpl-Ligandensequenzen von anderen Spezies, (z.B. Hund, Schwein, Affe, Maus oder Ratte) beruhen, hier ebenfalls in Betracht gezogen.

Insertionen von Aminosäuren, um Glykosylierungsstellen zu erzeugen, werden ebenfalls in Betracht gezogen. Beispielsweise wird ein Glu in Position 57 durch ein Thr ersetzt, und Asn wird unmittelbar nach Met in Position 55 eingefügt, wie folgt:

Dies fügt eine neue Glykosylierungsstelle (Aminosäuren 55', 56 und 57) hinzu. Siehe Analogon N23 unten.

Ebenfalls von den Analoga dieser Erfindung umfasst sind Analoga, die eine oder mehrere Aminosäuren aufweisen, die sich vom carboxylterminalen Ende des mpl-Liganden erstrecken, wobei die carboxylterminale Extension mindestens eine zusätzliche Kohlenhydratstelle verfügbar macht. Der Carboxylterminus des mpl-Liganden wird in Abhängigkeit von der spezifischen Form des verwendeten mpl-Liganden (z.B. mpl-Ligand 1-332 Aminosäuren oder mpl-Ligand 1-163 Aminosäuren) variieren. Eine zusätzliche Kohlenhydratstelle kann zum Carboxylterminus einer mpl-Ligandenspezies hinzugefügt werden, indem man Aminosäuren an den Carboxylterminus anfügt, wobei solche Aminosäuren eine oder mehrere N- oder O-verknüpfte Glykosylierungsstellen enthalten.

Die Tabellen 1 und 6 listen einige beispielhafte mpl-Ligandenanaloga auf, welche zusätzliche Stellen für N-verknüpfte Kohlenhydratketten aufweisen. Die Analoga haben die Sequenz Asn-X-Ser oder Asn-X-Thr an verschiedenen Positionen in der menschlichen mpl-Liganden-Polypeptidkette, die auf den menschlichen Aminosäuresequenzen beruht, um N-verknüpfte Stellen zu erzeugen, eingeschlossen. Die Tabellen 4 und 7 listen diejenigen Analoga auf, die mindestens eine zusätzliche N-verknüpfte Kohlenhydratkette hinzufügen, was durch die Wanderung des Glykoproteins in SDS-Gel nachgewiesen wird (siehe Beispiel 6 und 3, 5, 6, 7, 9, 10, 12 und 13). Man beachte, dass diese Tabellen auch einige trunkierte Spezies einschließen, die keine „Analoga", wie hier definiert, sind (d.h. N1, N16, N17 und N31). Diese werden in den Tabellen aufgelistet, um zu zeigen, wie verschiedene trunkierte Spezies hergestellt wurden.

Ebenso umfasst von der vorliegenden Erfindung sind DNA-Sequenzen, die die mpl-Ligandenanaloga, die hier offenbart werden, kodieren, vorzugsweise diejenigen Sequenzen, die Analoga kodieren, die zusätzliche Stellen für N-verknüpfte Ketten aufweisen. Verfahren, die verwendet werden, um Änderungen in der mpl-Liganden-DNA-Sequenz herbeizuführen mit dem Ziel, Anfügungsstellen für Kohlenhydrate zu erzeugen, zu deletieren und/oder zu ändern, werden in den Beispielen 4 und 14 offenbart.

Diese mpl-Ligandenanaloga können das Produkt einer Expression einer exogenen DNA-Sequenz sein, d.h. sie können durch rekombinante DNA-Technologie hergestellt worden sein, sie können chemisch synthetisierte Produkte sein oder sie können durch eine Kombination aus verschiedenen Verfahren hergestellt worden sein. Eine exogene DNA-Sequenz umfasst cDNA, genomische DNA oder chemisch synthetisierte DNA, die ein mpl-Ligandenanalogon kodiert. Es werden auch rekombinante DNA-Plasmide und eukaryotische Wirtszellen, die für die Expression solcher Analoga nützlich sind, verfügbar gemacht.

Expressionsvektoren schließen jeden Vektor ein, der in der Lage ist, klonierte DNA-Sequenzen in einer eukaryotischen Wirtszelle zu exprimieren, insbesondere schließen sie jene Vektoren ein, die für die Expression in COS- und CHO-Zellen verwendet werden. Beispiele für solche Vektoren schließen die Plasmide pDSR&agr; und pDSR&agr;2 ein, siehe Mol. Cell. Biol. 8: 466–472 (1988); WO 91/13160 (1991); und WO 90/14363 (1990). Die Kultivierung von COS- und CHO-Wirtszellen, die mpl-Ligandenanaloga exprimieren, wurde unter Verwendung von Standardverfahren durchgeführt, die denjenigen die auf dem Fachgebiet sachkundig sind, bekannt sind.

Das Ändern der Anzahl, der Art, des Ortes oder der Menge an Kohlenhydratketten, die an den mpl-Liganden angefügt sind, kann vorteilhafte Eigenschaften verleihen, wie z.B. eine erhöhte Löslichkeit, höhere Resistenz gegenüber Proteolyse, geringere Immunogenität, erhöhte Halbwertszeit im Serum und erhöhte oder geänderte biologischen Aktivität.

Konditionierte Medien von COS-Zellen, welche die mpl-Ligandenanaloga N2–N15 exprimieren (N1 ist der menschliche mpl-Ligand 1-174; siehe 2) wurden auf ihre biologische Aktivität in vitro hin untersucht und die Ergebnisse werden in Tabelle 4 gezeigt.

Konditionierte Medien von COS-Zellen, welche die mpl-Ligandenanaloga/Trunkierungen N15–N40 exprimieren, wurden auf ihre biologische Aktivität in vitro hin untersucht und die Ergebnisse werden in Tabelle 7 gezeigt.

Die Ergebnisse der biologischen Aktivität in vivo für verschiedene Formen werden in 11 gezeigt (siehe Beispiel 13).

Eine andere Ausführung der Erfindung bezieht sich auf Wirtszellen von Säugetieren (z.B. vom Ovar des chinesischen Hamsters, CHO), die vorzugsweise mpl-Liganden oder Analoga von mpl-Liganden synthetisieren, die mehr als eine spezifischen Anzahl von Sialinsäuren pro Molekül aufweisen, z.B. mehr als die, die in den mpl-Liganden 1-332, 1-199, 1-191, 1-183, 1-174, 1-163, 1-153, 1-152 oder 1-151 gefunden werden, die natürlich oder rekombinant in einer eukaryotischen Zelle hergestellt werden. Die in vitro-Aktivitäten der Analoga N4 und N15, zusammen mit Volllänge- und trunkierten Spezies, die in CHO-Zellen exprimiert werden, werden in Tabelle 5 gezeigt.

Der Sialinsäuregehalt der mpl-Ligandenmoleküle kann einen Einfluss auf seine biologische Aktivität in vivo haben. Beispielsweise machen tetraantennäre (vierfach verzweigte) N-verknüpfte Oligosaccharide gewöhnlich vier mögliche Stellen für eine Anfügung von Sialinsäure verfügbar, während bi- und triantennäre Oligosaccharide, welche die tetraantennäre Form bei Asparagin-verknüpften Stellen substituieren können, gewöhnlich bestenfalls nur zwei oder drei Sialinsäuren anfügen. O-verknüpfte Oligosaccharide machen gewöhnlich zwei Stellen zur Anfügung von Sialinsäure verfügbar. Deshalb können mpl-Ligandenmoleküle, bei denen N-verknüpftes Kohlenhydrat durch O-verknüpftes Kohlenhydrat substituiert ist, zwei zusätzliche Sialinsäuren pro Kette aufnehmen, vorausgesetzt, die N-verknüpften Oligosaccharide sind tetraantennär. Säugetierzellkulturen werden auf solche Zellen hin überprüft, die vorzugsweise tetraantennäre Ketten an rekombinante mpl-Liganden anzufügen, wodurch die Anzahl der Stellen zur Anheftung von Sialinsäure maximiert wird.

Dihydrofolatreduktase (DHFR)-defiziente chinesische Hamsterovarzellen (CHO) werden gewöhnlich als Wirtszellen für die Herstellung von rekombinanten Glykoproteinen, einschließlich rekombinantem mpl-Liganden, verwendet.

Zusammensetzungen, die eine therapeutisch wirksame Menge eines mpl-Ligandenanalogon in Übereinstimmung damit zusammen mit einem geeigneten Verdünnungsmittel, einem Adjuvanz und/oder einem Träger umfassen, die bei der mpl-Ligandentherapie nützlich sind, sind von dieser Erfindung weiter umfasst. Eine „therapeutisch wirksame Menge", wie hier verwendet, bezieht sich auf diejenige Menge, die eine therapeutische Wirkung für einen vorgegebenen Zustand und ein Verabreichungsschema verfügbar macht.

Die vorliegende Zusammensetzung kann systemisch parenteral verabreicht werden. Alternativ dazu können die Zusammensetzungen intravenös oder subkutan verabreicht werden. Wenn sie systemisch verabreicht werden, können die therapeutischen Zusammensetzungen für die Verwendung in dieser Erfindung in Form einer pyrogenfreien, parenteral akzeptablen wässrigen Lösung vorliegen. Die Zubereitung von solchen pharmazeutisch akzeptablen Proteinlösungen bei genauer Beachtung des pH-Werts, der Isotonie, der Stabilität und dergleichem, liegt im Bereich des Könnens des Fachmanns. Der spezifische Weg, der eingeschlagen wird, wird von dem zu behandelnden Zustand abhängen. Die Verabreichung eines mpl-Liganden oder von mpl-Ligandenanaloga wird vorzugsweise als Teil einer Formulierung vorgenommen, die einen geeigneten Träger, wie z.B. menschliches Serumalbumin, ein geeignetes Verdünnungsmittel, wie z.B. gepufferte Salzlösung und/oder ein geeignetes Adjuvanz enthält. Die erforderliche Dosierung wird in Mengen vorhanden sein, die ausreichen, um den Blutplättchenspiegel von Patienten anzuheben und sie wird unterschiedlich sein, je nach der Schwere des Zustands, der behandelt wird, der Methode der Verabreichung, die verwendet wird und dergleichen.

Die Zustände, die durch die Verfahren und durch die Zusammensetzungen der vorliegenden Erfindung behandelt werden sollen, sind im Allgemeinen diejenigen, die einen existierenden Mangel an Megakaryozyten/Blutplättchen oder einen in der Zukunft zu erwartenden Mangel an Megakaryozyten/Blutplättchen umfassen (z.B. wegen einer geplanten Operation). Solche Zustände werden gewöhnlich das Ergebnis eines Mangels (zeitlich begrenzt oder andauernd) von aktivem mpl-Liganden in vivo sein. Der Oberbegriff für einen Mangel an Blutplättchen ist Thrombozytopenie und deshalb sind die Verfahren und Zusammensetzungen der vorliegenden Erfindung im Allgemeinen für die Behandlung von Thrombozytopenie verfügbar.

Eine Thrombozytopenie (Mangel an Blutplättchen) kann aus verschiedenen Gründen, einschließlich Chemotherapie, Knochenmarkstransplantationen und anderer Therapien mit einer Vielzahl an Medikamenten, Strahlentherapie, Operationen, eines durch einen Unfall verursachten Blutverlusts und anderer spezifischer Krankheitszustände vorliegen. Beispiele für spezifische Krankheitszustände, die eine Thrombozytopenie umfassen und die in Übereinstimmung mit dieser Erfindung behandelt werden können, sind: aplastische Anämie, idiopathische Thrombozytopenie, metastasierende Tumoren, die zu einer Thrombozytopenie führen, systemischer Lupus erythematosus, Splenomegalie, Franconi-Syndrom, Vitamin-B12-Mangel, Folsäuremangel, May-Hegglin-Anomalie, Wiskott-Aldrich-Syndrom und anfallsartige nächtliche Hämoglobinurie. Ebenso führen einige Behandlungen von AIDS zu Thrombozytopenie (z.B. AZT). Einige Störungen bei der Wundheilung könnten ebenso von einem Anstieg der Zahl der Blutplättchen profitieren.

Im Hinblick auf erwartete Mängel an Blutplättchen, z.B. wegen einer bevorstehenden Operation oder wegen einer bevorstehenden Therapie, die zu einer Thrombozytopenie führt, könnte ein mpl-Ligandenanalogon der vorliegenden Erfindung einige Tage bis einige Stunden vor dem Bedarf an Blutplättchen verabreicht werden. Im Hinblick auf akute Situationen, z.B. ein durch einen Unfall verursachter oder ein massiver Blutverlust, könnte ein mpl-Ligandenanalogon zusammen mit Blut oder gereinigten Blutplättchen verabreicht werden.

Das Dosierungsschema, das ein Verfahren zur Behandlung der oben beschriebenen Zustände umfasst, wird vom behandelnden Arzt bestimmt, der verschiedene Faktoren in Betracht zieht, die die Wirkung von Arzneimitteln beeinflussen, wie z.B. Alter, Zustand, Körpergewicht, Geschlecht und Ernährung des Patienten, die Schwere von irgendeiner Infektion, die Zeit der Verabreichung und andere klinische Faktoren. Im Allgemeinen sollte die tägliche Medikation in einem Bereich von 0,01–1000 &mgr;g mpl-Ligandenanalogon pro Kilogramm Körpergewicht, vorzugsweise 0,1–10 &mgr;g pro Kilogramm Körpergewicht liegen.

Die therapeutischen Verfahren, Zusammensetzungen und Polypeptide der vorliegenden Erfindung können alleine oder in Kombination mit anderen Zytokinen, löslichem mpl (z.B. mpl-Ligand)-Rezeptor, hämatopoetischen Faktoren, Interleukinen, Wachstumsfaktoren und Antikörpern auch bei der Behandlung von Krankheitszuständen, die durch andere Symptome, ebenso wie durch einen Mangel an Blutplättchen charakterisiert sind, verwendet werden. Es wird erwartet, dass ein mpl-Ligandanalogonmolekül sich bei der Behandlung einiger Formen von Thrombozytopenie in Kombination mit allgemeinen Stimulatoren der Hämatopoese, wie z.B. IL-3 oder GM-CSF, als nützlich erweisen wird. Andere stimulatorische Faktoren für Megakaryozyten, d.h. meg-CSF, Stammzellfaktor (stem cell factor, SCF), Leukämie-Hemmfaktor (leukemia inhibitory factor, LIF), Oncostatin M (OSM) oder andere Moleküle mit stimulierender Aktivität für Megakaryozyten können ebenso mit mpl-Liganden eingesetzt werden. Zusätzliche Beispiele für Zytokine oder hämatopoetische Faktoren für solch eine gemeinsame Verabreichung schließen IL-1 alpha, IL-1 beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-11, koloniestimulierender Faktor-1 (colony stimulating factor-1, CSF-1), GM-CSF, granulozytenkoloniestimulierender Faktor (granulocyte colony stimulating factor, G-CSF), EPO, Interpheron-alpha (IFN-alpha), IFN-beta oder IFN-gamma ein. Es könnte weiter nützlich sein, eine wirksame Menge eines löslichen Säugetier-mpl-Rezeptors entweder gleichzeitig oder in Folge zu verabreichen, was zu bewirken scheint, dass Megakaryozyten veranlasst werden, sich in Blutplättchen zu fragmentieren, sobald die Megakaryozyten ihre reife Form erreicht haben. Deshalb erwartet man, dass die Verabreichung eines mpl-Ligandenanalogons (um die Anzahl der reifen Megakaryozyten zu erhöhen), gefolgt von der Verabreichung eines löslichen mpl-Rezeptors (um das Analogon zu inaktivieren und es dem reifen Megakaryozyten zu ermöglichen, Blutplättchen zu erzeugen), ein besonders wirksames Mittel ist, die Produktion von Blutplättchen zu stimulieren. Die Dosierung, die oben genannt wurde, würde angepasst werden, um solche zusätzlichen Bestandteile in der therapeutischen Zusammensetzung zu kompensieren. Ein Fortschritt des behandelten Patienten kann mit herkömmlichen Verfahren überwacht werden.

Zusätzliche Modifikationen der Analoga dieser Erfindung können auch ausgeführt werden, um z.B. die Aktivität, die Stabilität, die Halbwertszeit etc. zu erhöhen. Es könnte z.B. eine Pegylierung (poly- oder mono-) an das mpl-Ligandenanalogon über Aminogruppen an dem Protein oder über Kohlenhydratgruppen angefügt werden. Es könnten ebenso Fettsäuren oder andere Polymere an das Protein oder die Kohlenhydratgruppe angefügt werden.

Die folgenden Beispiele sollen die Erfindung besser veranschaulichen, sollen sie jedoch nicht in ihrem Umfang einschränken. Der mpl-Liganden-Standard, der in den Biotest in den Beispielen verwendet wurde, ist ein rekombinanter mpl-Liganden-Standard, der in E. coli exprimiert, in eine aktive Konformation gefaltet und gereinigt worden war. Deshalb werden nur relative spezifische Aktivitäten gemessen.

BEISPIEL 1 Konstruktion vom mpl-Liganden 1-174

Ein menschliches mpl-Liganden-Gen, das die Aminosäuren 1-174 (beginnend mit S-P-A-P-P-A...) aus 2 kodiert, wurde aus einer menschlichen fötalen Leber-cDNA-Bibliothek (Barley et al., Cell 77: 1117–1124 (1994) durch PCR (polymerase chain reaction) gewonnen. Der 5'-PCR-Primer kodierte den Aminoterminus des menschlichen mpl-Liganden, eine XbaI-Stelle und eine optimierte Kozak-Sequenz. Der 3'-Primer enthielt ein Stoppkodon und eine SalI-Restriktionsstelle. Das amplifizierte DNA-Fragment wurde mit XbaI und SalI verdaut, dann in mit XbaI und SalI verdautes pDSR&agr;2 ligiert. Das sich ergebende Plasmid, pDSR&agr;2-mpl-Ligand 1-174, wurde zur Expression in Säugetierzellen verwendet. Die Sequenz des daraus hervorgehenden Gens (einschließlich des Signalpeptids) wird in 2 gezeigt.

Plasmid-DNA, die mpl-Ligand 1-174 enthielt, wurde mit den Restriktionsenzymen XbaI und SalI verdaut, die sich ergebenden DNA-Fragmente wurden einer Agarosegelelektrophorese unterzogen und das 605 nt mpl-Liganden 1-174-DNA-Fragment wurde unter Verwendung eines GeneCleanTM-Kits und von Verfahren, die durch den Hersteller (BIO 101, Inc.) bereit gestellt wurden, aus dem Gel isoliert. Das Plasmid pDSR&agr;2, wie in WO 90/14363 (1990) beschrieben, wurde auch mit den Restriktionsenzymen XbaI und SalI verdaut und das Vektorfragment wurde zurückgewonnen. Die Ligation der beiden Fragmente führt zu pDSR&agr;2 (mpl-Ligand 1-174).

BEISPIEL 2 Expression von mpl-Liganden 1-174 in CHO-Zellen und Reinigung

Dihydrofolatreduktase-defiziente (DHFR) Zellen aus dem Ovar des chinesischen Hamsters (CHO) wurden mit pDSR&agr;2-mpl-Ligand 1-174 transfiziert. Eine 100 mm-Gewebekulturschale wurde mit 1 × 106 CHO-DHFR-Zellen in CHO-D-Medium (DMEM, 10% fötales Rinderserum, 1% Penicillin/Streptomycin/Glutamin, 1% nicht essentielle Aminosäuren (Gibco) und 1% HT-Ersatz (Gibco)) am Tag vor der Transfektion ausplattiert. Vier Transfektionen wurden durchgeführt. Bei jeder Transfektion wurde Plasmid-DNA (50 &mgr;g) durch Verdauung mit Pvu I und Puffer H (Boehringer Mannheim) linearisiert. Dann wurde ein DNA-Präzipitat gebildet und tröpfchenweise mit dem Säugetier-Zell-Transfektionskit („Mammalian Cell Transfection Kit") (Speciality Media) zu den Platten hinzugegeben. Nach 24 Stunden in einem Gewebekulturinkubator wurde das Medium durch ein frisches CHO-D-Medium ersetzt. 24 Stunden später wurden die Zellen in 96-Well-Gewebekulturplatten mit 100 &mgr;l CHO-Selektionsmedium (D-MEM, 5% dialysiertes fötales Rinderserum, 1% Penicillin/Streptomycin/Glutamin, 1 % nicht essentielle Aminosäuren (Gibco)) pro Well aufgeteilt, und es wurden Transformanten ausgewählt. Das Medium wurde wöchentlich gewechselt bis Kolonien zu sehen waren. Nach zwei Wochen wurde die mpl-Liganden-Expression durchgemustert, um die Transformanten in dem 32D-Zell-Proliferations-Test, wie unten beschrieben (siehe Beispiel 9), zu verwenden. Diese Klone, die im Übermaß 1 × 105 Units/ml exprimierten, wurden expandiert und zur kryogenen Lagerung eingefroren. Ein Klon wurde zur Rollflaschen-Produktion expandiert, und es wurden ungefähr acht Liter eines konditionierten Mediums produziert.

Plasmid pDSR&agr;2, welches mpl-Liganden-1-174-cDNA enthielt, wurde in DHFR-defiziente CHO-Zellen wie oben beschrieben transfiziert. Zwei Liter eines serumfreien CHO-konditionierten Mediums (50% D-MEM, 50% HAMS-F12, 1% Penicillin/Streptomycin/Glutamin, 1% nicht essentielle Aminosäuren (Gibco)) aus Rollflaschen, in dem CHO-Zellen ausgesät worden waren, die mpl-Liganden 1-174 exprimieren, wurden unter Verwendung einer 21-Rührzelle von Amicon, Model 2000 und einer Membran mit einem Molekulargewichtsausschluss von 10000 Dalton (YM10, Amicon) 15-fach konzentriert. 45 ml des konzentrierten konditionierten Mediums wurden dann direkt auf eine 4 ml-hu-MPL-X-Affinitätssäule mit einer Flussrate von 0,4 ml/min unter Verwendung eines Pharmacia FPLC-Geräts geladen. Die Affinitätssäule wurde hergestellt, indem 1,5–2,5 mg Mpl-X (die lösliche extrazelluläre Domaine des mpl-Rezeptors) pro ml CNBr-aktiviertes Sepharoseharz von Pharmacia, wie vom Hersteller empfohlen, gekoppelt wurden. Nach dem Beladen wurde die Säule mit 16 ml phosphatgepufferter Salzlösung (PBS; 10 mM NaPO4 pH 6,8/150 mM NaCl) und dann mit 24 ml 10mM Tris, pH 8,0/1M NaCl gewaschen. Der mpl-Ligand (1-174) wurde mit 40 ml 20mM CAPS (3-[Cyclohexylamino]-1-propansulfonsäure) pH 10,5/1M NaCl/SmM CHAPS (3-[3-Cholamidoopropyl)dimethylammonio]-1-propansulfonat) in Fraktionen von 6 ml eluiert. Die zweite Fraktion ergab eine einzelne Bande auf einem 14%igen SDS-Gel. Dieses Material wurde konzentriert, der Puffer wurde durch eine Salzlösung aus 0,9% NaCl ausgetauscht, und das Material war in vitro und in vivo biologisch aktiv. Andere Arten von mpl-Liganden, die durch CHO-Zellen exprimiert wurden, wurden auf ähnliche Weise gereinigt.

BEISPIEL 3 Biologische Aktivität in vivo von rekombinanten menschlichen mpl-Liganden

Die Blutplättchenzahlen von Mäusen, die mit verschiedenen Arten von mpl-Liganden behandelt worden waren, wurden gemessen. Aus CHO-Zellen stammende mpl-Liganden 1-332, 1-174, 1-163 und 1-153 wurden hergestellt und durch mpl-Rezeptor-Affinitätschromatographie gereinigt. Aus E. coli stammender Met-Lys-mpl-Ligand 1-332, Met-Lys-mpl-Ligand 1-174, Met-Lys-mpl-Ligand 1-163 und Met-Lys-mpl-Ligand 1-153 wurde hergestellt und durch herkömmliche Chromatographie gereinigt.

4 zeigt Blutplättchenzahlen von Mäusen, die mit verschiedenen Arten von aus CHO-Zellen stammendem (durchgezogene Linie) oder aus E. coli stammendem (gestrichelte Linie) rekombinantem menschlichem mpl-Liganden behandelt wurden. Normalen weiblichen Balb/c-Mäusen wurde die angegebene Konzentration von mpl-Ligand an fünf aufeinanderfolgenden Tagen subkutan injiziert. Blutproben von einem kleinen seitlichen Schnitt in eine Schwanzvene wurden 24 Stunden nach der letzten Injektion gesammelt. Analysen der Blutzellen wurden mit einem elektronischen Sysmex-Blutzellenanalysator (Baxter Diagnostics, Inc. Irvine, CA) durchgeführt. Die Daten werden als Mittelwert von Bestimmungen von vier Tieren dargestellt, +/– Standardfehler des Mittelwerts. Andere Blutzellenparameter, wie z.B. die Gesamtzahl der weißen oder roten Blutzellen, waren von diesen Behandlungen nicht betroffen (Daten werden nicht gezeigt).

Die Ergebnisse zeigen, dass durch CHO-Zellen exprimierte Formen vom mpl-Liganden im Vergleich zu denselben Formen vom mpl-Liganden, die in E. coli hergestellt wurden, eine höhere in vivo-Aktivität besitzen. Wie in Beispiel 6 beschrieben, enthalten die durch CHO-Zellen exprimierten Formen von mpl-Liganden alle N- und/oder O-verknüpfte Kohlenhydrate, und die durch E. coli exprimierten Formen vom mpl-Liganden enthalten diese nicht. Dies zeigt, dass das Kohlenhydrat die in vivo-Aktiviät vom mpl-Liganden erhöht. Der Anstieg in der in vivo-Aktivität, der vom Kohlenhydrat verursacht wird, kann ein Ergebnis einer erhöhten zirkulatorischen Halbwertszeit, einer erhöhten Stabilität oder einer Kombination aus beidem sein.

BEISPIEL 4 Herstellung eines mpl-Ligandenanalogons N2–N15

Verfahren zum Erzeugen zusätzlicher Glykosylierungsstellen beim mpl-Liganden werden unten beschrieben.

Die folgenden Oligonukleotidprimer wurden zur Verwendung in einer in vitro-Mutagenese synthetisiert, um die Analoga N2–N14 herzustellen (siehe Tabelle 1 bezüglich der Strukturen dieser Analoga):

N2- CCCATGTCAATCACAGCAGACT SEQ ID Nr.: 5

N3- CTTCACAGCAACCTGAGCCAGT SEQ ID Nr.: 6

N4- CAGTGCAACGAGACCCACCCTTTG SEQ ID Nr.: 7

N5- GCCTACAAATGTCACGCTGCCTGCT SEQ ID Nr.: 8

N6- CCCACTTGTAACTCATCCCTC SEQ ID Nr.: 9

N7- CAACTGAACGCCACTTGTCTCTCA SEQ ID Nr.: 10

N8- ACTTGTCTCAACTCCACCCTGGGGGA SEQ ID Nr.: 11

N9- CTCCTGGGGAACCTTTCTGGA SEQ ID Nr.: 12

N10- GACCACAAATCACACCGATCCCAAT SEQ ID Nr.: 13

N11- ACCCTTTGTCTACAAATGTCACGCTGCCTGCT SEQ ID Nr.: 14

N12- TCTCTCAAACCTCACGGGGGAGCTT SEQ ID Nr.: 15

N13- TGGAAAAATCAGACGGAGGAGAC SEQ ID Nr.: 16

N14- TGGAGGAGAACAAGACACAGGACAT SEQ ID Nr.: 17

Um den m13mp18-mpl-Liganden 1-174 zu konstruieren, wurde das Gen aus 2 in mit den Restriktionsenzymen XbaI und SalI verdaute m13mp18-DNA eingeführt. Einzelsträngige DNA wurde aus Überständen vom E. coli-Stamm RZ1032, der durch m13mp18 (mpl-Ligand 1-174) infiziert worden war, wiedergewonnen, wie bei Kunkel et al., Methods in Enzymol. 154:367 (1987) und Messing, Methods in Enzymol. 101:20 (1983) beschrieben. Für die in vitro-Mutagenese wurden ungefähr 0,5 &mgr;g einzelsträngige DNA und 0,125 pMol von einem der synthetischen Primer, die oben beschrieben wurden, mit 6 &mgr;l Puffer (250 mM Tris pH 7,8, 50 mM MgCl2, 50 mM Dithiothreitol und 1% Rinderserumalbumin (BSA-Pharmacia)) gemischt. Die Primer wurden mit ATP und T4-Polynukleotidkinase vor der Zugabe behandelt. Zum Annealing der Primer an die Matrize wurde das Reaktionsvolumen auf 10 &mgr;l mit Wasser eingestellt, die Mischung wurde auf 65°C 5 Minuten lang erhitzt und dann auf Raumtemperatur abkühlen lassen. Für die Verlängerungsreaktion (Elongation) wurden jeweils 2,5 &mgr;l dTTP, dATP, dGTP und dCTP und 1 ml ATP (alle in einer Konzentration von 10 &mgr;M) hinzugegeben, gefolgt von 1 &mgr;l (1 Unit) E. coli DNA-Polymerase (Klenow-Fragment) und 1 &mgr;l (1 Unit) T4-DNA-Ligase. Die Mischung wurde dann über Nacht bei 14°C inkubiert und verwendet, um E. coli JM 109 (Yanisch-Perron et al. Gene 33, 103 (1985)) wie beschrieben (Messing, supra) zu transformieren.

Um Mutantenklone durch differentielle Hybridisierung zu identifizieren, wurden Plaques auf Nähragar auf Gene-Screen-Filter (New England Nuclear) übertragen. Die DNA wurde an den Filtern quervernetzt, indem sie mit einem „UV Stratalinker" Modell 1800 unter Verwendung des Modus „auto cross-link" (Stratagene) bestrahlt wurde. Sie wurden dann eine Stunde in 6 × SSC (0,9 M NaCl/0,09 M Na-Zitrat), das 1% SDS enthielt, bei 60°C inkubiert. Für die Hybridisierung wurde der oben genannte Oligonukleotidprimer (8 pMole) mit T4-Polynukleotidkinase und &ggr;-32P-markiertem ATP am Ende markiert und mit den Filtern über Nacht in 6 × SSC, 0,5% SDS und 125 &mgr;g/ml Heringssperma-DNA inkubiert. Die Hybridisierungstemperaturen wurden nach Schätzungen von Oligonukleotidschmelzpunkten ausgewählt. Im Allgemeinen war die Hybridisierungstemperatur ungefähr 10°C geringer als der Schmelzpunkt. Am nächsten Tag wurden die Filter zweimal mit 6 × SSC/1% SDS bei Hybridisierungstemperatur gewaschen, gefolgt durch zwei Waschschritte mit 6 × SSC bei Hybridisierungstemperatur, und einer Autoradiographie unterzogen. Falls notwendig, wurden die Filter dann mit 6 × SSC bei zunehmenden Temperaturen gewaschen, bis wenig oder keine Hybridisierung bei Plaques mit der Wildtyp-mpl-Liganden-cDNA-Sequenz nachgewiesen wurde. Klone, die unter diesen Bedingungen positive Hybridisierungssignale ergaben, wurden identifiziert und wieder in JM 109 überführt, um einen reinen Klon zu isolieren. Die Sequenzanalyse durch die Didesoxykettenabbruchmethode gab an, dass die Mutationen vorhanden waren.

Doppelsträngige m13mpl-Liganden 1-174 DNAs, welche die gewünschten Änderungen trugen, wurden aus transfizierten JM109-Zellen mit QIAGEN Kits (Chatsworth CA.) unter Verwendung von Verfahren, die durch den Hersteller bereitgestellt wurden, wiedergewonnen. Die DNAs wurden mit XbaI und SalI verdaut, und die 605 bp großen mpl-Liganden-DNA-Fragmente wurden isoliert. pDSR&agr;2 wurde mit XbaI und SalI verdaut. Das Vektorfragment wurde isoliert und mit den oben genannten mpl-Ligandenfragmenten ligiert. Rekombinante Plasmide wurden durch Restriktionsanalyse identifiziert. Die daraus hervorgehenden Plasmide (bezeichnet als mpl-Ligand 1-174-NX, wobei NX die Nr. des Analogons ist) enthalten DNA, welche mpl-Ligandenanaloga mit veränderten Aminosäureresten in den angegebenen Positionen enthält. Die sich daraus ergebenden Plasmide wurden dann wieder sequenziert, um das Vorhandensein der gewünschten Mutationen zu bestätigen.

Das Analogon N15 wurde derart konstruiert, dass es zwei zusätzliche N-verknüpfte Glykosylierungsstellen in den Positionen 30 und 120 aufwies. Der pDSR&agr;2-mpl-Ligand 174-N4, der Mutationen in Asn30 und Thr32 enthielt, wurde mit den Restriktionsenzymen XbaI und PstI verdaut, und es wurde das ungefähr 385 nt DNA-Fragment isoliert. Der PDSR&agr;2-mpl-Ligand 174-N10, der Mutationen in Asn120 und Thr122 enthielt, wurde mit den Restriktionsenzymen PstI und SalI verdaut, und das ungefähr 220 nt DNA-Fragment wurde isoliert. pDSR&agr;2 wurde mit XbaI und SalI verdaut. Das Vektorfragment wurde isoliert und in die oben genannten mpl-Ligandenfragmente ligiert. Dies führte zum PDSR&agr;2-mpl-Liganden 174-N15, der Substitutionen in Asn30, Thr32, Asn120 und Thr122 enthält.

Diese allgemeinen Vorgehensweisen wurden verwendet, um die in Tabelle 1 gezeigten mpl-Ligandenanaloga zu konstruieren. Die DNA-Sequenzänderungen werden für jedes der Analoga gezeigt; ansonsten wiesen die zur Mutagenese verwendeten Oligonukleotid-Primer Sequenzen auf, die zu denen des menschlichen mpl-Liganden komplementär waren.

Anmerkung: Die Analoga N2–N15 werden hier synonym als Analoga 2–15 bezeichnet. Wie hier verwendet, bedeutet weiterhin beispielsweise [Asn22]-mpl-Ligand, dass ein Asparagin durch die Aminosäure in Position 22 in der besonderen mpl-Ligandenspezies, die berücksichtigt worden ist, substituiert wurde, die vorzugsweise eine menschliche Sequenz mit mindestens den Aminosäuren 7-151 in 1 darstellt (einschließlich der bevorzugten menschlichen mpl-Ligandensequenzen, die hier oben dargestellt wurden). Folglich ergibt eine Substitution eines Asparaginrests durch einen Lysinrest in Position 22 vom mpl-Liganden 1-174 (menschliche Sequenz) ein mpl-Ligandenanalogon, das durch den [Asn22]-mpl-Liganden 1-174 dargestellt werden kann.

Plasmide, die als pDSR&agr;2 1-174-NX (wobei NX die Nr. des Analogons ist) bezeichnet werden, wurden konstruiert, indem eine mpl-Liganden-DNA in pDSR&agr;2 eingeführt wurde. Der Expressionsvektor pDSR&agr;2 wird allgemein in WO 90/14363 (1990) beschrieben. pDSR&agr;2-mpl-Liganden 1-174-NX-Plasmide wurden durch Verdau von pDSR&agr;2 mit XbaI und SalI hergestellt. Das Vektorfragment wurde isoliert und mit den ungefähr 605 bp großen Fragmenten, welche die gewünschten Sequenzen enthielten, ligiert.

BEISPIEL 5 Expression vom mpl-Liganden und vom mpl-Liganden N1–N15 in COS-Zellen

cDNA-Klone vom menschlichen mpl-Liganden und von mpl-Ligandenanaloga, beschrieben in Tabelle 1, wurden in COS-1-Zellen (ATCC Nr. CRL-1650) durch Elektroporation transferiert. COS-1-Zellen wurden aus halbkonfluenten Petrischalen geerntet, mit Medium (Dulbecco's modifiziertes essentielles Medium mit 10% fötalem Rinderserum und 1 % L-Glutamin/Penicillin/Streptomycin, (Irvine Scientific)) resuspendiert und auf 6 × 106 Zellen/ml eingestellt. Ein halber ml der Zellen wurde in eine 0,2 cm-Elektroporationsküvette (Bio-Rad) übertragen und mit einem „BTX Elektroporation System Electrocell Manipulator 600" bei 650 &mgr;F und 130 Volt bei Einstellung einer Niedrigspannung mit 50 &mgr;g Plasmid-DNA, welche das mpl-Ligandenanalogon kodierte, elektroporiert. Die elektroporierten Zellen wurden auf 100 mm-Gewebekulturplatten in 10 ml Medium ausplattiert. 12 bis 24 Stunden nach dem Ausplattieren wurde das Medium durch 10 ml frisches Medium ersetzt. Das konditionierte Medium wurde drei bis fünf Tage nach Elektroporation gesammelt.

BEISPIEL 6 Charakterisierung vom mpl-Liganden und von mpl-Liganden N1–N15 A. Bestimmung von Kohlenhydrat-Additionen

Ein Volumenüberstand, der ungefähr 30 bis 60 ng mpl-Ligand oder mpl-Ligandenanalogon aus COS-Zellen, die mit mpl-Ligandenanalogon-cDNAs wie in Beispiel 5 beschrieben transfiziert waren, wurden über Nacht bei Raumtemperatur mit einem polyklonalen Kaninchen-anti-mpl-Liganden-Antikörper immunpräzipitiert. In einigen Fällen, in denen die Expression gering war, wurde ein maximales Volumen von ungefähr 8 bis 9 ml zur Immunpräzipitation verwendet. Der Antikörper wurde gegen mpl-Ligand 1-163 erzeugt, der in E. coli exprimiert und gereinigt wurde. 30 &mgr;l von 1:1 Protein A-Sepharose in phosphatgepufferter Salzlösung (phosphate bufferd saline, PBS), die 0,1% Natriumazid enthielt, wurde zu dem Immunpräzipitat gegeben, und der Ansatz wurde eine Stunde bei Raumtemperatur inkubiert. Die Proben wurden zentrifugiert, mit PBS gewaschen und in SDS-Probenpuffer (0,12 M Tris-HCl, pH 6,8/4% SDS/20% Glyzerin/10% &bgr;-Mercaptoethanol/0,001% Bromphenolblau) resuspendiert). Die Proben wurden durch 12% SDS-Polyacrylamidgelelekrophorese analysiert, auf Nitrocellulose übertragen und einer Analyse durch Western blot wie beschrieben (Burnette et al., Anal. Biochem. 112: 195–203 (1981); Elliott et al., Gene 79: 167–180 (1989)) unter Verwendung eines monoklonalen Maus-anti-mpl-Liganden-Antikörpers, der gegen ein synthetisches mpl-Ligandenpeptid (z.B. eines, das den Aminosäureresten 47 bis 62 in 1 entspricht) gerichtet war, unterzogen. Die den mpl-Liganden enthaltende Banden wurden unter Verwendung eines ECL-Kits (Amersham) sichtbar gemacht.

5 zeigt, dass COS-Zellüberstände von Zellen, die mit DNA der Analoga N4, N7 und N10 transfiziert waren, eine Größenzunahme im Vergleich zum mpl-Liganden 174 (N1) mit menschlicher Sequenz ergeben. 6 zeigt, dass COS-Zellüberstände von Zellen, die mit N13-, N14- und N4-DNA transfiziert waren, ebenfalls eine Größenzunahme im Vergleich zum mpl-Liganden mit menschlicher Sequenz aufwiesen. Diese Zunahme der Größe zeigt eine zusätzliche N-verknüpfte Kohlenhydratkette an. N15 enthält zwei zusätzliche N-verknüpfte Glykosylierungsstellen. 6 zeigt, dass dieses Analogon Material mit einer Größe aufweist, die größer ist als die von Analoga, die nur eine zusätzliche N-verknüpfte Glykosylierung enthalten. Die Größen der Proteine wurden aufgrund ihrer Mobilität in der SDS-PAGE im Verhältnis zu Proteinstandards von bekanntem Molekulargewicht abgeschätzt. Die abgeschätzten Größen der stärkeren Banden, die aus 6 berechnet wurden, werden in Tabelle 2 gezeigt. Dieses Ergebnis zeigt, dass N15 zwei zusätzliche N-verknüpfte Ketten enthält. Western blot-Analysen von anderen ausgewählten Analoga werden ebenfalls in 6 gezeigt.

Ein Experiment wurde durchgeführt, um zu zeigen, dass die Zunahme der Größe von mpl-Ligandenanaloga auf N-verknüpftes Kohlenhydrat zurückzuführen ist. COS- konditioniertes Zellmedium, das mpl-Ligand enthielt, wurde immunpräzipitiert und mit PBS wie oben beschrieben gewaschen. Jedem Röhrchen wurden dann 10 &mgr;l 0,5% SDS zugesetzt und jede Probe wurde 3 Minuten gekocht. Dann wurden die folgenden Bestandteile zugegeben: 10,8 &mgr;l 0,5 M NaPO4, pH 8,6, 5 ml 7,5% Nonidet P40 und 3 &mgr;l 250 Units/ml N-Glykanase (Genzyme). Die N-Glykanase-Behandlung entfernt N-verknüpftes Kohlenhydrat. Die Proben wurden 6 Stunden bei 37°C inkubiert. Die Reaktion wurde durch Zugabe von SDS-PAGE-Probenpuffer abgestoppt, und dann wurden die Proben einer SDS-PAGE (12% Acrylamid) und Westernblot-Analyse unter Verwendung eines monoklonalen anti-mpl-Liganden-Antikörpers und eines anti-Maus „ECL Western Detection Kit" (Amersham) wie oben beschrieben unterzogen. Eine Analyse von N-verknüpften Ketten unter Verwendung dieses Verfahrens wird in 7 für menschlichen mpl-Liganden und mpl-Ligandenanaloga gezeigt. Nach der Behandlung mit N-Glykanase war die Mobilität im Western blot bei N4, N7 und N10 reduziert auf die von N1. Wie erwartet, hatte eine Behandlung von N1 mit N-Glykanase keine Auswirkung auf die Mobiliät, da N1 keine N-verknüpften Glykosylierungstellen aufweist. Diese Ergebnisse zeigen, dass die beobachtete Zunahme der Größe auf die Addition von N-verknüpftem Kohlenhydrat zurückzuführen ist.

B. Analyse von O-verknüpftem Kohlenhydrat am mpl-Liganden

Um den Beitrag von O-verknüpftem Kohlenhydrat auf menschlichen mpl-Liganden zu analysieren, wurden verschiedene Formen des Proteins aus CHO-konditioniertem Zellmedium wie oben beschrieben gereinigt. Jede Form erhielt +/–-Behandlung mit O-Glykanase (Glykopeptid-alpha-N-acetylgalaktosaminidase, Oxford G1ycoSystems). Die O-Glykanase entfernt O-verknüpftes Kohlenhydrat aus Glykoproteinen. Die in E. coli exprimierte Version von jeder Form wurde als eine unglykosylierte Kontrolle verwendet. Um den Unterschied im Molekulargewicht, zu dem O-verknüpftes Kohlenhydrat beiträgt, aufzulösen, war es notwendig, zunächst jedes N-verknüpfte Kohlenhydrat zu entfernen. Da die Volllänge-Version, der mpl-Ligand 1-332, N-verknüpftes Kohlenhydrat enthält, erhielten die in CHO-Zellen exprimierten Volllänge-Proben eine N-Glykanase (Peptid-N4-(N-Acetyl-beta-glukosaminyl)asparaginamidase)-Behandlung, wie oben für in COS-Zellen exprimierten mpl-Ligandenanaloga beschrieben, abgesehen davon, dass die N-Glykanase-Behandlung mit einer Inkubation über Nacht verbunden war.

Bevor mit der O-Glykanase-Behandlung vom Volllänge (1-332)-mpl-Liganden fortgefahren wurde, wurde der pH-Bereich der Probe auf pH 6,0 bis pH 7,0 mit 1/15 Volumen 100 mM Essigsäure, pH 2,2 eingestellt. 1 &mgr;g Protein wurde durch 3 Minuten Kochen in SDS denaturiert und bei 37°C 60 Minuten mit 1 U/ml Neuraminidase (Sialidase, aus Arthrobacter urefaciens, Boehringer Mannheim) in 1 mM Calciumacetat, pH 6,8 und 20 mM Natriumphosphat, pH 6,8 inkubiert.

Eine anschließende Behandlung mit O-Glykanase wurde durchgeführt, indem 5 mU Enzym in einem Endvolumen von 100 &mgr;l zugesetzt wurden, gefolgt durch eine Inkubation über Nacht bei 37°C. Die Proteine (0,2 &mgr;g/Spur) wurden durch SDS-PAGE (15 % Acrylamid) aufgetrennt. Nach dem Transfer auf 0,2 &mgr;m Nitrocellulose und Inkubation über Nacht mit polyklonalem anti-mpl-Liganden-Antikörper wurden die mpl-Ligandenproteine unter Verwendung eines anti-Kaninchen „ECL Western Detection Kit" (Amersham) sichtbar gemacht.

3 zeigt einen Western blot von vier verschiedenen Formen von menschlichem mpl-Liganden. Der Volllänge-mpl-Ligand 1-332 wird in den Spuren 1 bis 3 dargestellt, mpl-Ligand 1-174 in den Spuren 4 bis 6, mpl-Ligand 1-163 in den Spuren 7 bis 9 und mpl-Ligand 1-153 in den Spuren 10 bis 12. Eine Behandlung mit Neuraminidase und O-Glykanase, gezeigt in den Spuren 2, 5, 8 und 11, reduzierte das Molekulargewicht auf das von unglykosyliertem Material, gezeigt in den Spuren 3, 6, 9 und 12. In jedem Fall nahm die Mobilität zu und erreichte diejenige der in E. coli exprimierten unglykosylierten Version. Diese Ergebnisse zeigen, dass die Banden von höherem Molekulargewicht in den Spuren 1, 4, 7 und 10 auf O-verknüpftes Kohlenhydrat zurückzuführen sind. Das Molekulargewicht, das jede der Banden repräsentierte, wurde abgeschätzt, indem die Mobilitäten der Proteine mit denen von Proteinen mit bekanntem Molekulargewicht verglichen wurden.

Wie Tabelle 3, die abgeschätzte Molekulargewichte von verschiedenen Proteinen zeigt, zu entnehmen ist, könnte die apparente Verschiebung der Mobilität für nicht weniger als 14 O-verknüpfte Kohlenhydratketten (unter der Annahme von 950 Da/Kette) beim mpl-Liganden 1-332, 9 Ketten beim mpl-Liganden 1-174, 4 Ketten beim mpl-Liganden 1-163 und 2 Ketten beim mpl-Liganden 1-153 verantwortlich sein. Die Probe, die in Spur 2 gelaufen ist, ist der Volllänge-mpl-Ligand 1-332. Es scheint so als ob dieses Protein abgebaut worden wäre, möglicherweise aufgrund einer ausgedehnten Inkubation in Glykoenzymen bei 37°C. Deshalb wurde die in E. coli exprimierte unglykosylierte Version in Spur 3 verwendet, um das ungefähre Molekulargewicht von O-verknüpftem Kohlenhydrat, das an den in CHO-Zellen exprimierten mpl-Liganden 1-332 angefügt war, zu berechnen.

Diese Ergebnisse stimmen mit dem Vorhandensein von Kohlenhydrat an allen in CHO-Zellen exprimierten Formen von getestetem mpl-Liganden überein. Das Vorhandensein von O-verknüpftem Kohlenhydrat wurde für die in CHO-Zellen exprimierten mpl-Liganden 1-332, 1-174 und 1-163 durch direkte Analyse der Monosaccharidzusammensetzung bestätigt. Durch Säurehydrolyse wurden Sialinsäure, GalNAC und Gal aus Glykoproteinen freigesetzt. Die Monosaccharide wurden durch Hochdruck-Anionenaustauschchromatographie und durch gepulste amperometrische Detektion nachgewiesen. Alle drei Zucker wurden in jeder der mpl-Liganden-Formen nachgewiesen. Dieses Ergebnis zeigt das Vorhandensein von O-verknüpftem Kohlenhydrat, das Sialinsäure enthält. Diese Daten korrelieren mit den in vivo-Daten, die 4 zu entnehmen sind, bei denen die in CHO-Zellen exprimierten Formen von mpl-Liganden alle in vivo aktiver waren als die entsprechenden in E. coli exprimierten Formen. Folglich verstärkt das Vorhandensein von Kohlenhydrat die in vivo-Aktivität vom mpl-Liganden.

BEISPIEL 7 mpl-Liganden-ELISA-Test

Herstellung von polyklonalen Antikörpern: Weiße Kaninchen der Rasse „Neuseeländer" wurden über einen Zeitraum von drei Monaten mit in E. coli produziertem rekombinantem menschlichem mpl-Liganden 1-163 hyperimmunisiert. Antiseren von sechs Kaninchen, die hohe Antikörpertiter aufwiesen, wurden vereinigt („gepoolt") und spezifische anti-mpl-Liganden-Antikörper wurden affinitätsgereinigt.

Affinitätsreinigung: Rekombinanter menschlicher mpl-Ligand 1-163 wurde kovalent an „Actigel-ALD" (Sterogene Bioseparations, Inc.) nach den Anleitungen des Herstellers angefügt.

Ein Aliquot der vereinigten Kaninchenantiseren wurde zu dem mpl-Liganden-Affinitätsgel gegeben und der Schlamm wurde vorsichtig auf einer Wippe über Nacht bei 4–8°C bewegt. Nicht gebundene Serumproteine wurden mit PBS aus den Gelbett gewaschen, und spezifisch gebundene anti-mpl-Liganden-Antikörper wurden dann mit „ImmunoPure Gentle Ag/Ab Elution Buffer" (Pierce Chemical Co.) eluiert. Die gewonnenen Antikörper wurden gegen PBS dialysiert, wobei der Puffer mehrfach gewechselt wurde, dann wurde die Antikörperlösung in einer Ultrafiltrationseinheit (Rührzelle von Amicon) konzentriert, und das sich ergebende Antikörperkonzentrat war die Quelle für spezifische anti-mpl-Liganden-Antikörper, die anschließend für die Beschichtung von Wells und Enzymkonjugatpräparationen verwendet wurden.

ELISA-Reagenzien: Streifen von „Immulon 4 Removawell" (Dynatech Laboratories, Inc.) wurden mit affinitätsgereinigten Kaninchen-anti-mpl-Liganden-Antikörpern beschichtet. Die affinitätsgereinigten Antikörper wurden in 0,1 M Natriumbicarbonat (frisch zubereitet mit einem pH-Wert um 8,2) verdünnt, um eine Konzentration von 2,5 &mgr;g/ml zu ergeben. Jedes Well erhielt 100 &mgr;l Antikörper, und die Platten wurden 24 Stunden bei Raumtemperatur in einer abgeschlossenen und befeuchteten Kammer inkubiert. Dann wurden 200 &mgr;l einer Blocking-Lösung, die aus 1% fötalem Rinderserum, 5% Succrose in TEN (50 mM Tris 7,4/10 mM EDTA/150 mM NaCl) bestand, zu jedem Well gegeben, und die Platten wurden weitere 24 Stunden bei Raumtemperatur in einer abgeschlossenen und befeuchteten Kammer inkubiert. Die zusammengemischten Beschichtungs- und Blocking-Lösungen wurden aus den Wells entfernt. Es wurde ein zusätzlicher Überschichtungs-Blocking-Schritt einbezogen: 300 &mgr;l „Superblock Blocking"-Puffer in PBS (Pierce Chemical Co.) wurden zu jedem Well gegeben. Nachdem die Wells bei Raumtemperatur 5 Minuten stehen gelassen wurden, wurde diese Lösung entfernt und die Wells wurden bei Raumtemperatur 24 Stunden lufttrocknen gelassen. Die beschichteten Wells wurden in verschlossenen Kunststofftaschen bei 4–8°C gelagert, bis sie in dem mpl-Liganden-ELISA verwendet wurden.

Affinitätsgereinigte anti-mpl-Liganden-Antikörper aus einem Pool von Kaninchenantiseren wurden kovalent an Meerrettichperoxidase (horseradish peroxidase, HRPO) zur Verwendung als signalerzeugender Antikörper gekoppelt. Die affinitätsgereinigten Antikörper wurden mit Iminothiolan-HCl (Fluka Chemical Corp.) derivatisiert. Davon getrennt wurde die HRPO mit N-Succinimidyl-6-maleimidocaproat (Fluka Chemical Corp.) derivatisiert. Die zwei aktivierten Proteine wurden kombiniert, um eine kovalente Kopplung zu erlauben. Die Reaktionsmischung wurde dann an einer FPLC-Superose 6 (Pharmacia)-Säule chromatographiert, um das Antikörper:HRPO-Konjugat mit dem gewünschten Molekulargewicht (d.h. um 200 kDa) zu isolieren. Fraktionen, welche das gewünschte Konjugat enthielten, wurden vereinigt und in einem Centricon 30 (Amicon Division, W.R. Grace & Co.) konzentriert und als eine 50 %ige Glyzerinlösung bei –20°C gelagert. Dieses anti-mpl-Liganden-Antikörper:HRPO-Konzentrat wurde in 2% fötalem Rinderserum in PBS zur Verwendung in dem ELISA verdünnt. Die Endkonzentration von im ELISA verwendeten Konjugat betrug 250–500 ng/ml.

Rekombinanter menschlicher mpl-Ligand 1-163, hergestellt in E. coli-Zellen, wurde für die Herstellung von Standards verwendet. Dieser mpl-Ligand wurde in 2% fötalem Rinderserum (Sigma Chemical Co.) in TEN-Puffer, der 0,05% Thimerosal als Konservierungsmittel enthielt, verdünnt. Die hergestellten Standards enthielten 0,10, 0,05, 0,25, 0,125 und 0,026 ng/ml mpl-Ligand.

Test: 100 &mgr;l von mpl-Liganden-Standards oder -Proben wurden in Wells gegeben, dann wurde 18–24 Stunden bei Raumtemperatur in einer abgeschlossenen und befeuchteten Kammer inkubiert. Der Inhalt der Wells und restliche Lösung wurden dann entfernt, und die Wells wurden einmal mit Waschlösung (0,05% Tween 20 in TEN-Puffer) gewaschen. Es wurden jedem Well anti-mpl-Liganden-Antikörper:HRPO-Konjugat-Lösung (100 &mgr;l) zugegeben, und es wurde dann zwei Stunden bei Raumtemperatur in einer abgeschossenen und befeuchteten Kammer inkubiert. Der Inhalt der Wells wurde dann viermal mit 0,05% Tween 20 in TEN-Puffer gewaschen.

Zur Farbentwicklung wurden 100 &mgr;l TMB/Peroxid-Substratlösung (Lösungen A und B, 1:1 gemischt, Kirkegaard & Perry) hinzugefügt, und es wurde 20 Minuten bei Raumtemperatur inkubiert. Die Reaktion wurde durch Zugabe von 100 &mgr;l Stopplösung (0,5 N Schwefelsäure) abgestoppt, und die Absorption wurde bei 450 nm mit einem Mikrotiterplattenlesegerät abgelesen. Die Konzentrationen an mpl-Ligand in den Proben wurden aus einer Standardkurve, die unter Verwendung eines Curvefit-Programms erzeugt wurde, berechnet.

BEISPIEL 8 Biologische Aktivität von mpl-Liganden 1-174-Analoga in einem Test an Megakaryozyten in kurzzeitiger Flüssigkultur

Analoga vom mpl-Liganden 1-174 wurden wie oben beschrieben hergestellt und auf ihre Fähigkeit getestet, das Wachstum von Megakaryozyten in einer Flüssigkultur zu stimulieren. CD34-selektionierte Zellen, die aus menschlichen Leukapherese-Einheiten (Nichol et al., Stem Cells 12: 494–505, 1994) isoliert wurden, wurden mit einer Dichte von 200 × 105/ml in Kulturmedium (IMDM/1% Pen-Strep-Glutamin/1% nicht essentielle Aminosäuren/1% MEM Na-Pyruvat/1% MEM Vitamine/10% entionisiertes BSA/10% normales menschliches Antikörperplasma/10 &mgr;M &agr;-Thiazylglyzerin/20 &mgr;g/ml L-Asparagin) ausplattiert. Zusätzlich wurden 1,5 &mgr;l COS-1-konditioniertes Medium, das mpl-Liganden (1-174) oder mpl-Liganden 1-174-Analogon enthielt, zu jedem Well gegeben. Das Endvolumen betrug 15 &mgr;l in Terasaki-Mikrotiter-Gewebekulturplatten (Vangard International). Die Zellen wurden bei 37°C 8 Tage in befeuchteten Kästen in 5% CO2 inkubiert, mit 1% Glutaraldehyd direkt an die Kultur-Wells fixiert und dann mit einem Cocktail aus monoklonalen Antikörpern, der aus anti-GPIb, anti-GPIIb (Biodesign) und anti-GPIb (Dako, Carpinteria, CA) bestand, inkubiert. Die Immunreaktion wurde mit einem Streptavidin-&bgr;-Galactosidase-Detektionssystem (HistoMark, Kirkegaard und Perry) entwickelt. Megakaryozyten, identifizert durch die dunklere Farbe (in den echten Photographien blau), erscheinen in 8.

Die Tafeln A und D in 8 sind die positiven bzw. negativen Kontrollen. Das Well, das in Tafel A abgebildet ist, erhielt 37,5 pg Wildtyp-mpl-Ligand 1-174 COS-1-konditioniertes Medium und zeigt ein wesentliches Megakaryozytenwachstun. Das Well in Tafel D erhielt 1,5 &mgr;l COS-1-konditioniertes Medium ohne Ligand („Mock") und zeigt kein Wachstum. Die Tafeln B und C in 8 sind die mpl-Liganden 1-174-Analoga N7 bzw. N10. Das Well in Tafel B erthielt 9,0 pg mpl-Ligand COS-1-konditioniertes Medium, während das Well in Tafel C 27 pg erhielt, und beide zeigten ein ausgezeichnetes Megakaryozytenwachstum.

Diese Experiment zeigt, dass die getesteten Analoga des mpl-Liganden in der Lage sind, das Wachstum von menschlichen Megakaryozyten in vitro zu stimulieren.

BEISPIEL 9 Biologische Aktivität von mpl-Liganden 1-174-Analoga in einem in vitro-Zellproliferationstest

Analoga vom mpl-Liganden 1-174 wurden wie oben beschrieben hergestellt und auf ihre Fähigkeit getestet, die Proliferation von 32 D-mpl-Zellen zu stimulieren. Um 32 D-mpl-Zellen zu konstruieren, wurde die Volllängesequenz des menschlichen mpl-Rezeptors (Vigon, I. et al., PNAS 89: 5640–5644, 1992) in einen Expressionsvektor subkloniert, welcher den Transkriptiospromotor des Moloney Murine Sarcoma-Virus enthielt. Es wurden 6 &mgr;g dieses Konstrukts und 6 &mgr;g eines amphotrophen retroviralen Verpackungskonstrukts (Landau, N.R., Littaman, D.R., Journal of Virology 66: 5110–5113 (1992)) in 293-Zellen in einer Dichte von 3 × 106 unter Verwendung eines CaPO4-Säugetiertransfektionskits (Stratagene) transfiziert. Dieselben Zellen wurden nach zwei Tagen und wieder nach vier Tagen erneut transfiziert. An dem Tag nach der letzten Transfektion wurden die 293-Zellen mit der IL-3-abhängigen Mäusezelllinie (32 D, Klon 23; Greenberger et al., PNAS 80: 2931–2936, 1983) kokultiviert. Nach 24 Stunden wurden die 32 D-Zellen geerntet und in einem BSA-Gradienten (Path-o-cyte; Miles Inc.) zu Banden geformt. Die Zellen wurden in 1 ng/ml Maus-IL-3 expandiert und dann zum Wachstum in 20% APK9-Serum (Bartley et al., Cell 77: 1117–1124, 1994) selektioniert. Die Zellen wurden nach Zelloberflächenexpression des Rezeptors durch FACS unter Verwendung eines polyklonalen Kaninchen-anti-Peptid (MPL)-Serums sortiert. Die Zytokinabhängigen 32 D-mpl-Mäusezellen waren in der Lage, auf den mpl-Liganden zu antworten. Die 32 D-mpl-Zellen wurden in MEM-Medium, das 10% Kälber-Klon II-Serum (Hyclone Laboratories) und 1,0 ng/ml muIL3 enthielt, bis zu einer Zelldichte von 1 × 106 Zellen/ml wachsen gelassen. Die Zellen wurden durch Zentrifugation (ungefähr 500 × g) gesammelt und zweimal in Wachstumsmedium ohne muIL3 gewaschen, resuspendiert und auf eine Zellzahl von 1 × 105/ml eingestellt.

Eine erweiterte mpl-Liganden-Standardkurve mit 12 Punkten wurde unter Verwendung des mpl-Liganden 1-163 und Bereichen von 5000 bis 1 pg/ml hergestellt. Ein Volumen von 100 &mgr;l von jeder Verdünnung von mpl-Liganden-Standard- oder -Testprobe wurde zu geeigneten Wells einer 96-Well-Mikrotiter-Gewebekulturplatte gegeben, die 100 &mgr;l resuspendierte Zellen (10000 Zellen/Well) enthielt, und in einem befeuchteten Inkubator bei 37°C und 10% CO2inkubiert. Nach 48 Stunden wurden 40 &mgr;l MTS-Reagenz („Aqueous Non-Radioactive Cell Proliferation Kit", Promega) zu jedem Well gegeben, und 14–18 Stunden später wurden die Platten mit einem Plattenlesegerät bei 490 nm abgelesen. Die in vitro-Aktivität in Proben wurde aus einer Dosis-Antwort-Kurve für jede Probe berechnet. Eine Einheit war definiert als die Menge an mpl-Ligand in jeder Probe, die erforderlich war, um 50% der maximalen Stimulation zu ergeben. Die spezifische Aktivität wurde berechnet, indem die biologische Aktivität in Units/ml durch die mpl-Liganden-Konzentration in ng/ml, wie durch den mpl-Liganden-ELISA bestimmt, dividiert wurde.

Die spezifische biologische Aktivität von mpl-Liganden-Analoga, die in COS-Zellen transfiziert und exprimiert wurden, wird in Tabelle 4 gezeigt. Die Wirkung der Aminosäuresubstitutionen auf eine Kohlenhydrat-Addition wird ebenfalls zusammengefasst. Gereinigter mpl-Ligand mit menschlicher Sequenz weist eine in vitro-Aktivität auf, die 200–300 Units/ng betrug, wie durch die oben beschriebenen Tests bestimmt wurde. Aus Tabelle 4 ist ersichtlich, dass mpl-Liganden-Analoga, welche zusätzliches N-verknüpftes Kohlenhydrat enthalten, ebenso exprimiert werden, wie ein mpl-Ligand mit der nativen Sequenz, selbst wenn sie zusätzliche Kohlenhydratketten (wie in Beispiel 6, Abschnitt A bestimmt), z.B. N4 und N10, enthalten. Beide Analoga behalten auch die volle biologische Aktivität in vitro bei. Deshalb können die mpl-Liganden-Analoga, welche N-verknüpftes Kohlenhydrat enthalten, in Säugetierzellen normal exprimiert werden, und sie können eine normale oder verstärkte biologische Aktivität in vitro aufweisen.

Anmerkungen:

  • (a) Die Anzahl an zusätzlichen N-verknüpften Ketten wurde auf der Grundlage der Mobilität der Polypeptid-Analoga in SDS-Gelen abgeschätzt, wie in Beispiel 6 beschrieben.
  • (b) Die Mengen an mpl-Ligandenanaloga in CHO-Zellüberständen wurden durch einen ELISA-Test bestimmt, wie in den Beispielen beschrieben.
  • (c) Die in vitro-Aktivität wurde gemessen, indem die Stimulation der Tymidin-Aufnahme in 32 D-Zellen in Abhängigkeit vom mpl-Liganden zum Wachstum gemessen wurde.
  • (d) Verhältnis der in vitro-Aktivität vom mpl-Ligandenanalogon, wie durch Proliferationstests gemessen, zu der Menge an mpl-Ligandenanalogon, gemessen durch mpl-Liganden-ELISA

  • N.A. = not available = nicht verfügbar

BEISPIEL 10 Expression in CHO-Zellen und Reinigung der mpl-Liganden 1-174, N4 und N15

pDSR&agr;2, das cDNA der mpl-Liganden 1-174, N4 und N15 enthielt, wurde in DHFR-defiziente CHO-Zellen unter Verwendung des in Beispiel 2 beschriebenen Protokolls mit den folgenden Modifikationen transfiziert.

Für jedes Analogon wurde eine Transfektion durchgeführt. Drei Wochen nach der Transfektion wurde die mpl-Liganden-Expression durch mpl-Liganden-ELISA durchgemustert. Drei exprimierende Klone wurden unter cryogenen Lagerungsbedingungen eingefroren. Der Klon, der bei jedem Analogon die höchste Expression zeigte, wurde zur Produktion in Rollflaschen expandiert. Für N4 wurden 4,71 konditioniertes Medium (50% DMEM, 50% HAMS-F12, 1% Penicillin/Streptomycin/Glutamin, 1% nicht essentielle Aminosäuren (Gibco) produziert und für N15 wurden 4,61 konditioniertes Medium produziert.

Serumfreies konditioniertes CHO-Zellmedium aus Rollflaschen, worin die CHO-Zellen ausgesät worden waren, welche die mpl-Liganden 1-174 (2,9 l) N4 (7,4 l), N15 (4,4 l) exprimierten, wurden 12-, 19- bzw. 12-fach unter Verwendung einer S1Y10 (10000 Da Molekulargewichtsausschluss) Spriralultrafiltrationskartusche von Amicon konzentriert. 150 ml konzentriertes konditioniertes Medium wurde dann direkt auf eine 3,3 ml-hu-MPL-X (Rezeptor)-Affinitätssäule bei einer Flussrate von 0,3 ml/min. geladen. Die Affinitätssäule wurde konstruiert, indem 1,0–1,5 mg MPL-X (die lösliche extrazelluläre Domäne des mpl-Rezeptors) pro ml CNBr-aktiviertes Sepharoseharz von Pharmacia wie durch den Hersteller empfohlen gekoppelt wurden. Nach dem Beladen wurde die Säule mit 30 ml phosphatgepufferter Salzlösung (PBS; 10mM NaPO4, pH 6,8/150 mM NaCl) und dann 60 ml 10 mM Tris, pH 8,0/1 M NaCl/1mM CHAPS gewaschen. Der mpl-Ligand 1-174 wurde mit 30 ml 20 mM CHAPS (3-[Cyclohexylamino]-1-propansulfonsäure), pH 10,5/1 M NaCl/1mM CHAPS (3-[(3-Cholamidopropyl)-dimethylammonio]-1-propansulfonat) eluiert.

Die Fraktionen wurden durch Zugeben von 0,6 ml 1M Tris, pH 7,0 zu jeder eluierten Fraktion neutralisiert. Die SDS-PAGE-Analyse zeigte ein scheinbares „Ausbluten" vom 1-174 mpl-Liganden während des Waschschritts mit 10 mM Tris, pH 8,0/1M NaCl/1mM CHAPS. Die eluierten Fraktionen wurden durch SDS-PAGE analysiert. Solche Fraktionen, die den mpl-Liganden 1-174 enthielten, wurden vereinigt. Diese Affinitätsreinigung wurde dann modifiziert und mit folgenden Änderungen wiederholt: 0,5 ml/min Beladung und Elution und Weglassen des Waschschritts mit 10 mM Tris, pH 8,0/1M NaCl/1 mM CHAPS.

Alle Fraktionen, welche die einzelne Bande mit mpl-Liganden enthielten, wurden unter Verwendung einer YM10-Membran (10000 Da Molekulargewichtsausschluss) in einer 50 ml-Rührzelle mit Wechsel zu einer Centricon-Vorrichtung konzentriert. Dieses Konzentrat von 0,5 ml wurde direkt auf eine mit PBS äquilibrierte Pharmacia Superdex 200 HR 10/30-Gelfiltrationssäule bei 0,25 ml/min geladen, wobei Fraktionen von 0,25 ml gesammelt wurden. Alle eluierten Fraktionen, welche eine einzelne mpl-Liganden-Bande (auf der Grundlage einer SDS-PAGE-Analyse) enthielten, wurden vereinigt.

Andere Formen (N4 und N15) von in CHO-Zellen exprimiertem mpl-Liganden wurden auf ähnliche Weise gereinigt (Proben aus zwei Affinitätsreinigungen wurden vereinigt und über eine Superdex 200-Gelfiltrationssäule laufen gelassen).

BEISPIEL 11 Bestimmung von Kohlenhydrat-Additionen bei in CHO-Zellen exprimierten N4 und N15

Um zu bestimmen, ob N-verknüpftes Kohlenhydrat in den in CHO-Zellen exprimierten Formen von mpl-Liganden enthalten war, wurde konditioniertes Medium durch SDS-PAGE und Western blot wie in Beispiel 6 beschrieben mit den folgenden Modifikationen analysiert.

Es wurde CHO-D-konditioniertes Medium aus Rollflaschen verwendet. Die Proben wurden in die Centricon-10-Zentrifugenkonzentratoren (Amicon, Beverly, MA.) geladen und bei 6000 Upm eine Stunde in einer Beckman J2-HS-Zentrifuge unter Verwendung eines Festwinkelrotors (JA 20.1) zentrifugiert. Ein Volumen konzentrierte Probe, welches ungefähr 100 ng des mpl-Ligandenanalogons enthielt, wurde auf ein SDS-PAGE-Gel zusammen mit SDS-Probenpuffer (beschrieben in Beispiel 6) geladen. In E. coli exprimierter mpl-Ligand MK 1-174, der kein Kohlenhydrat enthielt, wurde ebenfalls geladen. 9 zeigt die Unterschiede in der Mobilität, die mit der erwarteten Menge an Kohlenhydrat korrelieren. Die Spezies mit der höchsten Mobilität war der in E. coli exprimierte Met-Lys (1-174)-mpl-Ligand, gefolgt durch mpl-Ligand 1-174 (CHO), N4 (CHO) und N15 (CHO), in dieser Reihenfolge. Siehe 9. Die wahrscheinlichste Erklärung für die Größenzunahmen im Verhältnis zu nicht glykosyliertem mpl-Liganden ist zusätzliches O-verknüpftes Kohlenhydrat am mpl-Liganden 1-174 (CHO), zusätzliches O-verknüpftes Kohlenhydrat und ein zusätzliches N-verknüpftes Oligosaccharid an N4 (CHO) und zusätzliches O-verknüpftes Kohlenhydrat und zwei zusätzliche N-verknüpfte Oligosaccharide an N15 (CHO).

Um nachzuweisen, dass die Zunahme des Molekulargewichts tatsächlich auf die Addition von N-verknüpften Kohlenhydratketten zurückzuführen war, wurden die Proben mit N-Glykanase behandelt, um jedes N-verknüpfte Kohlenhydrat zu entfernen, wie in Bespiel 6 beschrieben. Jede Probe enthielt ungefähr 100 ng mpl-Ligandenanalogon, gereinigt aus konditioniertem Medium.

Nach Behandlung mit N-Glykanase war die Mobilität von N4 (CHO) und N15 (CHO) auf diejenige des mpl-Liganden 1-174 (CHO) reduziert. Eine Behandlung von mpl-Liganden MK 1-174 (E. coli) oder mpl-Liganden 1-174 (CHO) mit N-Glykanase beeinflusste die Mobilität nicht, da von keiner Form erwartet wurde, dass sie N-verknüpftes Kohlenhydrat enthält. Ein Vergleich der N-Glykanase-Behandlung mit keiner Behandlung zeigt, dass der Größenunterschied für N4 der Größe einer N-verknüpften Kohlenhydratkette entspricht, und dass der Größenunterschied für N15 der Größe von 2 Kohlenhydratketten entspricht. Folglich führt eine Addition von N-verknüpften Glykosylierungsstellen bei diesen beiden mpl-Ligandenformen zu zusätzlichem N-verknüpftem Kohlenhydrat, wenn diese Spezies in CHO-Zellen exprimiert werden. Siehe 10.

BEISPIEL 12 Biologische in vitro-Aktivität von in CHO-hergestellten mpl-Ligandenanaloga

Gereinigter mpl-Ligand und gereinigte mpl-Analoga, exprimiert in und gereinigt aus CHO-Zellen oder E. coli-Zellen, wurden in Bezug auf ihre biologischen Aktivität in vitro unter Verwendung der Faktor-abhängigen Zelllinie 32D-MPL und eines in Beispiel 9 beschriebenen Tests analysiert, außer dass die Aktivität aus einer Kurve unter Verwendung eines in CHO-Zellen hergestellten mpl-Liganden 1-332 als Standard verwendet wurde. Die spezifischen biologischen Aktivitäten in vitro der verschiedenen Formen werden in Tabelle 5 gezeigt. Aus dieser Tabelle ist ersichtlich, dass die mpl-Ligandenanaloga, die zusätzliches Kohlenhydrat enthalten und in CHO-Zellen exprimiert werden, eine biologische Aktivität in vitro aufweisen.

BEISPIEL 13 Biologische in vitro-Aktivität von mpl-Ligandenanaloga

Die Zahlen der Blutplättchen bei Mäusen, die mit verschiedenen Formen vom mpl-Liganden behandelt wurden, wurden gemessen, und die Ergebnisse werden in 11 dargestellt. Die aus CHO-Zellen stammenden mpl-Liganden 1-332, 1-174, N4 und N15 wurden hergestellt und durch mpl-Rezeptoraffinitätschromatographie gereinigt. Der aus E. coli stammende Met-Lys-mpl-Ligand 1-174 wurde hergestellt und durch herkömmliche Chromatographie gereinigt. Die angegebene Konzentration von jeder Form wurde normalen Balb/c-Mäuseweibchen einmal täglich über 5 Tage subkutan verabreicht. Blutproben aus einem kleinen lateralen Schnitt in eine Schwanzvene wurden 24 Stunden nach der letzten Injektion gesammelt. Blutzellanalysen wurden mit einem elektronischen Sysmex-Blutzellanalysegerät (Baxter Diagnostics, Inc. Irvine, CA.) durchgeführt. Die Daten werden dargestellt als der Mittelwert von Bestimmungen von vier Tieren, +/– Standardfehler des Mittelwerts. Andere Blutzellparameter, wie etwa die Gesamtzahl an weißen Blutzellen oder die Zahl an roten Blutzellen, wurde durch diese Behandlungen nicht beeinflusst (Daten nicht gezeigt).

Alle Formen stimulierten Zunahmen der Blutplättchenzahlen. Dennoch variierten die Aktivitäten der verschiedenen Formen. Die relative in vitro-Aktivität war mpl-Ligand MK 1-174 (E. coli) < mpl-Ligand 1-174 (CHO) < N4 (CHO) < mpl-Ligand 1-332 (CHO) < N15 (CHO). Die Ergebnisse zeigen, dass die Addition eines nicht natürlich vorkommenden N-verknüpften Kohlenhydrats zu einer erhöhten Aktivität in vivo führt. Sie zeigen weiterhin, dass Zunahmen der Menge an Kohlenhydrat zu proportionalen Zunahmen der Aktivität in vivo führen.

BEISPIEL 14 Konstruktion von mpl-Ligandenanaloga und trunkierten N16–N40 durch Überlappungs-PCR

Es wurden Analoga N16 bis N40 (siehe Tabelle 6 im Bezug auf die Strukturen dieser Analoga) durch Überlappungs-PCR (overlap polymerase chaim reaction, overlap PCR) unter Verwendung eines angepassten Protokolls von Cheng et al., PNAS 91, 5695 (1994) konstruiert. Typischerweise werden ein bis zwei Mutationen in jede Konstruktion eingeführt.

Die folgenden Oligonukleotid-Primer wurden synthetisiert, um zum Herstellen der Analoga N16 bis N40 verwendet zu werden.

  • F = forward = Vorwärts
  • R = reverse = Rückwärts

Konstruktionen, die eine neue Glykosylierungsstelle einführen, wurden in zwei aufeinanderfolgenden Schritten durchgeführt. In Schritt 1 wurden zwei Reaktionen unter Verwendung von vier verschiedenen Oligonukleotiden durchgeführt. Diese Oligos beinhalteten einen 5'-Vorwärts-Primer, einen mutagenen Rückwärts-Primer, einen mutagenen Vorwärts-Primer (der gewöhnlich zu dem mutagenen Rückwärts-Primer komplementär ist) und einen 3'-Rückwärts-Primer. Der 3'-Rückwärts-Primer enthielt Sequenzen, welche Stoppkodons, gefolgt durch SalI-Restriktionsstellen, einführten. Stoppkodons wurden in den Positionen 175, 184, 192 und 200 eingeführt. Folglich konnten Formen mit den Längen 1-174, 1-183 (N16), 1-191 (N17) und 1-199 (N31) hergestellt werden. Die PCR1 verwendete Matrizen-DNA (pDSR&agr;2, das Sequenzen vom mpl-Liganden 1-174 oder Volllängesequenzen vom mpl-Liganden 1-332 enthielt), den 5'-Vorwärts-Primer und den mutagenen Rückwärts-Primer. Die PCR 2 verwendete Matrizen-DNA, den 3'-Rückwärts-Primer und den mutagenen Vorwärts-Primer. Die beiden PCR-Reaktionen wurden dann durchgeführt, und die amplifizierten DNA-Fragmente wurden durch Agarosegelelektrophorese aufgetrennt. Es wurden kleine Stücke von Agarose, welche DNA-Fragmente der richtigen Größe enthielten, aus dem Gel ausgeschnitten.

Die DNA-Fragmente aus den PCR1 und PCR2 wurden miteinander kombiniert, und es wurde eine dritte PCR-Reaktion durchgeführt, bei der nur die 5'-Vorwärts- und 3'-Rückwärts-Primer verwendet wurden. Folglich wurde ein Volllänge-DNA-Segment, welches die gewünschten Mutationen in den mpl-Liganden eingefügt enthielt, amplifiziert.

Die amplifizierten Fragmente wurden wieder durch Agarosegelelektrophorese aufgetrennt, das DNA-Fragment mit der richtigen Größe wurde unter Verwendung eine GenecleanTM-Kits und Vorgehensweisen, die durch den Hersteller (Bio 101, Inc.) geliefert wurden, gereinigt. Die gereinigte DNA wurde mit XbaI und SalI verdaut, dann wurde sie wieder unter Verwendung des GenecleanTM-Kits gereinigt. Das Fragment wurde dann in mit XbaI und SalI geschnittenes pDSR&agr;2 ligiert. Die ligierte DNA wurde mit 2 Volumen Ethanol in 0,3 M NaOAc, pH 5,2 in Gegenwart von Träger-t-RNA präzipitiert und in E. coli transformiert. Die Klone wurden durch Restriktionsanalyse und Agarosegelelektrophorese getestet, um solche zu identifizieren, welche die DNA-Inserts mit der korrekten Größe enthielten. Die gereinigte Plasmid-DNA wurde dann hergestellt, und es wurde das mpl-Liganden-Insert sequenziert, um das Vorhandensein der gewünschten Mutationen zu bestätigen und um sicherzustellen, dass keine zusätzlichen Aminosäureänderungen eingeführt worden waren.

In etlichen Fällen wurden zwei oder mehr Mutationen gleichzeitig kombiniert, d.h. siehe N29, N33, N34, N35, N39 und N40. Dies konnte durch Einführen einer neuen Substitution in DNA durchgeführt werden, die bereits eine Änderung enthielt. Beispielsweise wurde N33 durch Einführen der N23-Änderung in N15 hergestellt. In diesem Fall wurde die oben beschriebene Vorgehensweise unter Verwendung von mutagene N23-Primern und der N15-Matrizen-DNA durchgeführt.

Bei einer anderen Strategie konnten zwei Änderungen gleichzeitig in Matrizen-DNA eingeführt werden. Die Matrizen-DNA konnte natürliche Sequenzen enthalten oder sie konnte Sequenzen enthalten, welche mpl-Ligandenformen kodiert, die bereits Änderungen enthielten. In diesen Fällen umfasste Schritt 1 drei PCR-Reaktionen und sechs Oligos. Die Oligos beinhalteten einen 5'-Vorwärts-Primer, zwei Paare von mutagenen Vorwärts- und Rückwärts-Primern und einen 3'-Rückwärts-Primer. Die beiden Primer eines Paares waren zueinander komplementär und enthielten Sequenzen, welche entworfen wurden, um eine neue Glykosylierungsstelle einzuführen.

Die PCR1 beinhaltete Matrizen-DNA, den 5'-Vorwärts-Primer und den mutagenen Rückwärts-Primer von Paar 1. Die PCR2 beinhaltete Matrizen-DNA, den mutagenen Vorwärts-Primer von Paar 1 und den mutagene Rückwärts-Primer von Paar 2, wobei das Primerpaar 2 in 3'-Position zu dem Primerpaar 1 lokalisiert war. Die PCR3 beinhaltete Matrizen-DNA, den mutagenen Vorwärts-Primer von Paar 2 und den 3'-Rückwärts-Primer.

Die DNA-Fragmente aus jeder PCR-Reaktion wurden durch Agarosegelelektrophorese aufgetrennt und wie zuvor beschrieben ausgeschnitten. Die drei DNA-Fragmente wurden dann miteinander kombiniert und durch PCR wieder unter Verwendung von nur den 5'-Vorwärts- und 3'-Rückwärts-Primern amplifiziert.

Das DNA-Segment, welche das gesamte Gen von Interesse mit Sequenzen kodierte, welche zwei neue Glykosylierungsstellen enthielten, wurden dann gereinigt, mit XbaI und SalI geschnitten und in mit XbaI und SalI geschnittenes pDSR&agr;2 wie zuvor ligiert.

Eine Vielzahl von Mutationen konnte auch kombiniert werden, indem die PCR-Reaktionen an Matrizen durchgeführt wurden, die bereits Mutationen enthielten. Beispielsweise wurde N39 hergestellt, indem N36- und N38-Änderungen in N15-Matrizen-DNA eingeführt wurden. Dies wurde unter Verwendung eines anderen Sets von Primern (N36 (2)) durchgeführt, als dem, das verwendet wurde, um N36 (N36(1)) herzustellen. Siehe die oben dargestellten Primer. Beide Sets von Primern führten dieselbe Mutation ein.

Längere Formen von mpl-Liganden konnten auch hergestellt werden. Folglich wurde N40 auf ähnliche Weise wie N39 hergestellt, außer dass der 3'-Rückwärts-Primer in der PCR3 (Schritt 1) und der PCR-Primer in Schritt 2 derjenige Primer war, der verwendet wurde, um N31 herzustellen. Dieser Primer führte ein Stoppkodon in der Position 200, gefolgt durch eine SalI-Restriktionsstelle ein. Zusätzlich enthielt die Matrizen-DNA, die für die PCR3 verwendet wurde, Sequenzen, welche den Volllänge-mpl-Liganden (1-332) kodierten.

Die typische PCR-Reaktionsmischung enthielt Folgendes: jeweils 3 &mgr;l Vorwärts- und Rückwärts-Primer (5 pMol/&mgr;l), 1 &mgr;l Matrize (50 ng), 10 &mgr;l 5 × LP-Puffer (100 mM Tricine, pH 8,7/25% Glyzerin/425 mM KOAc), 10 &mgr;l dNTP-Stammlösung (jeweils 1 mM dATP, dTTP, dCTP, dGTP), 0,8 &mgr;l rtTh-Polymerase (Perkin Elmer; 2,5 U/&mgr;l) und 2 &mgr;l „Vent"-Polymerase (NEB; 0,01 U/&mgr;l nach frischer 1:100 Verdünnung in 1 × PL-Puffer). Es wurde H2O zugegeben, um die Reaktionsmischung auf ein Endvolumen von 50 &mgr;l zu bringen. Alle Bestandteile wurden in der angegebenen Reihenfolge zusammen gegeben und die PCR wurden gestartet, wenn die Temperatur während des ersten Zyklus mehr als 60°C betrug, indem 1 &mgr;l 50 mM MgOAc zugegeben wurde. Die Reaktionsbedingungen waren die Folgenden: Zwei Zyklen bei 94°C, 10 sec/45°C, 1 min/68°C, 5 min, gefolgt durch 25 Zyklen bei 95°C, 10 sec/55°C, 1 min/68°C, 5 min.

Diese allgemeinen Vorgehensweisen wurden verwendet, um die in Tabelle 6 gezeigten mpl-Ligandenanaloga und trunkierten Versionen N16 bis N40 zu konstruieren. Die Änderungen der DNA-Sequenz für jede der Formen werden gezeigt.

Das Symbol „(i)" in der oben dargestellten Tabelle bedeutet, dass die Aminosäure, auf die Bezug genommen wird, eingeführt worden ist. Beispielsweise bedeutet Glu57 → Asn55'(i), Thr57 (Analogon N23 in Tabelle 6), dass das Glu in Position 57 durch ein Thr ersetzt worden ist und zusätzlich ein Asn direkt nach dem Met in Position 55 eingefügt worden ist, wobei Asn die neue Nummer 55' erhalten hat, so dass nachfolgende Aminosäuren ihre zuvor zugeordneten Nummern beibehalten haben.

Beispiele, die alle Änderungen aus den vorhergehenden Beispielen einschließen, werden durch die spezifischen Nummern der Analoga, die durch „+"-Zeichen verbunden werden, angegeben. Siehe die Analoga N35, N39 und N40. Die Längen der Aminosäureketten dieser Analoga werden in Klammern angegeben. Folglich enthält das Analogon N35 eine Kombination aus allen Änderungen, die für die Analoga N4, N23, N30 und N31 hergestellt wurden. Die Änderungen, die für N31 angegeben wurden, bedeuten, dass Analogon N35 eine Länge von 199 Aminosäuren aufweist. Alle Analoga in Tabelle 6 weisen eine Länge von 174 Aminosäuren auf, außer wenn eine andere Länge angegeben ist (oder in den Fällen, in denen eine Aminosäure eingefügt worden ist, wird die Gesamtlänge durch die Anzahl der eingefügten Aminosäuren zunehmen).

BEISPIEL 15 Charakterisierung on mp-Ligandenanaloga und trunkierten N16 bis N40 A. Bestimmung der Expressionsstärke und der biologischen Aktivität in vitro von mpl-Ligandenanaloga.

Die Spezies N16 bis N40 wurden in COS-Zellen unter Verwendung von entweder dem Elektroporationsverfahren (Beispiel 5) oder dem CaPO4-Verfahren („Mammalian Cell Transfection Kit"; Speciality media) transfiziert. Nach drei bis vier Tagen wurde zellfreies konditioniertes Medium gesammelt, aliquotiert und bei –70°C gelagert. Die Expressionsstärke wurde durch einen ELISA-Test wie in Beispiel 7 beschrieben bestimmt. Die Überstände wurden auch auf ihre biologische Aktivität wie in Beispiel 9 beschrieben mit einer Modifikation getestet. Die Aktivitäten wurden aus einer Standardkurve unter Verwendung von in CHO-Zellen exprimiertem und gereinigtem mpl-Liganden 1-332 als Standard berechnet.

Die Ergebnisse werden in Tabelle 7 gezeigt. Wie in Tabelle 7 gezeigt wird, werden die meisten der mpl-Ligandenanaloga exprimiert und sezerniert. Die Sekretion einiger der Analoga schien erhöht zu sein. Biotests mit diesen Proben zeigten, dass die spezifischen Aktivitäten bei den meisten auch mit nicht modifizierten Formen vergleichbar war. Einige der Analoga enthielten eine Vielzahl von N-verknüpften Kohlenhydratketten (siehe unten). Dies zeigt, dass eine Addition von Kohlenhydrat zu einer erhöhten Sekretion und einer normalen Aktivität der Analoga in vitro führen kann.

Anmerkungen

  • (a) Die Anzahl an zusätzlichen N-verknüpften Ketten wurde auf der Grundlage der Mobilität der Peptidanaloga in SDS-Gelen abgeschätzt.
  • (b) Die Mengen an mpl-Ligandenanaloga in COS-Zellüberständen wurden durch EIA bestimmt.
  • (c) Die in vitro-Aktivität wurde bestimmt, indem die Proliferation von 32D-mpl-Zellen, deren Wachstum vom mpl-Liganden abhängig ist, gemessen wurde.
  • (d) Das Verhältnis der in vitro-Aktivität vom mpl-Ligandenanalogon, wie durch Proliferationstests gemessen, zur Länge vom mpl-Ligandenanalogon, gemessen durch mpl-Liganden-ELISA

  • i = Insertion
  • NA = not available = nicht verfügbar

B. Bestimmung einer Kohlenhydrat-Addition

Die in Tabelle 6 gezeigten Analoga wurden unter Verwendung der in Beispiel 6 beschriebenen Vorgehensweisen getestet, um zu sehen, ob sie N-verknüpftes Kohlenhydrat anfügen.

Einige Analoga (N21, N22, N30, N33 und N36) wurden auch mit einer modifizierten Vorgehensweise getestet. Dies war notwendig, da der monoklonale Antikörper, der verwendet wurdet wurde, um den Westen blot zu entwickeln, gegen ein Peptid gerichtet war, welches die Aminosäurereste 47 bis 62 einschloss, und einige der in Tabelle 6 beschriebenen Analoga Substitutionen enthalten, welche die Immunreaktivität mit diesem Antikörper beeinflussen, z.B. N21. Um diese Analoga zu analysieren, wurden deshalb die Überstände unter Verwendung eines monoklonalen Antikörpers, der in Mäusen gegen den in E. coli-Zellen exprimierten mpl-Liganden 1-163 erzeugt wurde, immunpräzipitiert.

Typischerweise wurden 15 &mgr;g Antikörper verwendet, um 50 ng mpl-Ligandenanalogon zu immunpräzipitieren. Western blots mit immunpräzipitiertem Material wurden wie in Beispiel 6 beschrieben durchgeführt, abgesehen davon, dass die immunpräzipitierten Banden sichtbar gemacht wurden, indem die Blots mit dem polyklonalen Kaninchen-anti-mpl-Liganden-Antikörper (typischerweise 1 &mgr;/ml; gerichtet gegen in E. coli-Zellen exprimierten mpl-Liganden 1-163) und ein anti-Kaninchen-ECL-Kit (Amersham) inkubiert wurde. Die Ergebnisse der verschiedenen Experimente werden in Tabelle 7 gezeigt. Einige der Analoga zeigten eine Größenzunahme, welche die Anwesenheit von N-verknüpftem Kohlenhydrat angibt (N21, N22, N23, N29, N30, N31, N33, N34, N35, N36, N38, N39 und N40). Eine Untergruppe dieser Analoga wies mehr als eine N-verknüpfte Kette auf, z.B. N29, N33, N34, N35, N39 und N40. Diese Analoga wurden mit normalen oder erhöhten Spiegeln sezerniert und wiesen in vitro eine biologische Aktivität auf, die der des mpl-Liganden 1-174 vergleichbar ist. Dies zeigt, dass eine Vielzahl von funktionellen N-verknüpften Glykosylierungsstellen in einem mpl-Liganden ohne eine nachteilige Wirkung sowohl auf die Expression oder die biologische Aktivität eingeführt werden kann.

Um zu zeigen, dass eine Vielzahl von Oligosaccharidketten an einen mpl-Liganden angefügt werden kann, wurden verschiedene Analoga, die in COS-Zellen exprimiert wurden, durch Western blot wie in Beispiel 6 beschrieben analysiert. 12 zeigt, dass die Mobilität der Analoga mit zunehmender Anzahl von angefügten N-verknüpften Glykosylierungsstellen abnimmt. Es werden Analoga mit vier neuen Stellen gezeigt, nämlich N39 und N40. Die Analoga mit den meisten N-verknüpften Stellen zeigten die geringste Mobilität. Dieses Ergebnis wird bei den beiden Formen 1-174 und 1-199 des mpl-Liganden beobachtet. Dies zeigt, dass mindestens vier Analoga miteinander kombiniert werden können, was zu neuen Analoga mit einer Vielzahl von N-verknüpften Kohlenhydratketten führt.

BEISPIEL 16 Vergleich von Asn-X-Ser und Asn-X-Thr enthaltenden Glykosylierungsstellen

N-verknüpfte Glykosylierungsstellen beinhalten entweder Asn-X-Thr oder Asn-X-Ser, wobei X jede der 20 natürlich vorkommenden Aminosäuren mit Ausnahme von Pro sein kann. Wir wollten bestimmen, ob Ser oder Thr in der dritten Position bevorzugt ist. Deshalb wurden zwei Sets von Analoga, wobei jedes Set ein mpl-Liganden-Glykosylierungs-Analogon enthielt, das entweder ein Ser oder ein Thr in der dritten Position in dem Sequon enthielt, untersucht, um zu sehen, ob dies eine Wirkung auf die prozentuale Besetzung der N-verknüpften Glykosylierungsstellen hatte. N15 enthält zwei Asn-X-Thr-Stellen, während N29 zwei Asn-X-Ser-Stellen in genau denselben Positionen enthält. Auf ähnliche Weise enthält N30 ein Asn-X-Ser, während N38 ein Asn-X-Thr in derselben Position enthält.

Um diese beiden Sets von Analoga zu vergleichen, wurden sie in COS-Zellen exprimiert und der sezernierte mpl-Ligand wurde einer Western blot-Analyse wie in Beispiel 6 beschrieben unterzogen. 13 zeigt die Ergebnisse. N15 weist einen signifikant gestiegenen Anteil an glykosyliertem mpl-Liganden im Vergleich zu N29 auf. Im Gegensatz dazu gab es wenig Unterschied am Anteil an glykosyliertem und unglykosyliertem mpl-Liganden, wenn N30 und N38 verglichen wurden. Diese Ergebnisse zeigen, dass sowohl Asn-X-Ser als auch Asn-X-Thr in einen mpl-Liganden eingeführt werden kann, und dass beide als Stellen für eine N-verknüpfte Kohlenhydrat-Addition fungieren können. Zusätzlich kann in einigen Fällen das Asn-X-Thr-Sequon bervorzugt sein (d.h. es kann mit größerer Effizienz glykosyliert werden).


Anspruch[de]
Analogon des Megakaryocyten-Wachstums- und Entwicklungsfaktors (MGDF), wobei

(a) besagtes MGDF-Analogon eine Sequenz von Aminosäuren umfaßt, ausgewählt aus der Gruppe, bestehend aus Aminosäuresequenzen 7-151 bis 1-332, einschließlich, von SEQ ID NO: 1,

(b) besagtes MGDF-Analogon wenigstens eine zusätzliche N-verknüpfte Glycosylierungsstelle in besagter Sequenz von Aminosäuren hat,

(c) besagtes MGDF-Analogon wenigstens eine zusätzliche Kohlenhydratkette hat, die an besagte zusätzliche N-verknüpfte Glycosylierungsstelle angehängt ist, und

(d) besagtes MGDF-Analogon eine biologische Aktivität der spezifischen Stimulierung oder Vermehrung von Megakaryocyten oder Blutplättchen hat,

(e) besagtes MGDF-Analogon ausgewählt ist aus der Gruppe, bestehend aus

[Asn30, Thr32]-mpl-Ligand;

[Asn82, Ala83]-mpl-Ligand;

[Asn120, Thr122]-mpl-Ligand;

[Asn53, Thr55]-mpl-Ligand;

[Asn58, Thr60]-mpl-Ligand;

[Asn30, Thr32, Asn120, Thr122]-mpl-Ligand;

[Asn54, Ser56]-mpl-Ligand;

[Asn52, Thr54]-mpl-Ligand;

[Asn55'(i), Thr57]-mpl-Ligand;

[Asn30, Ser32, Asn120, Ser122]-mpl-Ligand;

[Thr163, Asn164]-mpl-Ligand;

[Asn30, Thr32, Asn120, Thr122, Asn55(i), Thr57]-mpl-Ligand;

[Asn30, Thr32, Asn55'(i), Thr57, Thr163, Asn164]-mpl-Ligand;

[Asn56]-mpl-Ligand;

[Thr163, Asn164, Thr166]-mpl-Ligand; und

[Asm30, Thr32, Asn120, Thr122, Asn55, Thr57, Thr163, Asn164, Thr166]-mpl-Ligand, und

(f) besagtes MGDF-Analogon eine Aminosäuresequenz hat, ausgewählt aus:

mpl-Ligand 1-332 Aminosäuren 1-332 aus 1

mpl-Ligand 1-199 Aminosäuren 1-199 aus 1

mpl-Ligand 1-191 Aminosäuren 1-191 aus 1

mpl-Ligand 1-183 Aminosäuren 1-183 aus 1

mpl-Ligand 1-174 Aminosäuren 1-174 aus 1

mpl-Ligand 1-163 Aminosäuren 1-163 aus 1

mpl-Ligand 1-153 Aminosäuren 1-153 aus 1

mpl-Ligand 1-152 Aminosäuren 1-152 aus 1

mpl-Ligand 1-151 Aminosäuren 1-151 aus 1

mpl-Ligand 7-332 Aminosäuren 7-332 aus 1

mpl-Ligand 7-191 Aminosäuren 7-191 aus 1

mpl-Ligand 7-199 Aminosäuren 7-199 aus 1

mpl-Ligand 7-183 Aminosäuren 7-183 aus 1

mpl-Ligand 7-174 Aminosäuren 7-174 aus 1

mpl-Ligand 7-163 Aminosäuren 7-163 aus 1

mpl-Ligand 7-153 Aminosäuren 7-153 aus 1

mpl-Ligand 7-152 Aminosäuren 7-152 aus 1

mpl-Ligand 7-151 Aminosäuren 7-151 aus 1
Analogon nach Anspruch 1, das das Expressionsprodukt einer exogenen DNA-Sequenz in einer eukaryotischen Zelle ist. Analogon nach Anspruch 2, wobei die eukaryotische Zelle eine Säugetierzelle ist. Analogon nach Anspruch 3, wobei besagte Säugetierzelle CHO ist. DNA-Sequenz mit einer Nukleotidsequenz, die für ein Analogon nach einem der vorangehenden Ansprüche kodiert. Eukaryotische Wirtszelle, die mit einer DNA-Sequenz nach Anspruch 5 in einer Weise transfiziert worden ist, die es ermöglicht, daß die Wirtszelle ein Analogon nach einem der Ansprüche 1–5 exprimiert. Zusammensetzung, umfassend eine therapeutisch wirksame Menge eines Analogon nach einem der Ansprüche 1–4, zusammen mit einem pharmazeutisch akzeptablen Verdünnungsmittel, Adjuvans oder Träger.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com