PatentDe  


Dokumentenidentifikation DE69736185T2 19.04.2007
EP-Veröffentlichungsnummer 0000934416
Titel ZUSAMMENSETZUNG EINES POLYNUCLEOTID-IMPFSTOFFES FÜR KATZEN
Anmelder Merial, Lyon, FR
Erfinder AUDONNET, Jean-Christophe, F-69006 Lyon, FR;
BOUCHARDON, Annabelle, F-69007 Lyon, FR;
BAUDU, Philippe, F-69290 Craponne, FR;
RIVIERE, Michel, F-69130 Ecully, FR
Vertreter Vossius & Partner, 81675 München
DE-Aktenzeichen 69736185
Vertragsstaaten BE, CH, DE, FR, GB, IE, IT, LI, NL, SE
Sprache des Dokument FR
EP-Anmeldetag 15.07.1997
EP-Aktenzeichen 979337466
WO-Anmeldetag 15.07.1997
PCT-Aktenzeichen PCT/FR97/01315
WO-Veröffentlichungsnummer 1998003660
WO-Veröffentlichungsdatum 29.01.1998
EP-Offenlegungsdatum 11.08.1999
EP date of grant 21.06.2006
Veröffentlichungstag im Patentblatt 19.04.2007
IPC-Hauptklasse C12N 15/48(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 15/35(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/50(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/38(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/40(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/49(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/47(2006.01)A, L, I, 20051017, B, H, EP   A61K 39/295(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]

Die vorliegende Erfindung betrifft eine Impfstoffzusammensetzung, die die Impfung von Katzen gegen eine bestimmte Anzahl von Pathologien erlaubt. Sie betrifft auch ein entsprechendes Impfverfahren.

In der Vergangenheit wurden bereits Impfstoffkombinationen gegen bestimmte Hunde-Viren vorgeschlagen.

Die bisher entwickelten Kombinationen wurden ausgehend von inaktivierten Impfstoffen oder Lebendimpfstoffen und gegebenenfalls aus Gemischen von solchen Impfstoffen hergestellt. Ihre Herstellung birgt Probleme hinsichtlich der Kompatibilität zwischen Valenzen und Stabilität. Es muss in der Tat gleichzeitig die Kompatibilität zwischen den verschiedenen Impfstoff-Valenzen gewährleistet sein, entweder hinsichtlich der verschiedenen verwendeten Antigene oder hinsichtlich der Formulierungen selbst, insbesondere in dem Fall, wenn gleichzeitig inaktivierte und lebende Impfstoffe kombiniert werden. Ferner stellt sich das Problem der Konservierung solcher Kombinationsimpfstoffe und ihrer Unbedenklichkeit insbesondere in Gegenwart von Adjuvans. Diese Impfstoffe sind in der Regel recht kostspielig.

Die Patentanmeldungen WO-A-90 11092, WO-A-93 19183, WO-A-94 21797 und WO-A-95 20660 wendeten die unlängst entwickelte Technik der Polynucleotid-Impfstoffe an. Man weiß, dass diese Impfstoffe ein Plasmid verwenden, das dazu geeignet ist, in den Zellen des Wirts das in das Plasmid inserierte Antigen zu exprimieren. Sämtliche Verabreichungswege wurden vorgeschlagen (intraperitoneal, intravenös, intramuskulär, transkutan, intradermal, mukosal, etc.). Auch verschiedene Impfstoffmittel können verwendet werden, wie DNA, die auf die Oberfläche von Goldpartikeln aufgebracht und so beschleunigt wird, dass sie in die Haut des Tiers eindringt (Tang et al., Nature 356, 152–154, 1992), und die Flüssigstrahl-Injektoren, die die gleichzeitige Transfektion in die Haut, den Muskel, die Fettgewebe und die Mammagewebe erlauben (Furth et al., Analytical Biochemistry, 205, 365–368, 1992).

Die Polynucleotid-Impfstoffe können auch nackte DNAs verwenden, ebenso wie beispielsweise in Liposomen oder in kationischen Lipiden formulierte DNAs.

Ein Ziel der Erfindung besteht in der Bereitstellung eines solchen Impfstoffes, der leicht zu verwenden ist und wenig kostet.

Wieder ein anderes Ziel der Erfindung besteht in der Bereitstellung eines Impfverfahrens für Katzen, durch das sich ein Schutz mit erhöhtem Wirksamkeitsniveau und von längerer Dauer und mit recht guter Unbedenklichkeit erhalten lässt.

Demnach betrifft die vorliegende Erfindung eine Impfstoffzusammensetzung, die für Katzen bestimmt ist, die ein Plasmid umfasst, in welches ein Gen eines Katzenpathogens, des Katzenleukämievirus (FeLV), derart integriert ist, dass es in vivo in den Wirtszellen exprimiert wird, wobei das Plasmid ein oder mehrere Gene, ausgewählt aus der Gruppe, bestehend aus env und gag/pol der Katzenleukämie umfasst.

Unter Gen eines pathogenen Agens wird nicht nur das vollständige Gen verstanden, sondern auch die verschiedenen Nucleotidsequenzen, einschließlich von Fragmenten, die die Fähigkeit zur Auslösung einer Schutzantwort bewahren. Der Begriff Gen umfasst die Nucleotidsequenzen, die denjenigen entsprechen, die in den Beispielen genau beschrieben sind, d.h. die abweichenden Sequenzen, die aber das gleiche Protein kodieren. Er betrifft auch die Nucleotidsequenzen von anderen Stämmen des betrachteten Pathogens, die einen Kreuzschutz oder einen Stamm-spezifischen oder Stammgruppen-spezifischen Schutz sicherstellen. Er umfasst auch die Nucleotidsequenzen, die modifiziert worden sind, um die Expression in vivo durch den tierischen Wirt zu erleichtern, die aber das gleiche Protein kodieren.

Für die Katzenleukämie werden vorzugsweise die beiden Gene env und gag/pol in zwei verschiedene Plasmide oder in ein und dasselbe Plasmid integriert oder das Gen allein verwendet. Die vorliegende Erfindung betrifft einen Impfstoff, wie in Anspruch 1 definiert.

Die erfindungsgemäße Impfstoffzusammensetzung kann in einem Dosisvolumen zwischen 0,1 bis 3 ml und insbesondere von 0,5 bis 1 ml vorliegen.

Die Dosis liegt im Allgemeinen im Bereich von 10 ng bis 1 mg, vorzugsweise 100 ng bis 500 &mgr;g und stärker bevorzugt auch 1 &mgr;g bis 250 &mgr;g pro Typ von Plasmid.

Vorzugsweise werden nackte Plasmide verwendet, einfach eingebracht in das Impfstoffvehikel, das im Allgemeinen physiologische Flüssigkeit (NaCl 0,9 %), ultrareines Wasser, TE-Puffer, etc. ist. Natürlich können sämtliche, im Stand der Technik beschriebenen Polynucleotid-Impfstoffformen verwendet werden.

Jedes Plasmid umfasst einen Promotor, der in der Lage ist, die Expression des inserierten unter seiner Kontrolle stehenden Gens in den Wirtszellen sicherzustellen. Es handelt sich im Allgemeinen um einen starken eukaryotischen Promotor und insbesondere um einen frühen Promotor des CMV-IE-Cytomegalovirus menschlichen oder murinen Ursprungs oder gegebenenfalls auch eines anderen Ursprungs, wie Ratte, Schwein, Meerschweinchen.

Allgemeiner kann der Promotor entweder viralen Ursprungs oder zellulären Ursprungs sein. Als viraler Promotor kann der frühe oder späte SV40-Virus-Promotor oder der LTR-Promotor des Rous-Sarcoma-Virus genannt werden. Es kann sich auch um einen Promotor des Virus handeln, von dem das Gen stammt, beispielsweise der Gen-eigene Promotor.

Als zellulärer Promotor kann der Promotor eines Gens des Cytoskeletts, wie beispielsweise der Desminpromotor (Bolmont et al., Journal of Submicroscopic Cytology and Pathology, 1990, 22, 117–122; et ZHEMLIN et al., Gene, 1989, 78, 243–254) oder auch der Actinpromotor genannt werden.

Wenn mehrere Gene in dem gleichen Plasmid vorhanden sind, können diese in der gleichen Transkriptionseinheit oder in zwei verschiedenen Einheiten angeordnet werden.

Gegenstand der Erfindung sind auch monovalente Impfstoffformulierungen, umfassend ein oder mehrere Plasmide, die ein oder mehrere Gene von einem der obigen Viren codieren, wobei die Gene diejenigen sind, die vorstehend beschrieben sind.

Neben ihrem monovalenten Charakter können diese Formulierungen im Hinblick auf die Wahl der Gene, ihre Kombinationen, die Zusammensetzung der Plasmide, die Dosisvolumina, die Dosen, etc. die vorstehend zitierten Merkmale annehmen.

Die monovalenten Impfstoffformulierungen können auch verwendet werden (i) zur Herstellung einer polyvalenten Impfstoffformulierung, wie vorstehend beschrieben, (ii) einzeln gegen die entsprechende Pathologie, (iii) in Kombination mit einem Impfstoff eines anderen Typs (lebender oder inaktivierter Vollimpfstoff, rekombinanter Impfstoff, Untereinheiten-Impfstoff) gegen eine andere Pathologie oder (iv) als Auffrischung eines Impfstoffs, wie nachstehend beschrieben.

In der Tat hat die vorliegende Erfindung ferner die Verwendung von einem oder mehreren erfindungsgemäßen Plasmiden zur Herstellung eines Impfstoffs zum Gegenstand, der zum Impfen der erstgeimpften Katzen mittels eines ersten klassischen Impfstoffs (mono- oder polyvalent) vom Typ der Impfstoffe des Stands der Technik, ausgewählt insbesondere aus der Gruppe, bestehend aus lebendem Vollimpfstoff, inaktiviertem Vollimpfstoff, Untereinheiten-Impfstoff, rekombinantem Impfstoff, bestimmt ist, wobei dieser erste Impfstoff aufweist (d.h. er enthält oder kann exprimieren): das oder die durch das oder die Plasmid(e) codierte(n) Antigen(e) oder Antigen(e), die einen Kreuzschutz sicherstellen.

Bemerkenswerterweise hat der Polynucleotid-Impfstoff eine kräftige Auffrischungswirkung, die sich in einer Verstärkung der Immunantwort und einer Einstellung einer Immunantwort von langer Dauer niederschlägt.

Allgemein können die Erstimpfungs-Impfstoffe aus den handelsüblichen Impfstoffen ausgewählt werden, die von verschiedenen Veterinärimpfstoff-Herstellern verfügbar sind.

Die Erfindung hat auch einen Impfstoff-Kit zum Gegenstand, der einen Erstimpfungs-Impfstoff, wie vorstehend beschrieben, und eine erfindungsgemäße Impfstofftormulierung zur Auffrischung umfasst. Sie betrifft ferner eine erfindungsgemäße Impfstoffformulierung zusammen mit einer Anleitung, die die Verwendung dieser Formulierung als Auffrischung einer Erstimpfung, wie hier vorstehend beschrieben, angibt.

Gegenstand der vorliegenden Erfindung ist auch ein Impfverfahren für Katzen, das die Verabreichung einer wirksamen Impfstoffformulierung, wie vorstehend beschrieben, umfasst. Dieses Impfverfahren umfasst die Verabreichung einer oder mehrerer Dosen von Impfstoffformulierung, wobei diese Dosen nacheinander in kurzen Zeitabständen und/oder nacheinander zu weit voneinander beabstandeten Zeitpunkten verabreicht werden können.

Die erfindungsgemäßen Impfstoffformulierungen können im Rahmen dieses Impfverfahrens auf den verschiedenen Verabreichungswegen, die im Stand der Technik zur Polynucleotid-Impfung vorgeschlagen werden, und mittels bekannter Verabreichungstechniken verabreicht werden.

Gegenstand der Erfindung ist auch das Impfverfahren, das in der Durchführung einer Erstimpfung, wie vorstehend beschrieben und einer Auffrischung mit einer erfindungsgemäßen Impfstoffformulierung besteht.

Bei einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens wird zunächst an das Tier eine wirksame Dosis eines Impfstoffs vom klassischen Typ, insbesondere inaktiviert, lebend, abgeschwächt oder rekombinant, oder auch ein Untereinheiten-Impfstoff so verabreicht, dass eine Erstimpfung gewährleistet ist, und nach einer Zeitspanne von vorzugsweise 2 bis 6 Wochen wird die Verabreichung des erfindungsgemäßen poly- oder monovalenten Impfstoffs sichergestellt.

Die Wirksamkeit der Präsentation der Antigene gegenüber dem Immunsystem variiert als Funktion der Gewebe. Insbesondere dienen die Schleimhäute der Atemwege als Eintrittsbarriere für Pathogene und sind mit Lymphgewebe verbunden, das eine lokale Immunität unterstützt. Die Verabreichung eines Impfstoffs durch Kontakt mit den Schleimhäuten, insbesondere der Mundschleimhaut, der Rachenschleimhaut und der Schleimhaut der Bronchialregion ist für die Impfung gegen Pathologien der Atemwege und des Verdauungstrakts von bestimmtem Interesse.

Folglich sind die Verabreichungswege über die Schleimhäute Teil einer für die Erfindung bevorzugten Verabreichungsweise, wobei insbesondere die Verneblung oder Spray oder Trinkwasser verwendet wird. Die erfindungsgemäßen Impfstoffformulierungen und Impfverfahren können in diesem Rahmen angewandt werden.

Die Erfindung betrifft auch das Verfahren zur Herstellung der Impfstoffformulierungen, nämlich die Herstellung von Valenzen und ihrer Gemische, wie es aus dieser Beschreibung hervorgeht.

Die Erfindung wird nun mit Hilfe von Ausführungsformen für die Erfindung unter Bezugnahme auf die beigefügten Zeichnungen ausführlicher beschrieben.

Liste der Figuren

1: Plasmid pVR1012

2: Plasmid pPB179

3: Sequenz des Gens env FeLV-B

4: Plasmid pPB180

5: Sequenz gag/pol des Virus FeLV-A, Stamm Glasgow-1

6: Plasmid pPB181

Liste der Sequenzen SEQ-ID NO:

  • SEQ-ID NO: 1: Oligonucleotid PB247
  • SEQ-ID NO: 2: Oligonucleotid PB249
  • SEQ-ID NO: 3: Oligonucleotid PB281
  • SEQ-ID NO: 4: Oligonucleotid PB282
  • SEQ-ID NO: 5: Sequenz des Gens env des FeLV-B-Virus
  • SEQ-ID NO: 6: Oligonucleotid PB283
  • SEQ-ID NO: 7: Oligonucleotid PB284
  • SEQ-ID NO: 8: Sequenz des Gens gag/pol des FeLV-A-Virus (Glasgow-1)

BEISPIELE Beispiel 1: Kultivierung der Viren

Die Viren werden in dem geeigneten Zellsystem bis zum Erhalt eines cytopathischen Effekts kultiviert. Die für jedes Virus zu verwendenden Zellsysteme sind dem Fachmann gut bekannt. Kurz gesagt werden Zellen, die für das verwendete Virus empfindlich sind und in Minimal-Essential-Eagle-Medium ("MEM"-Medium) oder in einem anderen geeigneten Medium kultiviert werden, mit dem untersuchten Virusstamm angeimpft, indem ein Infektionsvielfaches von 1 verwendet wird. Die infizierten Zellen werden nun bei 37 °C während der Zeit inkubiert, die zum Auftreten eines vollständigen cytopathischen Effekts notwendig ist (durchschnittlich 36 h).

Beispiel 2: Extraktion der genomischen viralen DNAs:

Nach der Kultivierung werden der Überstand und die aufgebrochenen Zellen geerntet, und die gesamte Virussuspension wird bei 1000 g 10 min bei +4 °C zentrifugiert, um den Zellabfall zu beseitigen. Die Viruspartikel werden dann durch Ultrazentrifugation bei 400000 g 1 h bei +4 °C geerntet. Das Pellet wird in einem möglichst kleinen Volumen von Puffer (10 mM Tris, 1 mM EDTA) aufgenommen. Diese konzentrierte Virussuspension wird mit Proteinase K (100 &mgr;g/ml Endkonzentration) in Gegenwart von Natriumdodecylsulfat (SDS) (0,5 % Endkonzentration) 2 h bei 37 °C behandelt. Sodann wird die Virus-DNA mit einem Gemisch von Phenol/Chloroform extrahiert und anschließend mit 2 Volumina absoluten Ethanol präzipitiert. Nach einer Nacht bei –20 °C wird die DNA bei 10000 g 15 min bei +4 °C zentrifugiert. Das DNA-Pellet wird getrocknet, anschließend in einem möglichst geringem Volumen hochreinem sterilem Wasser aufgenommen. Es kann nun durch Restriktionsenzyme verdaut werden.

Beispiel 3: Isolierung der genomischen viralen RNAs

Die RNA-Viren wurden nach dem Fachmann gut bekannten Techniken gereinigt. Die genomische Virus-RNA von jedem Virus wurde anschließend unter Anwendung der "Guanidinthiocyanat/Phenol-Chloroform"-Extraktionstechnik, beschrieben von P. Chomczynski et N. Sacchi (Anal. Biochem. 1987, 162, 156–159), isoliert.

Beispiel 4: Molekularbiologische Techniken

Sämtliche Konstruktionen von Plasmiden wurden unter Anwendung von molekularbiologischen Standardtechniken, beschrieben von J. Sambrook et al., (Molecular Cloning: A Laboratory Manual. 2. Ausgabe, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989) durchgeführt. Sämtliche, für die vorliegende Erfindung verwendeten Restriktionsfragmente wurden unter Verwendung des "Geneclean"-Kits (BIO101 Inc. La Jolla. CA) isoliert.

Beispiel 5: RT-PCR-Technik

Spezifische Oligonucleotide (die an ihren 5'-Enden Restriktionsschnittstellen zur Erleichterung der Klonierung der amplifizierten Fragmente umfassen) wurden so synthetisiert, dass sie die kodierenden Regionen der Gene, die amplifiziert werden müssen (siehe spezielle Beispiele), vollständig umfassen. Die reverse Transkriptionsreaktion (RT) und die Kettenamplifikation durch Polymerase (PCR) wurden nach Standardtechniken (Sambrook J. et al., 1989) durchgeführt. Jede RT-PCR-Reaktion wurde mit einem Paar von speziellen Amplifikatoren und unter Verwendung von genomischer viraler extrahierter RNA als Matrix durchgeführt. Die amplifizierte komplementäre DNA wurde vor dem Verdau durch die Restriktionsenzyme mit Phenol/Chloroform/Isoamylalkohol (25:24:1) extrahiert.

Beispiel 6: Plasmid pVR1012

Das Plasmid pVR1012 (Figur Nr. 1) wurde bei Vical Inc. San Diego, CA, USA, erhalten. Seine Konstruktion wurde von J. Hartikka et al. (Human Gene Therapy, 1996, 7, 1205–1217) beschrieben.

Beispiel 7: Konstruktion des Plasmids pPB179 (env-Gen des FeLV-A-Virus)

Eine RT-PCR-Reaktion nach der Technik von Beispiel 5 wurde mit der genomischen RNA des Katzenleukämievirus (FeLV-A) (Stamm Glasgow-1) (M. Stewart et al., J. Viror, 1986, 58, 825–834), die nach der Technik von Beispiel 3 hergestellt wurde, und mit den folgenden Oligonucleotiden, durchgeführt:

PB247 (29-mer) (SEQ ID NO: 1)

5'TTTGTCGACCATGGAAAGTCCAACGCACC3'

PB249 (28-mer) (SEQ ID NO: 2)

5'TTTGGATCCTCATGGTCGGTCCGGATCG3'

um ein Fragment von 1947 bp, das das Gen enthält, das das Env-Glycoprotein des FeLV-A-Virus (Stamm Glasgow-1) codiert, in Form eines SalI-BamHI-Fragments zu amplifizieren. Nach der Reinigung wurde das RT-PCR-Produkt durch SalI und BamHI verdaut, um ein SalI-BamHI-Fragment von 1935 bp zu ergeben.

Dieses Fragment wurde mit dem pVR1012-Vektor (Beispiel 6), der zuvor mit SalI und BamHI verdaut wurde, ligiert, um das Plasmid pPB179 (6804 bp) (Figur Nr. 2) zu ergeben.

Beispiel 8: Konstruktion des Plasmids pPB180 (env-Gen des FeLV-B-Virus)

Eine RT-PCR-Reaktion nach der Technik von Beispiel 5 wurde mit der genomischen RNA des Katzenleukämievirus (Subtyp FeLV-B), die nach der Technik von Beispiel 3 hergestellt wurde, und mit den folgenden Oligonucleotiden durchgeführt:

PB281 (29-mer) (SEQ ID NO: 3)

5'TTTGTCGACATGGAAGGTCCAACGCACCC3'

PB282 (32-mer) (SEQ ID NO: 4)

5'TTGGATCCTCATGGTCGGTCCGGATCATATTG3'

um ein Fragment von 2005 bp, das das Gen enthält, das das Env-Glycoprotein des FeLV-B-Virus (Figur Nr. 3 und SEQ ID NO: 5) kodiert, in Form eines SalI-BamHI-Fragments zu amplifizieren. Nach der Reinigung wurde das RT-PCR-Produkt durch SalI und BamHI verdaut, um ein SalI-BamHI-Fragment von 1995 bp zu ergeben.

Dieses Fragment wurde mit dem pVR1012-Vektor (Beispiel 6), der zuvor mit SalI und BamHI verdaut wurde, ligiert, um das Plasmid pPB180 (6863 bp) (Figur Nr. 4) zu ergeben.

Beispiel 9: Konstruktion des Plasmid pPB181 (Gen FeLV gag/pol)

Eine RT-PCR-Reaktion nach der Technik von Beispiel 5 wurde mit der genomischen RNA des Katzenleukämievirus (Subtyp FeLV-A) (Stamm Glasgow-1 ), die nach der Technik von Beispiel 3 hergestellt wurde, und mit den folgenden Oligonucleotiden durchgeführt:

PB283 (33-mer) (SEQ ID NO: 6)

5'TTGTCGACATGTCTGGAGCCTCTAGTGGGACAG3'

PB284 (40-mer) (SEQ ID NO: 7)

5'TTGGATCCTTATTTAATTACTGCAGTTCCAAGGAACTCTC3'

um ein Fragment von 3049 bp, enthaltend die Sequenz, die das Gag-Protein kodiert, und den 5'-Teil der Sequenz, die das Pol-Protein des FeLV-A-Virus (Stamm Galsgow-1) (Figur Nr. 5 und SEQ ID NO: 8) kodiert, in Form eines SalI-BamHI-Fragments zu amplifizieren. Nach der Reinigung wurde das RT-PCR-Produkt mit SalI und BamHI verdaut, um ein SalI-BamHI-Fragment von 3039 bp zu ergeben.

Dieses Fragment wurde mit dem pVR1012-Vektor (Beispiel 6), der zuvor mit SalI und BamHI verdaut wurde, ligiert, um das Plasmid pPB181 (7908 bp) (Figur Nr. 6) zu ergeben.

Beispiel 10: Herstellung und Reinigung der Plasmide

Zur Herstellung der Plasmide, die zum Impfen von Tieren bestimmt sind, kann jede Technik angewandt werden, durch die sich eine Suspension von gereinigten Plasmiden hauptsächlich in einer Superknäuelform erhalten lässt. Diese Techniken sind dem Fachmann gut bekannt. Es kann insbesondere die alkalische Lysetechnik, gefolgt von zwei aufeinanderfolgenden Ultrazentrifugationen auf einem Cäsiumchloridgradienten in Gegenwart von Ethidiumbromid zitiert werden, wie bei Sambrook et al., (Molecular Cloning: A Laboratory Manual, 2. Ausgabe, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989) beschrieben. Auch kann auf die PCT-Patentanmeldungen WO 95/21250 und WO 96/02658 Bezug genommen werden, die Verfahren zur großtechnischen Herstellung von Plasmiden, die zur Impfung verwendbar sind, beschreiben. Zur Herstellung von Impfstoffen (siehe Beispiel 11) werden die gereinigten Plasmide so resuspendiert, dass hochkonzentrierte Lösungen (> 2 mg/ml) erhalten werden, die lagerungskompatibel sind. Hierzu werden die Plasmide entweder in hochreinem Wasser oder in TE-Puffer (10 mM Tris-HCl, 1 mM EDTA, pH 8,0) resuspendiert.

Beispiel 11: Herstellung der Impfstoffkombinationen

Die verschiedenen Plasmide, die zur Herstellung einer Impfstoffkombination notwendig sind, werden ausgehend von ihren konzentrierten Lösungen gemischt (Beispiel 10). Die Gemische werden so hergestellt, dass die Endkonzentration von jedem Plasmid der wirksamen Dosis von jedem Plasmid entspricht. Die zur Einstellung der Endkonzentration des Impfstoffes verwendbaren Lösungen können entweder eine NACl-Lösung von 0,9 % oder PBS-Puffer sein.

Besondere Formulierungen, wie Liposomen, kationische Lipide, können ebenfalls zur Herstellung der Impfstoffe verwendet werden.

Beispiel 12: Impfung der Katzen

Die Katzen werden mit Dosen von 10 &mgr;g, 50 &mgr;g oder 250 &mgr;g pro Plasmid geimpft.

Die Injektionen werden mit einer Spritze intramuskulär durchgeführt. In diesem Fall werden die Impfstoffdosen in einem Volumen von 1 ml verabreicht.

Die Injektionen können auch intradermal mit einer Spritze durchgeführt werden. In diesem Fall werden die Impfstoffdosen in einem Gesamtvolumen von 1 ml an 10 Punkten von 0,1 ml, oder an 20 Punkten von 0,05 ml, verabreicht. Die intradermalen Verabreichungen werden nach dem Rasieren der Haut (im Allgemeinen die Thoraxflanke) oder auf einer relativ unbehaarten anatomischen Region, beispielsweise die Innenfläche der Schenkel, durchgeführt.

Für die intradermalen Injektionen kann auch ein Flüssigstrahl-Injektionsgerät (ohne Nadel) verwendet werden.


Anspruch[de]
Impfstoff für Katzen, der ein Plasmid, das eine oder mehrere Nucleinsäuren, die env und/oder gag/pol des felinen Leukämievirus codieren, enthält und in vivo exprimiert, und geeignete Träger umfasst. Impfstoff nach Anspruch 1, dadurch gekennzeichnet, dass das Plasmid eine Nucleinsäure enthält und in vivo exprimiert, die env codiert. Impfstoff nach Anspruch 1, dadurch gekennzeichnet, dass das Plasmid eine Nucleinsäure enthält und in vivo exprimiert, die env und gal/pol codiert. Impfstoff nach Anspruch 1, dadurch gekennzeichnet, dass das Plasmid eine Nucleinsäure enthält und in vivo exprimiert, die env codiert, und ein anderes Plasmid umfasst, das eine Nucleinsäure enthält und in vivo exprimiert, die gal/pol exprimiert. Impfstoff nach einem der Ansprüche 1 bis 4, dadurch gekennzeichnet, dass das Plasmid einen Promotor umfasst, der ausgewählt ist aus dem CMV-IE-Promotor, dem frühen SV40 Virus-Promotor, dem späten SV40 Virus-Promotor, dem LTR-Promotor des Rous-Sarcom-Virus und dem Promotor eines Gens des Cytoskeletts. Impfstoff nach Anspruch 5, dadurch gekennzeichnet, dass das Plasmid einen CMV-IE-Promotor enthält. Impfstoff nach Anspruch 5, dadurch gekennzeichnet, dass der Promotor eines Gens des Cytoskeletts der Desminpromotor oder der Aktinpromotor ist. Impfstoff nach einem der Ansprüche 1 bis 7, umfassend 10 ng bis 1 mg, vorzugsweise 100 ng bis 500 &mgr;g und mehr bevorzugt 1 &mgr;g bis 250 &mgr;g jedes Plasmids. Verwendung eines oder mehrerer Plasmide, wie in einem der Ansprüche 1 bis 7 beschrieben, zur Herstellung eines Impfstoffes, der bestimmt ist zur Impfung einer erstgeimpften Katze mittels eines ersten Impfstoffes, der ausgewählt ist aus der Gruppe bestehend aus: einem Vollimpfstoff, einem inaktivierten Vollimpfstoff, einem Untereinheiten-Impfstoff, einem rekombinanten Impfstoff, wobei der erste Impfstoff das oder die durch das oder die Plasmid(e) codierte(n) Antigen(e) umfasst oder Antigen(e), das (die) einen Kreuzschutz sicherstellt (sicherstellen). Kit zur Impfung von Katzen, der einen Impfstoff nach einem der Ansprüche 1 bis 8 und einen weiteren Impfstoff für Katzen umfasst, der ausgewählt ist aus der Gruppe bestehend aus: einem anti-inaktivierten Impfstoff, einem Untereinheiten-Impfstoff, einem rekombinanten Impfstoff, wobei der weitere Impfstoff das durch das Plasmid des Impfstoffes codierte Antigen umfasst oder ein Antigen, das einen Kreuzschutz sicherstellt, zur Verabreichung des weiteren Impfstoffes als Erstimpfung gefolgt von der Verabreichung des das Plasmid enthaltenden Impfstoffes zur Auffrischung. Verwendung eines oder mehrerer Plasmide, wie in einem der Ansprüche 1 bis 7 beschrieben, zur Herstellung eines Impfstoffes, der bestimmt ist zur Impfung einer Katze in Kombination mit einem anti-inaktivierten Impfstoff, einem Lebendvollimpfstoff, einem rekombinanten Impfstoff und einem Untereinheiten-Impfstoff gegen eine andere feline Erkrankung.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com