PatentDe  


Dokumentenidentifikation DE60032370T2 11.10.2007
EP-Veröffentlichungsnummer 0001211310
Titel HEFEVARIANTEN UND VERFAHREN ZUR HERSTELLUNG VON GLYKOPROTEIN ENTHALTENDEN ZUCKERKETTEN VOM SÄUGETIERTYP
Anmelder Kirin Beer K.K., Tokio/Tokyo, JP;
National Institute of Advanced Industrial Science and Technology, Tokio/Tokyo, JP
Erfinder Takeuchi, Makoto, Yokohama-shi, Kanagawa 236-0004, JP;
Kawashima, Nagako, Yokohama-shi, Kanagawa 236-0004, JP;
Yoshida, Satoshi, Yokohama-shi, Kanagawa 236-0004, JP;
Yamano, Shigeyuki, Yokohama-shi, Kanagawa 236-0004, JP;
Jigami, Yoshifumi, Ushiku-shi, Ibaraki 300-1234, JP;
Ishii, Tomoko, Tsukuba-shi, Ibaraki 305-0042, JP;
Shimma, Yoh-ichi, Tsukuba-shi, Ibaraki 305-0031, JP;
Chiba, Yasunori, Yokohama-shi, Kanagawa 236-0004, JP;
Kainuma, Mami, Yokohama-shi, Kanagawa 236-0004, JP
Vertreter HOFFMANN & EITLE, 81925 München
DE-Aktenzeichen 60032370
Vertragsstaaten AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 16.08.2000
EP-Aktenzeichen 009534363
WO-Anmeldetag 16.08.2000
PCT-Aktenzeichen PCT/JP00/05474
WO-Veröffentlichungsnummer 2001014522
WO-Veröffentlichungsdatum 01.03.2001
EP-Offenlegungsdatum 05.06.2002
EP date of grant 13.12.2006
Veröffentlichungstag im Patentblatt 11.10.2007
IPC-Hauptklasse C12N 1/19(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12P 21/02(2006.01)A, L, I, 20051017, B, H, EP   C12N 9/24(2006.01)A, L, I, 20051017, B, H, EP   C12P 19/18(2006.01)A, L, I, 20051017, B, H, EP   C12P 21/00(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Gebiet der Erfindung

Die Erfindung betrifft neue Hefemutanten, die ein Glycoprotein herstellen können, bei der eine Zuckerkette, die eine Zuckerkettenstruktur aufweist, die mit einer von Säugerzellen hergestellten Zuckerkette identisch ist, an einen Asparaginproteinrest gebunden ist und ein Verfahren zur Herstellung der Zuckerkette und des Glycoproteins durch ein biotechnisches Glycoverfahren unter Verwendung der Mutanten.

Hintergrund der Erfindung

Es gibt zwei Proteinarten, die in der Welt vorkommen, das ist ein einfaches Protein, bestehend aus Aminosäuren und ein konjugiertes Protein, an das eine Zuckerkette, ein Fett oder eine Phosphorsäure und dergleichen gebunden ist. Es ist bekannt, dass die meisten Cytokine Glycoproteine sind. Es ist darüber hinaus erkannt worden, dass unter diesen Erythropoietin (EPO), Gewebsplasminogenactivator (TPA) und dergleichen durch Entfernung der Zuckerkette keine inhärenten physiologischen Aktivitäten entfalten (Akira Kobata, TanpakushitsuKakusanKoso, 36, 775-788 (1991). Folglich wird von Zuckerketten angenommen, dass sie eine wichtige Rolle beim Äußern einiger biologischer Aktivitäten spielen; da die Korrelation zwischen einer Zuckerkettenstruktur und einer biologischen Aktivität allerdings nicht immer klar ist, ist die Entwicklung einer Methode notwendig, bei der eine Zuckerkettenstruktur (Zuckerart, Bindungsstelle, Kettenlänge und dergleichen), die an einen Proteinteil gebunden ist, unbehindert variiert und reguliert werden kann.

Solche Ketten aus Glycoprotein werden grob klassifiziert in den Asn-gebundenen Typ, Mucintyp, O-GlcNAc-Typ, GPI-Ankertyp und Proteoglycantyp und dergleichen (Makoto Takeuchi, Glycobiology Series 5, Glycotechnology, herausgegeben von Akira Kobata, Sen-ichiro Hakomori, und Katsutaka Nagai, Kodansha Scientific, 191-208 (1994)), wobei jeder davon einen inhärenten Biosyntheseweg hat und eine separate physiologische Funktion leitet. Man weiß viel über den biosynthetischen Weg einer Asn-gebundenen Zuckerkette, da diese im Detail untersucht wurde.

Die Biosynthese einer Asn-gebundenen Zuckerkette wird wie folgt durchgeführt. Ein Vorläufer, umfassend N-Acetylglucosamin, Mannose und Glucose, wird auf einem Lipid-Träger-Zwischenprodukt synthetisiert und wird zunächst auf eine spezifische Sequenz (Asn-X-Ser oder Thr) des Glycoproteins auf einem endoplasmatischen Retikulum (ER) übertragen. Der Vorläufer wird anschließend verarbeitet (Spaltung eines Glucoserestes und eines spezifischen Mannoserestes) und eine M8-hohe Zuckerkette vom Mannosetyp (Man8GlcNAc2), bestehend aus 8 Mannoseresten und 2 N-Acetylglusoaminresten, wird synthetisiert. Protein, das die Zuckerkette vom hohen Mannosetyp enthält, wird zum Golgikomplex transportiert und verschiedenen Modifikationen unterworfen. Die Modifizierung am Golgikomplex bei Hefe unterscheidet sich stark von der bei Säugern (Gemmill, T. R., Trimble, R. B., Biochim. Biophys. Acta., 1426, 227 (1999).

In Säugerzellen wirkt &agr;-Mannosidase I häufig auf die Zuckerkette vom hohen Mannosetyp und spaltet unterschiedliche Mannosereste. Eine Zuckerkette, die durch dieses Verfahren hergestellt wird, (Man5-8-GlcNAc2) wird als Zuckerkette vom hohen Mannosetyp bezeichnet. N-Acetylglucosaminyltransferase (GnT) I wirkt auf eine M5 hohe Zuckerkette vom Mannosetyp (Man5GlcNAc2), die durch Spaltung von 3 Mannoseresten entsteht, wodurch ein N-Acetylglucosaminrest übertragen und eine Zuckerkette, bestehend aus GlcNAcMan5GlcNAc2, hergestellt wird. Die so erhaltene Zuckerkette wird als Hybridtyp bezeichnet. Wenn &agr;-Mannosidase II und GnT-II wirken, wird darüber hinaus eine Zuckerkettenstruktur hergestellt, die als Komplextyp bezeichnet wird, d. h. GlcNAc2Man3GlcNAc2. Danach wirken ungefähr 10 Glycosyltransferasetypen und binden N-Acetylglucosamin, Galactose, Sialinsäure und dergleichen, um verschiedene Zuckerketten vom Säugertyp zu bilden (1). Bei Säugern sind eine Zuckerkette vom hohen Mannosetyp, Hybridtyp oder Komplextyp zu beobachten. Die zu bindenden Zuckerketten unterscheiden sich in Abhängigkeit des Proteintyps, und in einigen Fällen werden unterschiedliche Zuckerketten an ein und dasselbe Protein gebunden. Diese Zuckerketten entfalten ausgezeichnete Wirkungen bei der Biosynthese von Glycoproteinen, beim Sortieren innerhalb der Zelle, beim Verbergen von Antigenität, bei der in vivo-Stabilität, und bei auf Organe gerichteten Eigenschaften und dergleichen, wobei es von dem Typ der Zuckerkette und der Vielzahl der gebundenen Zuckerketten abhängt (Tamao Endo, Tosa Kogaku (Glycoengineering), Sangyo Chosakai, 64-72 (1992)).

Im Fall von Erythropoietin, das erste pharmazeutisch hergestellte Glycoprotein, das eine rekombinante Tierzelle als Wirtszelle verwendet, ist die Bedeutung der Zuckerkette dargetan. Die Zuckerkette von Erythropoietin inhibiert die Bindung an einen Rezeptor; die Zuckerkette wirkt dennoch definitiv bei der Beibehaltung der aktiven Struktur und der Verbesserung der Pharmacokinetik mit. Dies deutet darauf hin, dass die Zuckerkette von Erythropoietin insgesamt für das Ausdrücken der pharmakologischen Aktivität wesentlich ist (Takeuchi und Kobata, Glycobiology, 1, 337-346 (1991)). Darüber hinaus wurde eine starke Korrelation zwischen einer Zuckerkettenstruktur, dem Typ, der Zahl der Verzweigungen (die Zahl der Verzweigungen, die aus GlcNAc, das an Man3GlcNAc2 gebunden ist, gebildet wird) und einer pharmakologischen Wirkung von Erythropoietin hergestellt (Takeuchi et al., Proc. Natl. Acad. Sci. USA, 86, 7819-7822 (1989)). Der Hauptgrund dieses Phänomens wird wie folgt erklärt: Mit einem Erythropoietin, bei dem eine verzweigte Struktur nicht entwickelt ist, erhöht sich die Klärungsgeschwindigkeit in einer Niere und als Ergebnis wird die Verweilzeit im Körper kürzer (Misaizu et al., Blood, 86, 4097-4104 (1995)). Beispiele, die mit diesem ähnlich sind, können bei einem Serum Glycoprotein, wie Fetuin und dergleichen, festgestellt werden, bei dem die Entfernung einer Sialinsäure an einem Zuckerkettenende Galactose bloßlegt, was dazu führt, dass es Lectin auf der Oberfläche einer Leberzelle erkennt und das Glycoprotein schnell aus dem Blut verschwindet (Ashwell und Harford, Annu. Rev. Biochem., 51, 531-554 (1982); Morell et al., J. Biol. Chem., 243, 155-159 (1968)).

Viele der Enzymgruppen, die sich im menschlichen Lysosom befinden, werden bio-synthetisiert und zum Golgikomplex transportiert, wo eine Phosphatgruppe an einen nicht reduzierenden terminalen Mannoserest an Position 6 der Zuckerkette vom hohen Mannosetyp gebunden wird. Dies ist ein Erkennungsmarker, der für ein Lysosomenzym spezifisch ist. Anschließend wird durch Bindung an den Mannose-6-Phosphatrezeptor (MPR) als hoch affinitiver Rezeptor das Lysosomenzym von den anderen Proteinen getrennt und zu einem Prälysosom transportiert. Nach dem Dissoziieren vom MPR unter sauren Bedingungen wird das Enzym weiter zu einem Lysosom transportiert (von Figura and Hasilik, Annu. Rev. Biochem., 54, 167-193 (1984)). Die Additionsreaktion einer Phosphatgruppe, die für Lysosomenzyme spezifisch ist, wird durch zwei Enzymsreaktionstypen durchgeführt. In dem Fall, in dem Gene für diese Reaktionen genetische Defekte aufweisen, ist bekannt, dass eine Fehlsteuerung in einem Targeting-Mechanismus zum Lysosym auftritt und eine schwere Erkrankung, generell als lysosomale Erkrankung bezeichnet, auftritt (Leroy and DeMars, Science, 157, 804-806 (1967). Daher kann gesagt werden, dass die Wirkungen sich signifikant in Abhängigkeit ihrer Strukturen unterscheiden.

Auf der anderen Seite wird im Fall von Hefe eine Zuckerkette vom Mannantyp (äußere Zuckerkette) hergestellt, bei der mehrere bis zu 100 oder mehr Mannosereste an eine M8-hohe Zuckerkette vom Mannosetyp gebunden werden. Die Biosynthese einer äußeren Zuckerkette bei der Hefe Saccharomyces wird voraussichtlich entlang einem in 2 und 3 gezeigten Weg durchgeführt (Ballou et al., Proc. Natl. Acad. Sci. USA, 87, 3368-3372 (1990)). Das heißt, eine Reaktion zum Anstoßen der Verlängerung beginnt, wobei eine Mannose über eine &agr;-1,6-Bindung zunächst an eine M8-hohe Zuckerkette vom Mannosetyp gebunden wird (2, Reaktion I, B). Es wurde aufgeklärt, dass das Enzym, das diese Reaktion durchführt, ein Protein ist, das durch das OCH1-Gen kodiert wird (Nakayama et al., EMBO J., 11, 2511-2519 (1992)). Eine schrittweise Verlängerungsreaktion mit Mannose (2, II) über eine &agr;-1,6-Bindung bildet eine Poly-&agr;-1,6-Mannosebindung als Grundgerüst für eine äußere Zuckerkette (2, E). An die &agr;-1,6-gebundene Mannose kann verzweigte &agr;-1,2-gebundene Mannose binden (2, 3: C, F, H). Zusätzlich kann an das Ende der verzweigten &agr;-1,2-gebundenen Mannosekette &agr;-1,3-gebundene Mannose binden (2, 3: D, G, H, I). Die Addition von &agr;-1,3 gebundener Mannose wird durch ein MNN1-Genprodukt verursacht (Nakanishi-Shindo et al., J. Biol. Chem., 268, 26338-26345 (1993)). Saure Zuckerketten können hergestellt werden, wobei ein Mannose-1-Phosphat an einen Zuckerkettenteil vom hohen Mannosetyp und einen äußeren Zuckerkettenteil gebunden wird (2, *; eine Stelle, die phosphoryliert werden kann (eine potentielle Phosphorylierungsstelle, entsprechend * in der obigen Formel (I)). Es wurde festgestellt, dass diese Reaktion durch ein Protein verursacht wird, das durch das MNN6-Gen kodiert wird (Wang et al., J. Biol. Chem., 272, 18117-18124 (1997)). Darüber hinaus wurde ein Gen (MNN4), das ein Protein kodiert, das positiv die Umlagerungsreaktion reguliert, aufgedeckt (Odani et al., Glycobiology, 6, 805-810 (1996); Odani et al., FEBS letters, 420, 186-190 (1997)).

In vielen Fällen stellen äußere Zuckerketten heterogene Proteinprudukte her, wodurch die Proteinreinigung erschwert wird oder die spezifische Aktivität der Proteine verringert wird (Bekkers et al., Biochim. Biophys. Acta, 1089, 345-351 (1991)). Da sich Zuckerkettenstrukturen stark unterscheiden, kann darüber hinaus biologische Aktivität, die dentisch mit derjenigen, die vom Säuger abstammt, in einem durch Hefe hergestellten Glycoprotein nicht nachgewiesen werden, oder das Glycoprotein kann starke Immunogenität gegen Säuger und dergleichen aufweisen. Folglich ist als Wirt bei der Herstellung nützlicher von Säugern abstammender Glycoproteine Hefe vermutlich ungeeignet. Die Entwicklung einer Hefe, die ein Glycoprotein mit biologischer Aktivität herstellen kann, die äquivalent mit der vom Säuger abstammenden ist, d. h. ein Glycoprotein, das eine Zuckerkette vom Säugertyp enthält, ist folglich von den Hochschulen und der Industrie gewünscht.

Zum Herstellen einer Zuckerkette vom Säugertyp unter Verwendung von Hefe, ist es folglich wichtig, eine Mutante zu isolieren, die ein Zuckerkettenbiosynthesesystem aufweist, bei dem viele Mannosen gebunden werden, wobei diese Mutante eine modifizierte Glycoproteinzuckerkette aufweist, die spezifisch für Hefe ist, und zu Beginn, die oben beschriebene Reaktion nicht auftritt, also eine äußere Zuckerkette nicht gebunden wird und die Synthese einer Zuckerkette bei einer M8-hohen Zuckerkette vom Mannosetyp anhält. Anschließend könnte die Zuckerkette vom Säugertyp durch Einführung von biosynthetischen Genen für die Zuckerkette in die Hefemutante hergestellt werden, wobei eine Zuckerkette vom Säugertyp an eine M8-hohe Zuckerkette vom Mannosetyp angehängt wird, d. h. an einen Vorläufer für diese Zuckerkette vom Säugertyp.

Um ein Glycoprotein zu erhalten, dem die äußere Zuckerkette fehlt, wurde daher die Verwendung eines mutanten Stammes, bei dem die Enzyme zur Herstellung äußerer Zuckerketten in der Hefe fehlerhaft waren, untersucht. Ein fehlerhafter mutanter Stamm kann durch Erhalt einer Mutante unter Verwendung von Medikamenten, ultravioletter Bestrahlung oder natürlicher Mutation oder durch künstliches Zerstören eines Zielgens bereitgestellt werden.

Es gibt mehrere Berichte über das vorherige Verfahren. Zum Beispiel hat die mnn2-Mutante einen defekten Verzweigungsschritt, was eine &agr;-1,2-Bindung aus einem &agr;-1,6-Gerüst einer äußeren Zuckerkette bewirkt, eine mnn1-Mutante hat einen defekten Herstellungsschritt bei der &agr;-1,3-gebundenen Mannose am Ende einer Verzweigung. Diese Mutanten weisen jedoch keinen Defekt in der &agr;-1,6-Mannosebindung als Grundgerüst einer äußeren Zuckerkette auf und folglich stellen sie lange äußere Zuckerketten her. Die mnn7-, 8-, 9-, und 10-Mutanten werden z. B. isoliert als Mutanten mit nur ungefähr 4 bis 15 &agr;-1,6-gebundenen Mannosemolekülen. Das verkürzt lediglich die äußere Zuckerkette dieser Mutanten, aber die Zuckerkettenverlängerung ist nicht bei der Zuckerkette vom hohen Mannosetyp beendet (Ballou et al., J. Biol. Chem., 255, 5986-5991 (1989)). Defekte beim Additionsmechanismus der äußeren Zuckerkette können z. B. beobachtet werden bei Sekretionsmutanten, wie sec18, bei der der Proteintransport vom endoplasmatischen Retikulum zum Golgikomplex temperaturempfindlich ist. Bei einer sec-Mutante ist jedoch die Absonderung eines Proteins selbst durch eine hohe Temperatur gehemmt und folglich eignet sich die sec-Mutante nicht zur Absonderung und Herstellung von Glycoproteinen.

Da diese Mutanten nicht vollständig eine Zuckerkette vom hohen Mannosetyp biosynthetisieren können, werden sie folglich als ungeeignete Wirtszelle zur Herstellung einer Zuckerkette vom Säugertyp angesehen.

Indessen wurde ein Weg für die Zuckerkettenbiosynthese auf dem endoplasmatischen Reticulum (ER) in Hefe aufgedeckt, indem eine Mutante mit einigen Defekten in unterschiedlichen Phasen der Biosynthese isoliert und die isolierte Mutante biochemisch analysiert wurde. Eine alg (Asparagin-gebundene Glycosylierung)-Mutante wurde durch ein fachkundiges Auswahlverfahren isoliert, wobei Mutanten, bei denen ein Schaden/Extinktion durch Bestrahlung vermieden wurde, konzentriert wurden, da die Einführung von [3H]-Mannose in dessen Zuckerkette weniger betrug als bei einer Wildtypzelle mit einer äußeren Zuckerkette. Unter diesen häufte eine alg3-Mutante Dol-pp-GlcNAc2-Man5 (Dol-pp stellt Dolicholpyrophosphat dar) an bei nicht erlaubter Temperatur (Tanner, W. et al., Biochim. Biophys. Acta., 906, 8199 (1987)). Jigami et al. führten ebenfalls eine Untersuchung unter Verwendung einer Tripelmutante &Dgr;och1mnn1alg3 durch (Jigami et al., TanpakushitsuKakusanKoso, vol. 39, Nr. 4, S. 657 (1994)). Eine Zuckerkette vom Mannoprotein wurde einer Fluoreszenzmarkierung unter Verwendung von PA (2-Aminopyridin) unterworfen und wurde anschließend untersucht. Die Hauptbestandteile entfalteten als Folge zwei Höchstwerte entsprechend Man8GlcNA2-PA und Man5GlcNAc2-PA. Die Ergebnisse vom &agr;-1,2-Mannosidase-Verdau, FAB-MS und dergleichen, weisen darauf hin, dass der Erstere identisch mit der ER-Kernzuckerkette war. Im Gegensatz dazu entfernte hinsichtlich des Letzteren der &agr;-1,2-Mannosidase-Verdau zwei Man-Moleküle und stellte Man2GlcNAc2-PA her und die spezifische Spaltung von &agr;-1,6-gebundenem Man (Teilacetolyse) entfernte nur 1 Man-Molekül. Diese Ergebnisse zeigen, dass die durch diese Dreifachmutante hergestellte Man5GlcNAc2-PA-Zuckerkette eine unvollständige Zuckerkettenkernstruktur, wie in der obigen Formel II gezeigt, aufwies. Diese Dreifachmutante stellte nicht nur Man5GlcNAc2 her, sondern auch Man8GlcNAc2, da durch die alg3-Mutation die Anhäufung von Man5GlcNAc2-pp-Dol auf Dolicholpyrophosphat undicht ist.

In Bezug auf das Letztere haben kürzliche Entwicklungen in der Gentechnik im Gegensatz dazu die Herstellung einer defizienten Mutante ermöglicht, bei der eine Zahl von Zielgenen zerstört ist.

Hefe, die eine auxotrophe Mutation aufweist, ist bekannt und eine auxotrophe Mutation umfasst die leu2-Mutation, trp1-Mutation, ura3-Mutation, ade2-Mutation und his3-Mutation (Yasuji Oshima, Schreiber und Herausgeber, Seibutsukagaku Jikkenho 39, Kobo Bunshi Idengaku Jikkenho, 199-144 (1996)). Die Einführung eines Ursprungsgens in die von einer Mutation freie Mutante kann diese auxotrophen Eigenschaften ausschalten und das Hefewachstum ermöglichen, ohne dass ein wesentlicher Bestandteil dem Medium zugeführt werden muss. Auf Basis dieses Prinzips können Hefegene gestört werden (4). Bei diesem Verfahren wird durch einen in vitro-Vorgang die Zielgen-DNA auf einem Plasmid zunächst fragmentiert oder teilweise deletiert und anschließend wird eine adäquate Selektionsmarker-Gen-DNA eingeführt, um ein Konstrukt herzustellen, bei dem sich ein Selektionsmarker zwischen dem Bereich stromaufwärts und stromabwärts des Zielgens befindet. Daraufhin wird die lineare DNA mit dieser Struktur in eine Hefezelle eingeführt, um zwei Rekombinationen an einem homologen Teil zwischen beiden Enden des eingeführten Fragments und einem Zielgen auf dem Chromosom zu bewirken, wodurch ein DNA-Konstrukt, bei dem ein Selektionsmarker eingelegt ist, ersetzt wird (Rothstein, Methods Enzymol., 101, 202-211 (1983)). Dieses Verfahren erfordert einen Selektionsmarker, um ein Gen zu zerstören.

Molekularzüchtung eines Hefestammes, dem seine äußere Zuckerkette fehlt, wurde bereits in den offengelegten japanischen Patenten mit den Nummern Hei6-277086 (277086/1994) und Hei9-266792 (266792/1997) offenbart. Eine Glycoprotein-Zuckerkette, die aus einer Doppelmutante (&Dgr;och1&Dgr;mnn1) hergestellt ist, die in dem japanischen offengelegten Patent Nr. 277086/1994 beschrieben ist, umfasste eine saure Zuckerkette, die einen Phosphorsäurerest enthält. Diese saure Zuckerkette hat eine Struktur, die in einer Zuckerkette, die von Säugern abstammt, wie z. B. vom Menschen, nicht anwesend ist, und sie kann als Fremdsubstanz in einem Säugerkörper erkannt werden und daher Antigenität entfalten (Ballou, Methods Enzymol, 185, 440-470 (1990)). Demzufolge wurde eine Vierfachmutante (in dem offengelegten japanischen Patent Nr. 266792/1997 beschrieben) hergestellt, bei der eine Funktion eines Gens, die sich positiv auf die Regulierung der Übertragung von Mannose-1-phosphat (MNN4) und eine Funktion eines Mannosetransferasegens, die eine Verlängerungsreaktion für eine O-gebundene Zuckerkette (KRE2) durchführt, zerstört. Es wurde gezeigt, dass eine Zuckerkette eines Glycoproteins, das durch diesen oben beschriebenen Hefestamm hergestellt wird, eine Struktur einer Zuckerkette von Interesse, vom M8-hohen Mannosetyp aufwies. Ein Stamm, bei dem ein vom Aspergillus saritoi abstammendes &agr;-1,2-Mannosidase-Gen in diese Hefemutante eingeführt wird, hat eine Zuckerkette vom hohen Mannosetyp (Man5-8GlcNAc2), bei dem ein oder mehrere Mannosereste gespalten werden (Chiba et al., J. Biol. Chem., 273, 26298-26304 (1998)).

Shimma et al. stellten eine unterschiedliche Art einer Vierfachmutante her, bei dem außerdem eine alg3-Mutation eingeführt wurde (Shimma Y. et al., Mol. Gen. Genet., 256, 469-480 (1997); Wang et al., J. Biol. Chem. 272, 18117-18124 (1997); Yoichi Shimma, Yoshifumi Jigami, Abstracts of 32nd Forum of the Yeast Genetics Society of Japan, S. 64 (1999); Shimma Y. et al., Abstracts of XIX International Conference On Yeast Genetics and Molecular Biology, S. 443 (1999)).

Eine Zuckerkette des Glycoproteins, das durch diese Hefestämme hergestellt wird, kommt auch in Säugern vor, und hat demzufolge keine Antigenität. Wie im Fall des Erythropoietin-Beispiels kann ein Glycoprotein, das eine Zuckerkette vom hohen Mannosetyp enthält, jedoch keine Aktivität entfalten, die äquivalent mit einem Glycoprotein ist, das von Säugerzellen hergestellt wird, und zwar aufgrund dessen Zuckerkettenstruktur. Bei dieser Vierfachmutante können zudem vier Selektionsmarker (leu2, ura3, lys2, trp1) nicht mehr verwendet werden, die für die rezessiven Mutationen der Zerstörung der Zielgene verwendet worden sind. Einer der auxotrophen Restmarker ist anstatt durch Mutation künstlich zerstört und folglich kann keine Einführung in ein Hefechromosom unter Verwendung von Homologie mit diesen Markergenstellen auf dem Chromosom durchgeführt werden. Folglich ist es schwierig, in diese Hefestämme etliche Gene einzuführen, die zur Gruppe der Enzyme der Zuckerkettenhydrolysegene, zur Gruppe der Glycosyltransferasegene, zur Gruppe der Zuckernucleotidtransportergene, die zur Herstellung von einer Zuckerkette vom Säuger-Typ notwendig ist, gehören oder von Genen, die zur Herstellung von Glycoprotein nützich sind. Wie oben beschrieben, sind mehr oder weniger zehn Gruppen von Transferasen zur Herstellung einer Zuckerkette vom Säugertyp notwendig, und der Einsatz einer Hefezelle als Wirt wird als ungeeignet angesehen, um eine Zuckerkettenstruktur zu ändern oder zu regulieren.

Chiba et al. J. Biol. Chem., vol. 273, Nr. 41, 9. Oktober 1998, Seiten 26298-26304, offenbart Saccharomyces cerevisiae-Mutanten mit einer Zerstörung in den Genen och1, mnn1 und mnn4. Außerdem ist die Herstellung von Glycoproteinen mit einer „Hybrid" Man5GlcNAc2-Struktur offenbart. Die Einführung des GnT-I-Gens in die Wirtszellen ist nicht beschrieben.

Yoshida et al., Glycobiology, vol. 9, 1999, Seiten 53-58, führt aus, dass GnT-I für die Umwandlung von N-Glycanen vom hohen Mannosetyp zu Hybrid- und Komplextyparten wesentlich ist. In diesem Dokument wurde die GnT-I Aktivität nur in vitro bestätigt, wenn Oligosaccharide verwendet wurden. Dieses Dokument führt außerdem aus, dass in A. nidulans GnT-I in vitro aktiv ist, aber nicht in vivo wirkt.

Nakanishi-Shindo et al., J. Biol. Chem., 268, Seiten 26338-26345 (1993), offenbart och1-, mnn1-, alg3-Dreifachmutanten von Saccharomyces cerevisiae, wobei das och1-Gen zerstört ist und die mnn1- und alg3-Gene mutiert sind. Die Aktivität des alg3-Genproduktes verbleibt, da das alg3 nicht vollständig zerstört ist, sondern lediglich durch die Natur mutiert ist.

Verostek et al., J. Biol. Chem., vol. 268, Nr. 16, 5. Juni 1996, Seiten 12104-121154, ist ein weiteres Dokument über alg3-Mutanten. Es betrifft die Glycoprotein-Biosynthese in einer alg3-Saccharomyces cerevisiae-Mutante.

Die Aufgabe der vorliegenden Erfindung ist es, die obigen Probleme bei der Herstellung von Asn-gebundenem Glycoprotein in Hefe zu bewältigen und ein Verfahren bereitzustellen zur Herstellung einer Zuckerkette mit einer Zuckerkettenstruktur, die identisch mit der eines hohen Mannosetyps, eines Hybridtyps und eines Komplextyps ist, die von menschlichen Zellen oder anderen Säugerzellen hergestellt wird, und ein Glycoprotein bereitzustellen, das die Zuckerkette umfasst unter Verwendung von Hefe.

Offenbarung der Erfindung

Durch sorgfältige Untersuchungen, die seitens der Erfinder durchgeführt wurden, die sich der obigen Aufgabe annahmen, wurde als Folge eine neue Hefemutante (auxotrophe Dreifachmutante) erfolgreich hergestellt, bei der unter den Genen, die zur Biosynthese einer Hefe-spezifischen äußeren Zuckerkette, ein Gen (OCH1), das &agr;-1,6-Mannosyltransferase kodiert, die eine Anfangsverlängerungs-Additionsreaktion durchführt, ein Gen (MNN1), das &agr;-1,3-Mannosyltransferase kodiert, das Mannose zu einem nicht reduzierenden Ende einer Zuckerkette hinzufügt, und ein Gen (MNN4), das die Addition von Mannose-1-phosphat reguliert, zerstört worden sind, während eine auxotrophe Mutation, die einen Selektionsmarker betrifft, beibehalten wird, d. h. ohne letztendlich Gene einzuführen, die auxotrophe Eigenschaften komplementieren. Die Mutante kann eine Zuckerkette mit einer identischen Zuckerkettenstruktur zu einer Zuckerkettenstruktur vom Säugertyp herstellen. Darüber hinaus können verschiedene Zuckerketten vom Säugertyp hergestellt werden durch Einführung von Genen für die Synthese einer Zuckerkette vom Säugertyp in die Mutante.

Insbesondere betrifft die Erfindung Folgendes:

  • 1. Verfahren zur Herstellung einer Hefemutante, die ein Glycoprotein herstellt, das eine Zuckerkette, dargestellt durch die nachfolgend aufgeführte Formel (IV), aufweist:
    wobei Man Mannose darstellt und GlcNAc N-Acetylglucosamin darstellt, und wobei das Verfahren die Schritte umfasst:

    Zerstören des MNN1-Gens, MNN4-Gens und OCH1-Gens in einer Hefe vom Wildtyp; und

    Einführen eines Gens, das &agr;-Mannosidase I mit einem C-terminalen ER-Retentionssignal kodiert und eines GnT-I-Gens, das den ORF umfasst, in die Hefe.
  • 2. Verfahren zur Herstellung einer Hefemutante, das die Schritte umfasst:

    Zerstören des MNN1-Gens, MNN4-Gens und OCH1-Gens in einer Hefe vom Wildtyp; und

    Einführen eines Gens, das &agr;-Mannosidase I mit einem C-terminalen ER-Retentionssignal kodiert und eines GnT-I-Gens, das den ORF umfasst, eines &agr;-Mannosidase II-Gens und eines GnT-II-Gens, in die Hefe.
  • 3. Verfahren zur Herstellung einer Hefemutante, das die Schritte umfasst:

    Zerstören des ALG3-Gens, des MNN1-Gens, des MNN4-Gens und des OCH1-Gens in einer Hefe vom Wildtyp; und

    Einführen eines Gens, das eine &agr;-Mannosidase I mit einem C-terminalen ER-Retentionssignal kodiert, in die Hefe.
  • 4. Verfahren nach Anspruch 3, außerdem umfassend das Einführen eines GnT-I-Gens, das den ORF umfasst, und eines GnT-II-Gens in die Hefe.
  • 5. Verfahren nach einem der vorhergehenden Ansprüche, wobei die Hefemutante mindestens eine auxotrophe Mutation aufweist, ausgewählt aus einer ura3-Mutation, his3-Mutation, leu2-Mutation, ade2-Mutation, trp1-Mutation und can1-Mutation.
  • 6. Verfahren nach einem der vorhergehenden Ansprüche, wobei die Hefemutante eine ura3-Mutation aufweist.
  • 7. Verfahren nach einem der vorhergehenden Ansprüche, wobei das &agr;-Mannosidase I-Gen von Aspergillus saitoi abstammt.
  • 8. Verfahren zum Herstellen einer Hefemutante nach den Ansprüchen 1 bis 7, das das Zerstören des OCH1-Gens mit einem Uracil-Marker umfasst.
  • 9. Verfahren nach Anspruch 8, wobei der Uracil-Marker ura3 ist.
  • 10. Verfahren zur Herstellung eines Glycoproteins mit einer Zuckerkette, dargestellt durch die nachfolgende Formel (IV):
    wobei Man Mannose darstellt und GlcNAc N-Acetylglucosamin darstellt, wobei das Verfahren die Schritte umfasst:

    – Kultivieren der Hefemutante, hergestellt durch das Verfahren nach Anspruch 1 in einem Medium,

    – Herstellen und Anhäufen des Glycoproteins in dem Kulturprodukt, und

    – Sammeln des Glycoproteins aus dem Kulturprodukt.
  • 11. Mutante Hefe, hergestellt durch eines der Verfahren nach den Ansprüchen 1 bis 9.

Die Beschreibung umfasst den Inhalt der Beschreibung und/oder der Abbildungen der japanischen Patentanmeldung Nr. Hei11-233215 (233215/1999), die das Prioritätsdokument dieser Anmeldung ist.

Kurze Beschreibung der Abbildungen

1 zeigt einen biosynthetischen Weg einer N-gebundenen Zuckerkette, die in Säugern allgemein vorkommt.

2 zeigt einen biosynthetischen Weg einer N-gebundenen Zuckerkette in Hefe (S. cerevisiae), wobei H, C, E jeweils zu I, D, F in 3 führen.

3 zeigt einen biosynthetischen Weg (Fortsetzung) einer N-gebundenen Zuckerkette in Hefe (S. cerevisiae).

4 zeigt ein herkömmliches Verfahren zum Zerstören eines Hefegens.

5 zeigt ein Verfahren zum Zerstören von Genen, ohne schließlich Gene einzuführen, die eine auxotrophe Eigenschaft komplementieren.

6 zeigt eine analysierte Struktur einer Zuckerkette eines Mannoseproteins auf der Zelloberfläche des TIY19-Stammes.

7 zeigt die Struktur einer Zuckerkette eines Mannoproteins auf der Zelloberfläche des TIY19-Stammes, in den das &agr;-1,2-Mannosidasegen eingeführt wurde, wobei zur Analyse eine Amid-80-Säule verwendet wurde.

  • a: eine Zuckerkette eines Mannan-Glycoproteins des TIY19-Stammes
  • b: eine Zuckerkette eines Mannan-Glycoproteins des TIY19-Stammes, in den &agr;-1,2-Mannosidase eingeführt wurde.

8 zeigt die Struktur einer Zuckerkette eines Mannoproteins auf der Zelloberfläche des TIY19-Stammes, in den das &agr;-1,2-Mannosidasegen eingeführt wurde, wobei zur Analyse eine ODS-80TM-Säule verwendet wurde.

  • a: eine Zuckerkette mit einer Struktur, dargestellt durch Formel III
  • b: eine in 6 erhaltene Fraktion.

9 zeigt ein Messergebnis der GnT-I-Aktivität.

10 zeigt die Struktur einer Zuckerkette eines Mannoproteins auf der Zelloberfläche des TIY19-Stammes, in den das &agr;-1,2-Mannosidasegen und das GnT-I-Gen eingeführt wurde, wobei zur Analyse eine Amid-80-Säule verwendet wurde.

  • A: analysierte Struktur einer Zuckerkette des TIY19-Stammes, in den nur ein Vektor eingeführt wurde
  • B: analysierte Struktur einer Zuckerkette des TIY19-Stammes in den das &agr;-1,2-Mannosidasegen und das GnT-I-Gen eingeführt wurden

    a: Man5GlcNAc2-PA

    b: GlcNAcMan5GlcNAc2-PA

    c: Man6GlcNAc2-PA

    d: Man7GlcNAc2-PA

    e: Man8GlcNAc2-PA

11 zeigt die Struktur einer Zuckerkette eines Mannoproteins auf der Zelloberfläche des TIY19-Stammes, in den das &agr;-1,2-Mannosidasegen und das GnT-I-Gen eingeführt wurden, wobei zur Analyse eine ODS-80TM-Säule verwendet wurde.

  • A: Mischung aus Standardprodukt
  • B: eine in 10.B. erhaltene Fraktion

12 zeigt die Westernblot-Analyse unter Verwendung eines Zellextraktes des YPH500-Stammes, in den das &agr;-Mannosidase-II-Gen eingeführt wurde.

  • A: Ergebnis der Westernblot-Analyse eines Zellextraktes aus dem YPH500-Stamm, in den nur ein Vektor (pYEX-BX-3HA) eingeführt wurde.
  • B: Ergebnis der Westernblot-Analyse eines Zellextraktes aus dem YPH500-Stamm, in den ein Vektor (pYEOM2-HA), der ein chimäres &agr;-Mannosidase-II-Gen enthält, eingeführt wurde.

13 zeigt ein Messergebnis der &agr;-Mannosidase-II-Aktivität unter Verwendung eines Zellextraktes aus dem YPH500-Stamm, in den das &agr;-Mannosidase-II-Gen eingeführt wurde.

  • A: Messergebnis der Aktivität im YPH500-Stamm, in den nur ein Vektor (pYEX-BX-3HA) eingeführt wurde.
  • B: Messergebnis der Aktivität in dem YPH500-Stamm, in den ein Vektor (pYEOM2-HA), enthaltend ein chimäres &agr;-Mannosidase-II-Gen, eingeführt wurde.

    a: GlcNAcMan5GlcNAc2-PA

    b: GlcNAcMan3GlcNAc2-PA

14 zeigt eine Struktur der FGF-Zuckerkette des TIY 48-Stammes, in den das FGF-Gen eingeführt wurde (obere Abbildung) und des TIY 53-Stammes, in den das FGF-Gen und das &agr;-1,2-Mannosidasegen eingeführt wurden (untere Abbildung), wobei zur Analyse eine Amid-80-Säule verwendet wurde.

Beschreibung der Symbole

  • GlcNAc, GN:
    N-Acetylglucosamin
    Man, M:
    Mannose
    PA:
    2-Aminopyridylierung

Kurze Beschreibung der Sequenzliste

  • SEQ-ID Nr. 1 stellt den Primer A zum Amplifizieren des 5'-Bereiches vom MNN1-Gen dar.
  • SEQ-ID Nr. 2 stellt den Primer B zum Amplifizieren des 5'-Bereiches vom MNN1-Gen dar.
  • SEQ-ID Nr. 3 stellt den Primer C zum Amplifizieren des 3'-Bereiches vom MNN1-Gen dar.
  • SEQ-ID Nr. 4 stellt den Primer D zum Amplifizieren des 3'-Bereiches vom MNN1-Gen dar.
  • SEQ-ID Nr. 5 stellt den Primer E zum Amplifizieren des 3'-Bereiches vom MNN4-Gen dar.
  • SEQ-ID Nr. 6 stellt den Primer F zum Amplifizieren des 3'-Bereiches vom MNN4-Gen dar.
  • SEQ-ID Nr. 7 stellt den Primer G zum Amplifizieren des 5'-Bereiches vom MNN4-Gen dar.
  • SEQ-ID Nr. 8 stellt den Primer H zum Amplifizieren des 5'-Bereiches vom MNN4-Gen dar.
  • SEQ-ID Nr. 9 stellt den Primer I zum Amplifizieren des 5'-Bereiches vom ALG3-Gen dar.
  • SEQ-ID Nr. 10 stellt den Primer J zum Amplifizieren des 5'-Bereiches vom ALG3-Gen dar.
  • SEQ-ID Nr. 11 stellt den Primer K zum Amplifizieren des 3'-Bereiches vom ALG3-Gen dar.
  • SEQ-ID Nr. 12 stellt den Primer L zum Amplifizieren des 3'-Bereiches vom ALG3-Gen dar.
  • SEQ-ID Nr. 13 stellt den Primer M zum Amplifizieren des N-terminalen Bereiches vom &agr;-Mannosidase-II-Gen dar.
  • SEQ-ID Nr. 14 stellt den Primer N zum Amplifizieren des N-terminalen Bereiches vom &agr;-Mannosidase-II-Gen dar.
  • SEQ-ID Nr. 15 stellt den Primer O zum Amplifizieren eines zentralen Bereiches vom &agr;-Mannosidase-II-Gen dar.
  • SEQ-ID Nr. 16 stellt den Primer P zum Amplifizieren eines zentralen Bereiches vom &agr;-Mannosidase-II-Gen dar.
  • SEQ-ID Nr. 17 stellt den Primer Q zum Amplifizieren des C-terminalen Bereiches vom &agr;-Mannosidase-II-Gen dar.
  • SEQ-ID Nr. 18 stellt den Primer R zum Amplifizieren des C-terminalen Bereiches vom &agr;-Mannosidase-II-Gen dar.
  • SEQ-ID Nr. 19 stellt, dreimal wiederholt, eine Sequenz S doppelsträngiger DNA dar, die ein Gen für die HA-Tag-Bindung kodiert.
  • SEQ-ID Nr. 20 stellt eine Sequenz T doppelsträngiger DNA dar, die einen Transmembranbereich im OCH1-Gen kodiert.
  • SEQ-ID Nr. 21 stellt den Primer U zum Amplifizieren eines Teils eines katalytischen Bereiches vom &agr;-Mannosidase-II-Gen dar.
  • SEQ-ID Nr. 22 stellt den Primer V zum Amplifizieren eines Teils eines katalytischen Bereiches vom &agr;-Mannosidase-II-Gen dar.
  • SEQ-ID Nr. 23 stellt den Primer W zum Amplifizieren eines menschlichen UDP-GlcNAc-Transportergens dar.
  • SEQ-ID Nr. 24 stellt den Primer X zum Amplifizieren des humanen UDP-GlcNAc-Transportergens dar.
  • SEQ-ID Nr. 25 stellt den Primer Y zum Amplifizieren von humanem Prepro &agr;-Faktor und vom FGF-Gen dar.
  • SEQ-ID Nr. 26 stellt den Primer Z zum Amplifizieren von humanem Prepro &agr;-Faktor und vom FGF-Gen dar.

Erfindungsgemäße Ausführungsform

Die vorliegende Erfindung wird im Detail beschrieben.

Mutationsstämme, die für eine erfindungsgemäße Hefemutante wesentlich sind, sind Mutationen biosynthetischer Gene der äußeren Kette, die für Hefe spezifisch sind. Spezifische Beispiele sind die och1-Mutation, mnn1-Mutation und mnn4-Mutation, oder die och1-Mutation, mnn1-Mutation, mnn4-Mutation und alg3-Mutation.

Das bedeutet, dass die Hefemutante durch natürliche Mutation oder künstliche Mutation erhalten werden kann, solange es die obigen Mutationen aufweist.

Die auxotrophen Mutationsstämme zum Einführen exogener Gene in die erfindungsgemäße Hefemutante sind durch den verwendeten Hefestamm definiert. Speziell werden die Mutationsmerkmale ausgewählt aus der ura3-Mutation, his3-Mutation, leu2-Mutation, ade2-Mutation, trp1-Mutation und can1-Mutation. Die Zahl der auxotrophen Mutationsmerkmale hängt von der Zahl der einzuführenden Gene ab und ein auxotrophes Mutationsmerkmal wird im Allgemeinen benötigt, um ein Gen einzuführen. Wenn eine Mehrzahl von Genen eingeführt wird, ist das Fragment der einzuführenden Gene lang, die Einführungseffizienz ist verringert und folglich ist die Expressionseffizienz verringert. Folglich, je mehr Gene eingeführt werden, je größer die Zahl der erforderlichen auxotrophen Mutationsmerkmale.

Der Ausdruck „Gene, die eine auxotrophe Eigenschaft komplementieren", der hier verwendet wird, bezieht sich auf Gene zur Synthese von Körperzusammensetzungen, wie einer Aminosäure und Nucleinsäure. Ein Mutationsmerkmal enthält eine Mutation, bei der diese Gene nicht wirken und folglich sind komplementierende Gene selbst ursprünglich wirkende Gene. Daher sind Gene, die vom Ursprungshefestamm abstammen, bevorzugt.

Der Ausdruck „ohne letztlich Gene einzuführen, die eine auxotrophe Eigenschaft komplementieren" oder „ohne endgültiges Einführen von Genen, die eine auxotrophe Eigenschaft komplementieren" bedeutet ein Phänomen, bei dem ein oder mehrere Selektionsmarker, d. h. auxotrophe Mutationsmerkmale, bei der Zerstörung von einem oder mehreren Genen (Einführung des Mutationsmerkmals) eingesetzt werden, wobei die Zahl der auxotrophen Merkmale, die zurückbleiben, die gleiche ist, wie die Zahl der zerstörten Gene nach der Zerstörung, und die gleichen auxotrophen Stämme können wiederholt bei einer anderen Genzerstörung verwendet werden (siehe 5).

Die erfindungsgemäße Hefemutante, in der ein auxotrophes Mutationsmerkmal zum Einführen exogener Gene beibehalten wird, während Hefe-spezifische Gene zur Biosynthese der äußeren Zuckerkette zerstört werden (hiernach als auxotropher Mutant bezeichnet), kann wie folgt hergestellt werden.

Zu Beginn, hinsichtlich der Isolierung eines DNA-Genfragmentes, das zum Zerstören eines Zielgens notwendig ist, ist dessen Lage auf dem Chromosom aufgrund des Genomprojektes mit Saccharomyces cerevisiae bekannt (Goffeau et al., Nature, 387 (suppl.), 1-105 (1997)), und folglich sind Genfragmente, einschließlich naheliegender Zielgene, von öffentlichen Einrichtungen erhältlich, wie von ATCC (American Type Culture Collection) in den USA (ATCC recombinante DNA-Materialien, 3. Ausgabe, 1993). Es ist auch möglich, Genom-DNA aus S. cerevisiae durch ein allgemeines Verfahren zu extrahieren und die Zielgene auszuwählen. Die Extraktion von Genom-DNA aus S. cerevisiae kann durchgeführt werden gemäß z. B. einem Verfahren von Cryer et al. (Methods in Cell Biology, 12, 39-44 (1975) und einem Verfahren von P. Philippsen et al. (Methods Enzymol., 194, 169-182 (1991).

Die Zielgene werden durch PCR amplifiziert und anschließend wird eine Genzerstörung durchgeführt. PCR kann das spezifische DNA-Fragment mehrere hundert bis tausend Male oder mehr in ungefähr 2 bis 3 Stunden in vitro amplifizieren, wobei eine Kombination aus Sinn-Antisinnprimern an beiden Enden des Bereichs, hitzebeständige DNA-Polymerase, ein DNA-Amplifizierungssystem und dergleichen verwendet werden. Bei der Amplifizierung der Zielgene werden 25 bis 30 synthetische einzelsträngige DNA als Primer verwendet und Genom-DNA wird als Matrize verwendet.

Erfindungsgemäß wird die Zerstörung der Zielgene im Wesentlichen gemäß einem Verfahren von Rothstein durchgeführt, Methods, Enzymol., 101, 202-211 (1983). Bei diesem Verfahren wird eine Zielgen-DNA auf einem Plasmid zunächst fragmentiert oder teilweise deletiert, eine adäquate Selektionsmarker-Gen-DNA wird eingeführt, um eine Struktur zu erzeugen, bei der ein Selektionsmarker sich zwischen dem stromaufwärts liegenden Bereich und dem stromabwärts liegenden Bereich des Zielgens befindet. Danach wird diese Struktur in eine Hefezelle eingeführt. Der obige Vorgang bewirkt zwei Rekombinationen an einem homologen Teil zwischen beiden Enden des eingeführten Fragmentes (DNA-Struktur, in der ein Selektionsmarker eingelegt ist) und einem Zielgen auf dem Chromosom, wodurch das Zielgen auf dem Chromosom durch das eingeführte Fragment ersetzt wird.

Spezifische Erläuterungen werden unter Verwendung eines Beispiels zur Herstellung eines MNN1-Gen-zerstörten Stammes bereitgestellt. Die hisG-URA3-hisG-Cassette wird mit einem Restriktionsenzym aus einem Plasmid ausgeschnitten, wobei ein Salmonellen-hisG-Gen-DNA-Fragment an beide Enden eines URA3-Gens gemäß Alani et al., (Alani et al., Genetics, 116, 541-545 (1987)) gebunden wird und in ein Zielgen auf einem Plasmid eingeführt wird, um ein zerstörtes Allel herzustellen. Ein Gen-zerstörter Stamm wird erhalten durch Ersetzen mit einem Zielgen des Chromosoms unter Verwendung dieses Plasmids. Ein URA3-Gen, das in ein Chromosom eingeführt wird, wird zwischen hisGs gelegt und zusammen mit einer hisG-Kopie aus dem Chromosom ausgeschieden, und zwar durch homologe Rekombination zwischen hisG-Sequenzen. Eine Kopie eines hisG-Fragments bleibt in einem zerstörten Zielgen auf dem Chromosom zurück, wobei eine Wirtszelle einen URA-Phänotyp hat (5). Homologe Rekombination zwischen hisG kann mittels 5-Fluorotinsäure (5-FOA) durchgeführt werden. Die ura3-Mutante ist 5-FOA-beständig (Boeke et al., Mol. Gen. Genet., 197, 345-346 (1984); Boeke et al., Methods Enzymol., 154, 165-174 (1987)), und ein Zellstamm vom Ura3+-Phänotyp kann nicht länger in einem 5-FOA-Medium wachsen. Folglich ermöglicht die Trennung eines Stammes mit einem Resistenzmerkmal in einem Medium, zu dem 5-FOA gegeben wird, den Vorgang, wobei wieder URA3 verwendet wird.

Dieser MNN1-Gen-zerstörte Stamm wird auf die gleiche Weise einer MNN4-Zerstörung und eine OCH1-Genzerstörung unterworfen, wobei die erfindungsgemäße auxotrophe Dreifachmutante (&Dgr;och1&Dgr;mnn1&Dgr;mnn4) erhalten wird. Darüber hinaus kann die ALG3-Genzerstörung auf die gleiche Weise die erfindungsgemäße auxotrophe Vierfachmutante (&Dgr;och1&Dgr;mnn1&Dgr;mnn4&Dgr;alg3) bereitstellen.

Bei einem „künstlich zerstörten Stamm", bei dem eine künstliche Genzerstörung in der oben beschriebenen Art und Weise durchgeführt wird, ist daher ein auxotrophes Mutationsmerkmal des Ursprungshefestammes durch den Genzerstörungsvorgang nicht beschädigt. Folglich ist die Zahl der auxotrophen Mutationsmerkmale des künstlich zerstörten Stammes äquivalent zu der Zahl der auxotrophen Mutationsmerkmale des Ursprungshefestammes, d. h., mindestens eines, obgleich es eine Dreifach- oder Vierfachmutante ist.

Auf der anderen Seite ist eine „natürliche Mutante", bei der die Genzerstörung spontan bewirkt wird, ohne das obige Verfahren zu verwenden, der Anstieg und die Verringerung der auxotrophen Mutationsmerkmale nicht in Beziehung zu setzen, da das obige Verfahren nicht eingesetzt wird.

Hinsichtlich der Herstellung einer Hefemutante, die eine erfindungsgemäße Zuckerkette vom M8-hohen Mannosetyp herstellt, bleiben nur drei auxotrophe Mutationsmerkmale zurück, wenn sie gemäß einem herkömmlichen Verfahren unter Verwendung eines Hefestammes mit sechs auxotrophen Mutationsmerkmalen, um OCH1-, MNN1- und MNN4-Gene zu zerstören, hergestellt wird, und folglich beträgt die Zahl der auxotrophen Mutationsmerkmale der Mutante mindestens vier.

Wenn eine Hefemutante, die einer Zuckerkette vom M8-hohen Mannosetyp herstellt, in der eine Mutation in den OCH1-, MNN1- und MNN4-Genen und außerdem in dem ALG3-Gen aufgetreten ist, hergestellt wird, können natürliche Mutanten mit MNN1-Mutation und ALG3-Mutation bei der Herstellung gemäß dem herkömmlichen Verfahren eingesetzt werden, jedoch sollten die OCH1- und MNN4-Gene außerdem zerstört werden. Folglich werden zwei auxotrophe Mutationsmerkmale eingesetzt. Die Verwendung des obigen Hefestammes mit sechs auxotrophen Mutationsmerkmalen führt daher nur zu vier verbleibenden auxotrophen Mutationsmerkmalen. Die Zahl der auxotrophen Mutationsmerkmale der Mutante ist daher mindestens fünf.

Bei der vorherigen Vorgehensweise können Marker, die Resistenz gegen Mittel wie G418, Cerulenin, Aureobasidin, Zeocin, Canavanin, Cycloheximid und Tetracyclin verleihen, als Selektionsmarker zusätzlich zu den auxotrophen Markern, wie URA3 verwendet werden. Durch den Einsatz von Genen als Marker, die z. B. Lösungsmittelresistenz gegen Methanol, Ethanol und dergleichen, osmotische Druckresistenz gegen Glycerin, Salz und dergleichen und Resistenz gegen Metallionen wie Kupfer verleihen, können Gene eingeführt und zerstört werden.

Wenn ein herkömmliches Verfahren, z. B. die Verwendung eines Phagen als Vektor, als Verfahren zum Einführen von DNA in eine Zelle und zum Transformieren desselben in der obigen Vorgehensweise eingesetzt wird, kann die DNA effizient in einen Wirt durch ein Verfahren zum Infizieren von Phagen in einen Escherichia coli-Wirt und dergleichen eingeführt werden. Verfahren zum Transformieren von Hefe unter Verwendung eines Plasmids umfassen ein Verfahren, bei dem ein Plasmid durch Behandeln mit Lithiumsalz eingeführt wird, um die spontane DNA-Einführung zu erleichtern und ein Verfahren zum elektrischen Einführen von DNA in eine Zelle (Becker and Guarente, Methods Enzymol., 194, 182-187 (1991)).

Bei der obigen Vorgehensweise kann die Isolierung, Reinigung und dergleichen der DNA durch ein herkömmliches Verfahren durchgeführt werden, z. B. im Fall von Escherichia coli durch DNA-Extraktion mittels dem Alkali-/SDS-Verfahren und Ethanolausfällung und außerdem durch DNA-Reinigung mittels RNase-Behandlung, PEG-Ausfällung und dergleichen. Die Bestimmung der DNA-Sequenz der Gene kann außerdem durch ein herkömmliches Verfahren durchgeführt werden, z. B. durch ein Dideoxyverfahren (Sanger et al., Proc. Natl. Acad. Sci., USA, 74, 5463-5467 (1977)). Die Bestimmung der obigen DNA-Nucleotidsequenz kann einfach durchgeführt werden unter Verwendung von einem im Handel erhältlichen Sequenzierungskit und dergleichen.

Die so hergestellte auxotrophe Mutante kann eine Zuckerkette vom hohen Säugermannosetyp herstellen. Um eine Säugertyp-Zuckerkette vom Hybridtyp und Komplextyp herzustellen, werden außerdem eine Gruppe von Hefe-spezifischen Zuckerkettenhydrolasegenen und einer Gruppe von Hefe-spezifischen Glycosyltransferasegenen in die Mutante eingeführt. Wie oben beschrieben, wird eine Zuckerkette ursprünglich in ER und im Golgiapparat biosynthetisiert und folglich sollten Zuckernucleotide als Startmaterial für eine Zuckerkette in diesen Organen vorhanden sein. Die Transporter für diese Zuckernucleotide fehlen jedoch in der Hefe, oder, wenn sie vorhanden sind, ist nur eine sehr kleine Menge in Organen vorhanden, in denen eine Zuckerkette tatsächlich biosynthetisiert wird. Eine Gruppe von Zuckernucleotidtransportergenen, die im Zytoplasma biosynthetisierte Zuckernucleotide vom Zytoplasma zum ER und zum Golgiapparat transportieren, ist außerdem notwendig.

Erfindungsgemäß werden daher Gene, die zur Gruppe der Zuckerkettenhydrolasegene, zur Gruppe der Glycosyltransferasegene und zur Gruppe der Zuckernucleotidtransportergene gehören, als „Gene zur Biosynthese einer Zuckerkette vom Säugertyp" bezeichnet.

Die Gruppe der Gene der Zuckerkettenhydrolase umfassen &agr;-Mannosidase (&agr;-Mannosidase I, &agr;-Mannosidase II)-Gene, die Gruppe der Glycosyltransferasegene umfasst N-Acetylgluxosaminyltransferase (GnT-I, GnT-II, GnT-III, GnT-IV, GnT-V)-Gene, Galactosyltransferase (GalT), Fucosyltransferase (FucT) und dergleichen, und die Gruppe der Gene der Zuckernucleotidtransporter umfasst UDP-GlcNAc-Transporter, UDP-Gal-Transportergene und dergleichen. Diese Gene können isolierte Säuger-abstammende Gene oder synthetisierte Gene sein.

Hinsichtlich der „Gene zur Biosynthese einer Zuckerkette vom Säugertyp" werden Gene, die zu einer, zwei oder mehreren Gruppen der oben erwähnten Gene gehören, in einer Zahl eingeführt, die notwendig ist, um die Zuckerkette herzustellen. Wenn eine Mehrzahl von Genen einzuführen ist, können diese Gene zur gleichen Gruppe gehören oder können unterschiedlichen Gruppen angehören.

Wenn die auxotrophe Mutante oder eine Mutante, in die die Gruppe exogener Gene in die auxotrophe Mutante eingeführt werden, in einem Medium kultiviert wird, verringert sich die Menge der äußeren Zuckerkette, die für Hefe spezifisch ist, und ein Glycoprotein, enthaltend eine Asn-gebundene Zuckerkette, die mit einer Zuckerkette vom hohen Mannosetyp (Man5-8GlcNAc2) identisch ist, eine Zuckerkette vom Hybridtyp (GlcNAcMan5GlcNAc2 und dergleichen) und eine Zuckerkette vom komplexen Typ (Gal2GlcNAc2Man3GlcNAc2 und dergleichen), die in Säugerzellen hergestellt wird, können in der Hefezelle oder außerhalb der Zelle hergestellt werden.

Genauer gesagt, wenn eine Dreifachmutante (&Dgr;och1&Dgr;mnn1&Dgr;mnn4) als auxotrophe Mutante verwendet wird, kann eine Zuckerkette vom Hybridtyp durch Einführen eines &agr;-Mannosidase-I-Gens und eines GnT-I-Gens in die Mutante hergestellt werden. Die Einführung von Genen zur Biosynthese einer Zuckerkette vom Säugertyp (&agr;-Mannosidase-II, GnT-II, GalT, UDP-GclNAc-Transporter, UDP-Gal-Transportergene) kann außerdem eine Zuckerkette vom zweistängigen Komplex (Gal2GlcNAc2Man2GlcNAc2) herstellen.

Die Einführung von GnT-IV- und GnT-V-Genen kann eine Zuckerkette vom dreistängigen Komplextyp und eine Zuckerkette vom vierstängigen Komplextyp herstellen.

Wenn eine Vierfachmutante (&Dgr;och1&Dgr;mnn1&Dgr;mnn4&Dgr;alg3) als auxotrophe Mutante verwendet wird, ohne dass das &agr;-Mannosidase-I-Gen eingeführt wird, kann eine Zuckerkette vom zweistängigen Zuckerkettenkomplex (Gal2GlcNAc2Man2GlcNAc2) hergestellt werden durch Einführen von Genen zur Biosynthese einer Zuckerkette vom Säugertyp (&agr;-Mannosidase-I, GnT-I, GnT-II, Gal-T, UDP-GlcNAc-Transporter, UDP-Gal-Transportergenen).

Zur Bereitstellung der Zuckerkette und des Glycoproteins in hoher Ausbeute wird das Enzym in einem adäquaten Organ (z. B. Golgiapparat) einer hohen Expression unterworfen. Folglich ist die Verwendung von Genen, die der Frequenz der Codonverwendung bei Hefe entsprechen, wirkungsvoll. Zum Lokalisieren des Enzyms in adäquaten Organen ist die Zugabe einer Signalsequenz von Hefe und dergleichen wirkungsvoll. Zum Einführen von Genen kann ein Verfahren in Betracht gezogen werden, bei dem Vektoren, wie 2 &mgr;m Plasmidtyp (YEp-Typ), ein Chromosomen-eingeführter Typ (YIp-Typ) und dergleichen verwendet werden, und ein auf den Verwendungszweck eingestelltes Verfahren kann bestimmt werden. Der YEp-Typ-Vektor kann viele Genkopien einführen und folglich können die Gene in einer großen Menge exprimiert werden. Auf der anderen Seite machen es YIp-Typ-Vektoren möglich, dass Gene in einem Chromosom vorhanden sind und folglich können die Gene stabil beibehalten werden. Promotoren, die zum Exprimieren eines Gens notwendig sind, umfassen, ohne bestimmte Einschränkungen, die konstitutiven Expressionspromotoren, wie GAPDH, PGK und dergleichen und induzierbare Expressionspromotoren, wie GAL1, CUP1 und dergleichen. Zur Herstellung einer Zuckerkette ist ein konstitutiver Expressionspromotor bevorzugt. Wenn ein oder mehrere Gene, d. h. eine Zuckerkettenhydrolase, eine Glycosyltransferase und ein Zuckernucleotidtransportergen zu exprimieren sind, kann es die Hefevermehrung beeinflussen. Folglich sollten in diesem Fall die Verwendung eines induzierbaren Promotors und die Reihenfolge der Einführung der Gene berücksichtigt werden.

Die erfindungsgemäße auxotrophe Mutante umfasst Mutanten, die erhältlich sind durch Verwendung eines Medikaments, durch ultraviolette Bestrahlung und durch natürliche Mutation zusätzlich zu Mutanten, die durch die obige künstliche Genzerstörung erhalten werden. Die in der Natur vorkommende Mutante kann außerdem eine Zuckerkette vom Säugertyp oder ein Glycoprotein mit einer Zuckerkette vom Säugertyp herstellen, und zwar durch Einführung der obigen Gene zur Biosynthese einer Zuckerkette vom Säugertyp (eine Gruppe aus Zuckerkettenhydrolasegenen, eine Gruppe aus Glycosyltransferasegen, und Genen, die zur Gruppe der Zuckernucleotidtransporter gehören).

Zur Herstellung eines Glycoproteins, das die obige Zuckerkette aufweist, und das von unterschiedlichen Arten abstammt, wird ein Gen bereitgestellt, das stromabwärts mit einem Promotor verbunden ist, der ein Gen (cDNA und dergleichen) exprimieren kann, das für das Zielglycoprotein in Hefe kodiert, und zwar durch Einsatz der Hefemutante als Wirt und durch anschließendes Einführen in den Hefewirt mittels homologer Rekombination. Alternativ kann das Gen in ein Plasmid eingeführt und zum Transformieren des Wirts verwendet werden, um einen Transformanten herzustellen. Das Zielglycoprotein, das innerhalb oder außerhalb der Hefezelle hergestellt wird, kann durch Kultivieren des Transformanten gemäß dem bekannten Verfahren gewonnen werden.

Die Hefemutante kann gemäß einem herkömmlichen Verfahren kultiviert werden, das gewöhnlich beim Kultivieren von Hefe eingesetzt wird. Ein synthetisches Medium (einschließlich einer Kohlenstoffquelle, einer Stickstoffquelle, anorganischen Salzen, Aminosäuren und Vitaminen) kann z. B. verwendet werden, zu dem verschiedene Mediumkomponenten, die von Difco bereitgestellt werden, zugegeben werden, und aus dem eine Aminosäure, die einen Marker bereitstellen kann, der zur Vermehrung und Retention eines Plasmids notwendig ist, entfernt wird, (Sherman, Methods Enzymol., 194, 3-57 (1991)).

Zum Isolieren und Reinigen eines Glycoproteins aus dem kultivierten Erzeugnis (Kulturlösung, kultivierten Zellen) kann ein herkömmliches Verfahren zum Isolieren und Reinigen von Proteinen verwendet werden.

Zum Beispiel werden die Zellen nach Beendigung der Kultivierung durch Zentrifugierung gewonnen und in einem wässrigen Puffer suspendiert. Die Zellen werden anschließend durch einen Ultraschall-Schleifapparat, eine französische Presse, ein Menton-Gaulin-Homogenisator, einer DYNO-Mühle und dergleichen zerstört, um ein zellfreies Extrakt zu erhalten. Aus dem durch Zentrifugierung des zellfreien Extraktes hergestellten Überstand kann ein gereinigtes Präparat unter Verwendung herkömmlicher Verfahren zum Isolieren und Reinigen von Proteinen erhalten werden, d. h. durch Lösungsmittelextraktion, Aussalzung unter Verwendung von Ammoniumsulfat und dergleichen, Entsalzung, einem Ausfällungsverfahren unter Verwendung eines organischen Lösungsmittels, Anionen-Austauscher-Chromatographie unter Verwendung von Harzen, wie Diethylaminoethyl (DERE)-Sepharose, Cationen-Austauscher-Chromatographie unter Verwendung von Harzen, wie S-Sepharose, FF (Pharmacia), hydrophober Chromatographie unter Verwendung von Harzen, wie Butylsepharose und Phenylsepharose, Gelfiltrierung unter Verwendung eines Molekularsiebs, Affinitätschromatographie unter Verwendung von Harzen, wie His-Bind-Harz (Novagen), Chromatofocussierung und Electrophorese unter Verwendung von isoelectrischer Focussierung allein oder in Kombination aus zwei oder mehreren.

Beispiele

Die Erfindung wird unter Bezugnahme auf die folgenden Beispiele näher erläutert, diese Beispiele sind jedoch nicht als Einschränkung für den technischen Umfang der Erfindung anzusehen.

[Beispiel 1] Züchten der Hefemutante (&Dgr;mnn1&Dgr;mnn4&Dgr;och1 auxotropher Dreifachmutante), die Zuckerkette vom Säugertyp herstellen kann. (1) Herstellung der &Dgr;mnn1 auxotrophen Mutante und Bestimmung von deren Eigenschaften

Eine Cassette (HUH), in der das Salmonella hisG-Gen an beide Enden des URA3-Gens durch direkte Wiederholung gebunden wird, wurde aus pNK51 an BglII und BamHI geschnitten, über das bereits berichtet wurde (Alani et al., Genetics, 116, 541-545 (1987) und in die BamHI-Stelle des Escherichia coli-Plasmids pSP73 eingeführt. Dieses Plasmid wurde als pSP73-HUH bezeichnet.

Das MNN1-Gen befindet sich in der Nähe des Centromers des Hefechromosoms Nr. 5 und die DNA-Nucleotidsequenz des MNN1-Gens ist in der Datenbank GenBank unter der Nr. L23753 registriert (Yip et al., Proc. Natl. Acad. Sci. USA, 9, 2723-2727 (1994)). Das 5'-Ende im MNN1-Gen wurde durch PCR unter Verwendung des Primers A (GGATCCGAAGAAAACCTAATACATTGAAGT: SEQ ID Nr. 1) und des Primers B (GCATGCCCTTTGGTTTAATATAAATCTCCGGAGTGC: SEQ ID Nr. 2) amplifiziert, und der 3'-Bereich wurde durch PCR unter Verwendung des Primers C (GCATGCTACATAACTCCAATCAGCAGCAAATATGTC: SEQ ID Nr. 3) und des Primers D (GCGGCCGCGTGTTCTGTTCGGGTAACGTTTAAACCAAT: SEQ ID Nr. 4) amplifiziert. Die erhaltenen DNA-Fragmente wurden in die SphI-Stelle des Plasmids pHYH, enthaltend den Marker HIS3, eingeführt, um pHYH&Dgr;mnn1 herzustellen. Zum Zerstören des MNN1-Gens unter Verwendung der HUH-Cassette, wurde das 1,8 kB SphI-Fragment aus pHYH&Dgr;mnn1 erhalten und in die SphI-Stelle von pSP73-HUH eingeführt, um pSP73-&Dgr;mnn1::HUH herzustellen. Dieses Plasmid wurde zum Linearisieren an der NotI-Stelle gespalten, und ein Wildtypstamm W303-1A (MATa leu2-3, 112his3-11, 15ade2-1 ura3-1 trp1-1 can1-100) wurde mit dem linearen Plasmid unter Verwendung des Lithiumacetatverfahrens transformiert (Ito et al., J. Bacteriol., 153, 163-168 (1983)). Nach der Transformation wurden die Hefezellen auf einer Platte aufgetragen, die SD-Ura-Medium (2 % Glucose, 0,67 % Hefe-Stickstoffbase w/o Aminosäuren (Difco), eine Mischung aus Nucleobasen, mit Ausnahme von Uracil und Aminosäuren (20-400 mg/l)) und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten.

Genom-DNA wurde aus dem Transformanten hergestellt, und die Einführung eines Uracilmarkers in ein Chromosom im MNN1-Bereich wurde durch PCR bestätigt. Dieser Transformant wurde TIY1-Stamm genannt.

Aus diesem Stamm wurde die Selektion in YSD-Medium (1 % Hefeextrakt, 2 % Glucose, Adenin (40 mg/l), Uracil (20 mg/l), enthaltend 5-FOA, durchgeführt und der URA3-Gen-defiziente Stamm wurde erhalten. Auf die gleiche Weise wie oben beschrieben, wurde der mnn1-zerstörte Stamm, dem das URA3-Gen fehlt, durch PCR bestätigt. Dieser Stamm, der &Dgr;mnn1::hisG enthält, wurde als TIY3-Stamm bezeichnet.

In dem Fall des MNN1-zerstörten Stamms ist bekannt, dass die Mobilität einer Invertase, die einer N-gebundenen Modifizierung unterworfen wird, schneller ist als die eines Wildtypstamms, da ihm &agr;-1,3-gebundene Mannose am nichtreduzierenden Ende fehlt. Ein Wildtypstamm und der TIY3-Stamm, die in YPAD-Medium kultiviert wurden, wurden jeweils in einem Nährstoffmedium (1 % Hefeextrakt, 2 % Bactopepton, Adenin (40 mg/l), enthaltend 0,2 % Sucrose, suspendiert und 3 Stunden kultiviert. Nach dem Sammeln wurden die Zellen in den SDS-Probenpuffer suspendiert und mit Glaskügelchen zerkleinert. Ein Überstand wurde anschließend verwendet, um eine 6 % SDS-Polyacrylamidelectrophorese durchzuführen. Die Invertase wurde durch Induzieren mit Sucrose nachgewiesen und durch anschließendes Durchführen von Aktivitätsfärbung unter Verwendung von Triphenyltetrazolium (Ballou, Methods Enzymol., 185, 440-470 (1990)). Im Ergebnis wurde bestätigt, dass die Mobilität der Invertase, die durch den Stamm TIY3 hergestellt wurde, schneller war als die des Wildtypstamms.

(2) Herstellung der &Dgr;mnn1&Dgr;mnn4 auxotrophen Doppelmutante und deren Eigenschaften

Das MNN4-Gen befindet sich auf dem Hefechromosom Nr. 11, und die DNA-Nucleotidsequenz des MNN4-Gens ist in der GenBank Datenbank unter der Nr. D83006 hinterlegt (Odani et al., Glycobiology, 6, 805-810 (1996). Der 3'-Bereich in dem MNN4-Gen wurde durch PCR unter Verwendung des Primers E (AGATGCATACTAGTGGGCCCATTGTGATTGGAAT: SEQ ID Nr. 5) und dem Primer F (CCCCCGAATTCGTGTGAAGGAATAGTGACG: SEQ ID Nr. 6) amplifiziert und der 5'-Bereich wurde durch PCR unter Verwendung des Primers G (CCCCCGAATTCAAGTCGGAGAACCTGACTG: SEQ ID Nr. 7) und des Primers H (ATGGGCCCACTAGTATGCATCTCGCGTGGCATGG: SEQ ID Nr. 8) amplifiziert. Die erhaltenen DNA-Fragmente wurden in die EcoRI-Stelle der pSP73-HUH-enthaltenden HUH-Cassette eingeführt, um sP73-&Dgr;mnn4::HUH herzustellen. Dieses Plasmid wurde an der SpeI-Stelle zum Linearisieren gespalten und der TIY3-Stamm wurde mit dem linearen Plasmid unter Verwendung des Lithiumacetatverfahrens transformiert. Nach der Transformation wurden die Hefezellen auf der Platte, enthaltend SD-Ura-Medium, aufgetragen und bei 30°C 2 Tage unter Erhalt eines Transformanten kultiviert.

Die Genom-DNA wurde aus dem Transformanten hergestellt und die Einführung eines Uracilmarkers in einem Chromosom im MNN4-Bereich durch PCR bestätigt. Dieser Transformant wurde als TIY9-Stamm bezeichnet.

Aus diesem Stamm wurde die Selektion in YSD-Medium, enthaltend 5-FOA durchgeführt und der URA3-Gen-defiziente Stamm wurde erhalten. Auf die gleiche Weise wie oben beschrieben, wurde der mnn4-zerstörte Stamm, dem das URA3-Gen fehlt, durch PCR bestätigt. Dieser Stamm, enthaltend &Dgr;mnn1::hisG &Dgr;mnn4::hisG, wurde als TIY11-Stamm bezeichnet.

Die Gegenwart oder Abwesenheit einer Phosphatgruppe in einer Zuckerkette kann durch Färbung mit Alcianblau bestimmt werden. Alcianblau ist ein positiv geladener Farbstoff, der an eine negative Ladung bindet. Wenn Hefezellen in einem Puffer mit einem pH-Wert von 3 suspendiert werden und 0,1 % Alcianblau 8GX (Sigma, Code-Nr. A3157) zugegeben wird, werden nur solche Zellen blau gefärbt, die eine Phosphatgruppe in einer Zuckerkette aufweisen, währenddessen solche, die keine Phosphatgruppe aufweisen, weiß werden. Da die Zuckerkette auf der Zelloberfläche im Wesentlichen keine Phosphatgruppe aufweist, wird der &Dgr;mnn4-zerstörte Stamm mit Alcianblau nicht gefärbt. Ein Wildtypstamm, TIY3 und TIY11, werden in einem Nährstoffmedium kultiviert und jede Zelle wird mit Alcianblau gefärbt. Als Ergebnis wurde bestätigt, dass nur TIY11 nicht blau gefärbt wurde.

(3) Herstellung der &Dgr;mnn1&Dgr;mnn4&Dgr;och1 auxotrophen Dreifachmutante und deren Eigenschaften

Das OCH1-Gen befindet sich auf dem Hefechromosom Nr. 7 und die DNA-Nucleotidsequenz des OCH1-Gens ist bei der GenBank Datenbank unter der Hinterlegungs-Nr. D11095 registriert (Nakayama et al., EMBO J., 11, 2511-2519 (1992)). Die AatII-HpaI-Stelle in dem OCH1-Gen von pBL-OCH1, das zuvor hergestellt worden ist (Nakayama et al., EMBO J., 11, 2511-2519 (1992)), und dass das gesamte OCH1-Gen enthält, wurde geschnitten und die HUH-Cassette, die aus mit glatten Enden versehenem pNKY51 erhalten wurde, wurde eingeführt, um pBL-&Dgr;och1::HUH herzustellen. Das Plasmid wurde an SalI und BamHI gespalten, um einen Bereich herauszuschneiden, der &Dgr;och1::HUH enthält, und TIY11 wurde unter Verwendung des Lithiumacetatverfahrens transformiert. Die Stämme, enthaltend die &Dgr;och1-Zerstörung, entfalteten Empfindlichkeit gegenüber niedrigem osmotischem Druck. Daher wurden nach der Transformation die transformierten Zellen auf eine Platte aufgetragen, enthaltend SD-Ura-Medium, das 0,3 M KCl enthält, und bei 30°C 2 Tage unter Erhalt eines Transformanten kultiviert.

Die Genom-DNA wurde aus dem Transformanten hergestellt, und die Einführung eines Uracilmarkers in einem Chromosom in dem OCH1-Bereich durch PCR bestätigt. Dieser Transformant wurde als TIY17-Stamm bezeichnet.

Mit diesem Stamm wurde die Selektion in YSD-Medium, enthaltend 5-FOA und 0,3 M KCl durchgeführt, und der URA3-Gen-defiziente Stamm wurde erhalten. Auf die gleiche Weise wie oben beschrieben, wurde der och1-zerstörte Stamm, dem das URA3-Gen fehlt, durch PCR bestätigt. Dieser Stamm, enthaltend &Dgr;mnn1::hisG &Dgr;mnn4::hisG &Dgr;och1::hisG, wurde als TIY19-Stamm bezeichnet.

Dieser auxotrophe Dreifachmutantenstamm TIY19 wurde international an dem National Institute of Bioscience and Human-Technology (1-1-3, Higashi, Tsukuba, Ibaraki) vom 27. Juli 1999 unter der Hinterlegungs-Nr. FERM BP-6802 hinterlegt.

Dieser TIY19-Stamm, enthaltend die och1-Zerstörung, bildet eine Zuckerkette vom hohen Mannosetyp und folglich ist bekannt, dass die Mobilität der Invertase schneller als die eines Wildtypstammes, des TIY3-Stammes und des TIY11-Stammes. Zur Bestätigung der Wirkung des och1-zerstörten Stammes auf eine Zuckerkettenlänge wurde die Invertase auf die gleiche Weise wie oben beschrieben jeweils in dem Wildtypstamm, den TIY3-Stamm, den TIY11-Stamm und den TIY19-Stamm nachgewiesen. Im Ergebnis wurde bestätigt, dass die Mobilität des Wildtypstammes, TIY3-Stammes, TIY11-Stammes und TIY19-Stammes in dieser Reihenfolge schneller wirkt.

[Beispiel 2] Herstellung der Hefemutante (&Dgr;mnn1&Dgr;mnn4&Dgr;och1&Dgr;alg3 auxotrophe Vierfachmutante), die eine Zuckerkette vom Säugertyp herstellen kann und deren Eigenschaften

Das ALG3-Gen befindet sich auf dem Hefechromosom Nr. 2, und die DNA-Nucleotidsequenz des ALG3-Gens ist bei der GenBank Datenbank unter der Hinterlegungs-Nr. Z35844 (Feldmann et al., EMBO J., 13, 5795-5809 (1994)) registriert. Der 5'-Bereich im ALG3-Gen wurde durch PCR unter Verwendung des Primers I (GCGGCCGCGAGACCTGAATCTTCGACACGCAAGAAAAA: SEQ ID Nr. 9) und des Primers J (GAATTCGCTTTCGAACAAAATCAAAAGGGGCATAAC: SEQ ID Nr. 10) amplifiziert, und der 3'-Bereich wurde durch PCR unter Verwendung des Primers K (GAATTCCTATCCACCAAACTCACAAGCAAGCA: SEQ ID Nr. 11) und des primers L (GCGGCCGCCGAGAGGGTGAACGGTGCTAACTCAGGATT: SEQ ID Nr. 12) amplifiziert. Die erhaltenen DNA-Fragmente wurden in die EcoRI-Stämme von pSP73-HUH, das die HUH-Cassette enthält, eingeführt, um pSP73-alg3::HUH herzustellen. Das Plasmid wurde an der NotI-Stelle geschnitten, um linearisiert zu werden, und der TIY19-Stamm wurde mit dem linearen Plasmid unter Verwendung des Lithiumacetatverfahrens transformiert. Nach der Transformation wurden die Hefezellen auf einer Platte mit SD-Ura-Medium aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten.

Die Genom-DNA wurde aus dem Transformanten hergestellt und die Einführung eines Uracilmarkers in einem Chromosom in dem ALG3-Bereich durch PCR bestätigt. Dieser Transformant wurde als YS134-Stamm bezeichnet.

Mit diesem Stamm wurde die Selektion in SD-Medium, enthaltend 5-FOA, durchgeführt und der URA3-Gen-defiziente Stamm wurde erhalten. Auf die gleiche Weise wie oben beschrieben, wurde der alg3-zerstörte Stamm, dem das URA3-Gen fehlt, durch PCR bestätigt. Dieser Stamm, enthaltend &Dgr;mnn1::hisG &Dgr;mnn4::hisG &Dgr;och1::hisG &Dgr;alg3::hisG, wurde als YS134-4A-Stamm bezeichnet.

Dieser auxotrophe Vierfachmutantenstamm YS124-4A wurde international bei dem National Institute of Bioscience and Human-Technology (1-1-3, Higashi, Tsukuba, Ibaraki) vom 27. Juli 1999 unter der Hinterlegungs-Nr. FERM BP-6801 hinterlegt.

Dieser YS134-4A-Stamm, enthaltend die alg3-Zerstörung, bildet eine kurze Zuckerkette und folglich ist bekannt, dass die Mobilität der Invertase schneller ist als die eines Wildtypstammes, des TIY3-Stammes, des TIY11-Stammes und des TIY19-Stammes. Um die Wirkung des alg3-zerstörten Stammes auf eine Zuckerkettenlänge zu bestätigen, wurde die Invertase jeweils in dem Wildtypstamm, dem TIY3-Stamm, dem TIY11-Stamm, dem TIY9-Stamm und dem YS134-4A-Stamm auf die gleiche Weise, wie in Beispiel 1 (1) beschrieben, nachgewiesen. Im Ergebnis wurde bestätigt, dass die Mobilität des Wildtypstammes, des TIY3-Stammes, des TIY11-Stammes, des TIY19-Stammes und des YS134-4A-Stammes in dieser Reihenfolge schneller wird.

[Beispiel 3] Trennung eines Mannoproteins auf der Zelloberfläche aus der auxotrophen Dreifachmutante &Dgr;mnn1&Dgr;mnn4&Dgr;och1 und Untersuchung der Zuckerkettenstruktur, die darin enthalten ist

Concanavalin A ist ein Lectin, das Affinität für eine Zuckerkette hat, die zwei oder mehrere &agr;-D-Man-Reste, in der die Hydroxylgruppen an den Positionen C-3, C-4 und C-6 nicht substituiert sind, enthält. Die Immobilisierung von Concanavalin A auf einer Säule ermöglicht die Trennung von Mannoprotein von Polysacchariden der Hefezellwand, wie Glucan oder Chitin. Mannoprotein auf der Zelloberfläche wurde zunächst aus den Zellen des TIY19-Stammes getrennt (Peat et al., J. Chem. Soc., 29 (1961)).

50 ml YPAD-Medium, enthaltend 0,3 M KCl, wurden in einen 500 ml Sakaguchi-Kolben eingeführt und der TIY19-Stamm wurde bei 30°C 24 Stunden kultiviert. Die Zellen wurden durch Zentrifugierung gesammelt und in 10 ml 100 mM Natriumcitratpuffer (pH 7,0) suspendiert und in einem Autoclaven bei 121°C 1 Stunde erwärmt. Nach dem Abkühlen wurde die Zentrifugierung durchgeführt und ein Überstand wurde gesammelt. Weitere 10 ml Wasser wurden zu der zurückgebliebenen festen Substanz gegeben, und die Mischung wurde erwärmt und zentrifugiert, um einen Überstand auf die gleiche Weise wie oben beschrieben zu sammeln. Alle Extrakte wurden zusammengeführt und zu dem dreifachen Ethanolvolumen gegeben. Das resultierende weiße Präzipitat wurde getrocknet und anschließend in einem Puffer für die Concanavalin A (ConA)-Säule (0,1 M Natriumphosphatpuffer (pH 7,2), enthaltend 0,15 M Natriumchlorid und 0,5 mM Calciumchlorid) aufgelöst. Die Lösung wurde auf eine ConA-Agarosesäule (0,6 × 2 cm, Honen Corporation) aufgetragen. Nach dem Waschen mit einem Puffer für die ConA-Säule wurde die Elution unter Verwendung eines Puffers für die ConA-Säule, enthaltend 0,2 M &agr;-Methylmannosid durchgeführt. Die resultierende Fraktion wurde dialysiert und gefriergetrocknet, wodurch Mannoprotein erhalten wurde.

Anschließend wurde das resultierende Mannoprotein mit einem Enzym behandelt, um eine Asn-gebundene Zuckerkette herauszuspalten. D. h. eine gefriergetrocknete Probe wurde in 100 &mgr;l Puffer für die N-Glycosidase F (0,1 M Tris-HCl-Puffer (pH 8,0), enthaltend 0,5 % SDS und 0,35 % 2-Mercaptoethanol) aufgelöst und 5 Minuten gekocht. Das Produkt wurde auf Raumtemperatur abgekühlt, 50 &mgr;l 7,5 % Nonidet P-40, 138 &mgr;l H2O und 12 &mgr;l N-Glycosidase F (Boehringer) wurden anschließend zugegeben, und die Mischung wurde bei 37°C 16 Stunden behandelt. Nach dem Entsalzen mit der BioRad AG501-X8-Säule wurde ein äquivalentes Volumen aus Phenol:Chloroform (1:1) zugegeben und stark geschüttelt, wodurch eine Oberflächen-aktive Substanz und Protein entfernt wurden. Folglich wurde ein Zuckerkettenpräparat erhalten.

Die erhaltene Zuckerkette wurde dem folgenden Verfahren unterworfen, um Fluoreszenzmarkierung durchzuführen (Pyridylaminierung, bezeichnet als PA („Pyridylaminierung" wird hiernach als „PA" abgekürzt)). Das Zuckerkettenpräparat wurde bis zur Trockenheit konzentriert und 40 &mgr;l eines Kopplungsreagens (eine Lösung aus 552 mg 2-Aminopyridin in 200 &mgr;l Essigsäure) wurden anschließend zugegeben. Die Mischung wurde dann hermetisch abgedichtet und bei 90°C 60 Minuten behandelt. Nach Abkühlung auf Raumtemperatur wurden 140 &mgr;l eines Reduktionsreagens (eine Lösung aus 200 mg Boran-dimethylamin-Komplex in 50 &mgr;l H2O und 80 &mgr;l Essigsäure) hinzugegeben. Die Mischung wurde dann hermetisch abgedichtet und bei 80°C 80 Minuten behandelt. Nach der Reaktion wurden 200 ml wässriges Ammoniak zu der Reaktionsmischung gegeben und außerdem wurde ein äquivalentes Volumen aus Phenol:Chloroform (1:1) zugegeben. Nachdem die Mischung kräftig geschüttelt worden war, wurde eine wässrige Schicht, enthaltend PA-Oligosaccharid, gesammelt. Dieses Verfahren wurde 7 Mal wiederholt und nicht-reagiertes 2-Aminopyridin wurde entfernt. Ein Überstand wurde durch einen 0,22 &mgr;m Filter filtriert und folglich wurde ein PA-Oligosaccharidpräparat erhalten.

HPLC unter Verwendung einer Amidsäule kann PA-Oligosaccharid in Abhängigkeit seiner Kettenlänge auftrennen. TSKGel Amid-80 (4,6 × 250 mm, Tosoh) wurde als Säule verwendet. Eine Mischlösung aus 200 mM Essigsäure-Triethylaminpuffer (pH 7,0) und Acetonitril (35:65, Lösungsmittel A) und eine Mischung aus 200 mM Essigsäure-Triethylaminpuffer (pH 7,0) und Acetonitril (50:50, Lösungsmittel B) wurden als Lösungsmittel hergestellt.

Die Säule wurde äquilibriert, indem das Lösungsmittel A zuvor bei einer Fließrate von 1,0 ml/min. durchgeleitet wurde. Sofort nach der Probeninjektion wurde das Verhältnis aus Lösungsmittel B linear auf 50 % über eine Zeitspanne von 25 Minuten erhöht. Das Lösungsmittel A und das Lösungsmittel B wurden anschließend 5 Minuten durchgeleitet und blieben bei 50:50 unverändert, wodurch das PA-Oligosaccharid eluiert wurde. Das Ergebnis ist in 6 gezeigt. Die Zuckerkette des Mannoproteins, das durch den &Dgr;och1&Dgr;mnn1&Dgr;mnn4 auxotrophen Dreifachmutantenstamm TIY19 hergestellt wurde, entfaltete primär einen Höchstwert mit einer Amidsäule. Dieser Höchstwert entsprach der Elutionsposition des Man8GlcNAc2-PA-Standards (Takara Shuzo Co., Ltd.). Dies bedeutet, dass eine Man8GlcNAc2-Zuckerkette vom hohen Mannosetyp, dem Mannoprotein hinzugefügt wurde, das durch den Stamm TIY19 hergestellt wurde.

[Beispiel 4] Einführung des &agr;-Mannosidase-I-Gens in &Dgr;och1&Dgr;mnn1&Dgr;mnn4 auxotrophe Dreifachmutante

Zur Biosynthese einer Zuckerkette mit einer Struktur, die eher der vom Säugertyp in Hefe entspricht, kann ein &agr;-Mannosidase-I (&agr;-1,2-Mannosidase)-Gen, das die Anfangsreaktion davon steuert, in eine auxotrophe Dreifachmutante eingeführt werden, um exprimiert zu werden. Der eingeführte Stamm kann eine Man5GlcNAc2-Zuckerkette biosynthetisieren, die ein Vorläufer eines Säugerhybridtyps oder Säugerkomplextyps ist, wobei eine Zuckerkette vom hohen Mannosetyp weiter verkürzt wird.

Ein Expressionsplasmid vom ER-Rückgewinnungstyp pGAMH1 für &agr;-1,2-Mannosidase, abstammend von Aspergillus saitoi, von dem bereits berichtet wurde, dass es Expressionsfähigkeit aufweist (Chiba et al., J. Biol. Chem., 273, 26298-26304 (1998)) wurde verwendet, um den TIY19-Stamm durch das Lithiumacetatverfahren zu transformieren. Als Kontrolle wurde ein Transformant, der nur aus einem Vektor pG3, der kein &agr;-1,2-Mannosidasegen enthält, hergestellt wurde, verwendet. Nach der Transformation wurden die Zellen auf der Platte, enthaltend ein SD-Trp-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Aminosäuren (Difco), eine Mischung aus Nucleobasen und Aminosäuren, außer Tryptophan (20-400 mg/l)) aufgetragen und bei 30°C 2 Tage kultiviert, um den Transformanten zu erhalten. Der resultierende Transformant wurde als TIY19pGAMH1 bezeichnet.

Wie in Beispiel 3 wurde eine Zuckerkette hergestellt aus den resultierenden Transformanten, um eine HPLC-Analyse durchzuführen.

Die Ergebnisse der Analyse durch die Amidsäule sind in 7 gezeigt. Eine Probe, die durch einen Kontrollvektor transformiert ist, entfaltete primär nur einen Höchstwert, wie in den Ergebnissen des Beispiels 3 (7, a), der der Elutionsposition des Man8GlcNAc2-PA-Standards (Takara Shuzo Co., Ltd.) entspricht. Auf der anderen Seite entfaltete TIY19pGAMH1, enthaltend das &agr;-1,2-Mannosidasegen, primär vier Höchstwerte (7, b). Diese Höchstwerte entsprechen den Elutionspositionen den Man5GlcNAc2-PA-, Man6GlcNAc2-PA-, Man7GlcNAc2-PA- und Man8GlcNAc2-PA-Standards, in der Reihenfolge der Elutionsgeschwindigkeit, d. h. vom schnellsten bis zum langsamsten. Diese Zuckerketten werden als Zuckerkette vom humanen hohen Mannosetyp bezeichnet.

Daraufhin wurde die Man5GlcNAc2-PA-Fraktion mit der schnellsten Elution gesammelt und einer Umkehrphasensäule zugeführt.

HPLC unter Verwendung einer Umkehrphasensäule ermöglicht die Trennung von PA-Oligosaccharid in Abhängigkeit von dessen Struktur. TSKGel ODS-80TM (4,6 × 150 mm, Tosoh) wurde als Säule verwendet und 100 mM Ammoniumacetatpuffer (pH 4,0, Lösungsmittel A) und 100 mM Ammoniumacetatpuffer, enthaltend 0,5 % 1-Butanol (pH 4,0, Lösungsmittel B), wurden als Lösungsmittel verwendet.

Die Säule wurde äquilibriert, indem eine Mischung aus Lösungsmittel A und Lösungsmittel B (95:5) zuvor bei einer Fließrate von 1,2 ml/min. durchgeleitet wurde. Sofort nach der Probeninjektion wurde das Verhältnis des Lösungsmittels B linear auf 50 % über einen Zeitraum von 20 Minuten erhöht, wodurch PA-Oligosaccharid eluiert. Das Ergebnis ist in 8 gezeigt. Die gesammelte Zuckerkettenfraktion entfaltet primär einen Höchstwert mit der Umkehrphasensäule (8, a) und dieser Höchstwert entsprach der Elutionspositon des Man5GlcNAc2-PA-Standards (Takara Shuzo Co., Ltd.) mit einer durch Formel (III) dargestellten Struktur:

worin Man Mannose darstellt, GlcNAc N-Acetylgluxosamin darstellt und # eine Stelle darstellt, an der GnT-I wirkt (8, b). Dies deutet darauf hin, dass das durch den TIY19pGAMH1-Stamm, der eine Man5GlcNAc2-Zuckerkette enthält, hergestellte Mannoprotein ein Vorläufer eines Hybridtyps und eines Komplextyps ist.

[Beispiel 5] Synthese eines Zuckerketten (GlcNAcMan5GlcNAc2)-Standards vom Hybridtyp

Zu Beginn wurde zur Bestätigung und Prüfung der Biosynthese einer Zuckerkette (GlcNAcMan5GlcNAc2) vom Hybridtyp eine GnT-I-Enzymreaktion in vitro durchgeführt, um die Zielzuckerkette zu synthetisieren. Die Substratspezifität von GnT-I ist sehr genau und GnT-I ist bekannt dafür, GlcNAc nur am Mannoserest an der Position # durch &bgr;-1,2-Bindung einer durch Formel (III) dargestellten Zuckerkettenstruktur zu übertragen.

Die Expression des GnT-I-Gens der Ratte in Hefe wurde durch Yoshida et al. erreicht (Yoshida et al., Glycobiology, 9, 53-58 (1999)). Dieses Gen wurde stromabwärts des GAP-DH-Promotors von pG3, das ein Plasmid mit hoher Kopienzahl ist, gebunden, anschließend am SmaI-NaeI gespalten und ein Bereich, enthaltend einen Promotor, ORF von GnT-I im Anschluss an den Promotor und ein Terminator wurde herausgeschnitten. Dieses Plasmid wurde anschließend in die SmaI-Stelle eines Plasmids mit hoher Kopienzahl pYO354 eingeführt. Dieses Plasmid wurde pYOG4 genannt. Unter Verwendung dieses Plasmids wurde ein Wildtyp-Hefestamm YPH500 durch das Lithiumacetatverfahren transformiert. Nach der Transformation wurden die Zellen auf eine Platte, enthaltend ein SD-Trp-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Aminosäuren (Difco), eine Mischung aus Nucleobasen und Aminosäuren, außer Tryptophan (20-400 mg/l)) aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Der resultierende Transformant wurde als YPH500/pYOG4 bezeichnet.

Der Transformant wurde einer Flüssigkultivierung in 500 ml SD-Trp-Lösung (2 % Glucose, 0,67 % Hefestickstoffbase w/o Aminosäuren (Difco), einer Mischung aus Nucleobasen und Aminosäuren, außer Tryptophan (20-400 mg/l)) unterworfen und wurde geerntet. Nach dem Waschen mit kaltem Wasser wurden die Zellen in 5,7 ml Spheroplastmedium (50 mM Kaliumphosphat, enthaltend 1 M Sorbitol (pH 7,5)) suspendiert. 9 &mgr;l 2-Mercaptoethanol und 12 mg Zymolyase 100T wurden in 300 &mgr;l Spheroplastmedium aufgelöst und zu der Suspension gegeben. Die resultierende Mischung wurde bei 30°C 45 Minuten erwärmt. 1 M Sorbitol (15 ml) wurde zugegeben und die Mischung wurde zentrifugiert. Danach wurde der Niederschlag mit 15 ml 1 M Sorbitol wieder gewaschen und geerntet. Zu diesem Niederschlag wurden 4 ml Lysepuffer (10 mM Triethanolamin (pH 7,2)-Lösung, enthaltend 250 mM Sorbitol, 2 &mgr;g/ml Antipain, 2 &mgr;g/ml Chymostatin, 3 &mgr;g/ml Leupeptin, 3 &mgr;g/ml Pepstatin, 1 mM Benzamidin, 1 mM EDTA, 1 mM EGTA und 1 mM PMSF) zugegeben. Die Zellen wurden durch einen Homogenisator zerstört und bei 220 × U zentrifugiert, um den Überstand zu gewinnen. Dieser Überstand wurde bei 100.000 × U zentrifugiert und die ausgefällte Fraktion wurde in 150 &mgr;l Lysepuffer suspendiert. Folglich wurde eine GnT-I-Enzymlösung erhalten. Andere GnT-Aktivität wurde in diesem Standard nicht festgestellt.

Die Zielzuckerkette wurde anschließend synthetisiert. Eine PA-markierte Man5GlcNAc2-Zuckerkette (von Takara Shuzo Co., Ltd. erworben) wurde als Substratakzeptor verwendet und in ein Röhrchen in einer Menge von jeweils 200 pmol eingeführt. Der Inhalt des Röhrchens wurde bis zur Trockenheit verdampft und anschließend wurden 8,2 &mgr;l GnT-I-Enzymlösung, hergestellt wie oben, 2 &mgr;l 0,2 M MnCl2 und 9,8 &mgr;l GnT-I-Reaktionspuffer (0,17 M MES (pH 6,0), 1,7 % Triton X-100, 0,34 % Rinderserumalbumin, 8,47 mM AMP, 1,69 mM UDP-GlcNAc und 169 mM GlcNAc) zu dem Röhrchen gegeben und bei 37°C 3 Stunden inkubiert. Die Reaktion wurde durch 5-minütiges Kochen beendet. Die Reaktionsmischung wurde anschließend durch einen 0,22 &mgr;m Filter filtriert, um einer HPLC unterworfen zu werden.

TSKGel ODS-80TM (4,6 × 250 mm, Tosoh) wurde als Säule verwendet und 100 mM Ammoniumacetatpuffer (pH 6,0), enthaltend 0,15 % 1-Butanol, wurde als Lösungsmittel verwendet. Die Säule wurde äquivilibriert, indem zuvor das Lösungsmittel bei einer Fließrate von 1,2 ml/min. durchgeleitet wurde. Die Probe wurde geladen und PA-Oligosaccharid wurde eluiert. Das Ergebnis ist in 9 gezeigt. Das Reaktionsprodukt entfaltete primär zwei Höchstwerte mit der Umkehrphasensäule und der Höchstwert der schnelleren Elution entsprach der Elutionsposition des Man5GlcNAc2-PA-Standards (Takara Shuzo Co., Ltd., eine Struktur davon ist in Formel (III) gezeigt). Folglich wurde es als nicht umgesetztes Akzeptorsubstrat angesehen.

Auf der anderen Seite wurde der Höchstwert der langsameren Elution gesammelt und nach der Reinigung wurde eine Massenanalyse unter Verwendung von TOF-MS durchgeführt. Die Analyse wurde unter Verwendung von LASERMAT2000 (ThermoQuest) und 0,01 % Dinatriumphosphat, enthaltend 2,5 % 2,5-Dihydroxybenzoesäure und 40 % Acetonitril als Matrize durchgeführt. Demzufolge entsprach die Masse der Höchstwertfraktion der erwarteten Molekularmasse (m/z = 1521 (H+); m/z = 1541 (Na+)). Wegen der genauen Substratspezifität von GnT-I wurde der resultierende Zuckerkettentyp als eine Zuckerkette GlcNAcMan5GlcNAc2 vom Zielhybridtyp angesehen, der eine Struktur, die durch Formel (IV) dargestellt ist, aufweist:

wobei Man Mannose darstellt und GlcNAc N-Actetylglucosamin darstellt.

[Beispiel 6] Einführung des &agr;-Mannosidase-I-Gens und GnT-I-Gens in die &Dgr;och1&Dgr;mnn1&Dgr;mnn4 auxotrophe Dreifachmutante

Zum Biosynthetisieren einer Zuckerkette vom Hybridtyp in Hefe kann außerdem das GnT-I-Gen in einen in Beispiel 4 hergestellten Hefestamm eingeführt werden, um exprimiert zu werden. Der eingeführte Stamm kann eine GlcNAcMan5GlcNAc2-Zuckerkette vom Säugerhybridtyp biosynthetisieren.

Das Expressionsplasmid vom ER-Rückgewinnungstyp pGAMH1 für &agr;-1,2-Mannosidase, abstammend von Aspergillus saitoi (Chiba et al., J. Biol. Chem., 273, 26298-26304 (1998)), das in Beispiel 4 verwendet wurde, wurde an SmaI-NaeI gespalten, um einen Bereich herauszuspalten, der einen Promotor, ORF von &agr;-1,2-Mannosidase im Anschluss an den Promotor und einen Terminator enthält. Dieses Fragment wurde dann in die SmaI-Stelle von pYOG4 eingeführt. Dieses Plasmid wurde als pYOMG4 bezeichnet. Unter Verwendung dieses Plasmids wurde der TIY19-Stamm durch das Lithiumacetatverfahren transformiert. Als Kontrolle wurden die, die nur durch pYO354 transformiert waren, verwendet. Nach der Transformation wurden die Zellen auf eine Platte, enthaltend SD-Trp-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Aminosäuren (Difco), eine Mischung aus Nucleobasen und Aminosäuren, außer Tryptphan (20-400 mg/l)) aufgetragen und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Der resultierende Transformant wurde TIY19 pYOMG4 genannt.

Dieser auxotrophe dreifache Mutantenstamm TIY19pYOMG4, in den das &agr;-Mannosidase-I-Gen und das GnT-I-Gen eingeführt worden waren, um eine Zuckerkette vom Hybridtyp herzustellen, wurde international an dem National Institute of Bioscience and Human-Technology (1-1-3, Higashi, Tsukuba, Ibaraki) vom 2. Juli 1999 unter der Hinterlegungs-Nr. FERM BP-6775 hinterlegt.

Wie in Beispiel 3 wurde eine Zuckerkette hergestellt aus dem resultierenden Transformanten, um eine HPLC-Analyse durchzuführen.

Die Ergebnisse der Analyse durch die Amidsäule sind in 10 gezeigt. Eine Probe, die durch einen Kontrollvektor transformiert ist, entfaltete primär nur einen Höchstwert, wie in den Ergebnissen des Beispiels 3, der der Elutionsposition des Man8GlcNAc2-PA-Standards (Takara Shuzo Co., Ltd.) entspricht (10, A). TIY19pYOMG4, enthaltend das &agr;-1,2-Mannosidasegen und das GnT-I-Gen, entfaltete primär fünf Höchstwerte (10, B). Von diesen fünf Höchstwerten entsprachen vier (10, B; Höchstwerte a, c, d und e) den Elutionspositionen der Man5GlcNAc2-PA-, Man6GlcNAc2-PA-, Man7GlcNAc2-PA- und Man8GlcNAc2-PA-Standards. Diese Zuckerketten werden als Zuckerkette vom humanen hohen Mannosetyp bezeichnet. Außerdem trat ein neuer Höchstwert (10, B; Höchstwert b) auf, der nicht festgestellt wurde, wenn nur das &agr;-1,2-Mannosidasegen eingeführt wurde. Die Elutionsposition dieses Höchstwerts entsprach der in Beispiel 5 hergestellten authentischen Probe des GlcNAcMan5GlcNAc2-Zuckerketten-Standards vom Hybridtyp. Darüber hinaus wurden die Fraktionen, die diesem Höchstwert entsprachen, gesammelt und wie in Beispiel 3 einer Umkehrphasensäule unterworfen. Die Säule, das Lösungsmittel und die Bedingungen entsprachen den in Beispiel 5 beschriebenen. Die gesammelte Zuckerkettenfraktion entfaltete primär einen Höchstwert mit einer Umkehrphasensäule (11) und dieser Höchstwert entsprach wieder der Elutionsposition des GlcNAcMan5GlcNAc2-PA-Standards. Dadurch wird deutlich, dass das durch den TIY19-pYOMG4-Stamm hergestellte Mannoprotein eine GlcNAcMan5GlcNAc2-Zuckerkette vom Hybridtyp enthielt.

[Beispiel 7] Expression von humaner Leber-&agr;-Mannosidase-II der Leber in Hefe

&agr;-Mannosidase-II ist ein Enzym, das im Golgiapparat eine Zuckerkette vom Hybridtyp in eine einzelsträngige Zuckerkette vom Komplextyp umwandelt.

Die Nucleotidsequenz des &agr;-Mannosidase-II-Gens der humanen Leber ist in der Datenbank GenBank unter der Hinterlegungs-Nr. U31520 registriert (Misago et al., Proc. Natl. Acad. Sci., 92, 11766-11770 (1995)). Unter Verwendung der fertigen Marathon-cDNA der humanen Leber (Clontech) als Matrize wurde ein Teil, der den endterminalen Bereich von &agr;-Mannosidase-II kodiert, durch PCR unter Verwendung des Primers M (CGCCGCCGAGCTCTAAAAAAATGAAGTTAAGCCGCC: SEQ ID Nr. 13) und des Primers N (ATCCCACCACTTTGAAAGGT: SEQ ID Nr. 14) amplifiziert und ein Teil, der den zentralen Bereich kodiert, wurde durch PCR unter Verwendung des Primers O (GAAGACTCACGGAGGAAGTT: SEQ ID Nr. 15) und des Primers P (ATGGCGGTATATGTGCTCGA: SEQ ID Nr. 16) amplifiziert und ein Teil, der den C-terminalen Bereich kodiert, wurde durch PCR unter Verwendung des Primers Q (CGCAGTTTGGGATACAGCAA: SEQ ID Nr. 17) und des Primers R (ATTATTATTAGCGGCCGCCCCTCAACTGGATTCG: SEQ ID Nr. 18) amplifiziert. Das resultierende DNA-Fragment wurde in die SrfI-Stelle des PCR-Scripts eingeführt. Die Sequenz wurde bestätigt und anschließend an der BglII-Stelle rekombiniert, um eine adäquate Sequenz, die alle Bereiche kodiert, herzustellen. Dieses Plasmid wurde pCRMAN2 genannt.

Um die Expression des Zielproteins zu bestätigen, wurde ein Gen hergestellt, bei dem 30 Bp von HA-tag, das das Influenzavirus Hämagglutininepitop kodiert, an das 3'-Ende des &agr;-Mannosidase-II-Gens gebunden, um dreimal wiederholt zu werden, wodurch ein Vektor erzeugt wurde. D. h. eine doppelsträngige DNA, umfassend die Sequenz S (SEQ ID Nr. 19) wurde chemisch synthetisiert und zwischen die BamHI-Stelle und die EcoRI-Stelle des Expressionsplasmids pYEX-BX eingeführt. Dieses Plasmid wurde pYEX-BX-3HA genannt. Daraufhin wurde ein Teil, der &agr;-Mannosidase-II kodiert, aus BamHI und EcoRI von pCRMAN2 herausgeschnitten und zwischen die SacI-Stelle und die NotI-Stelle von pYEX-BX-3HA eingeführt. Dieses Plasmid wurde pYEMAN2-HA genannt.

Zur Verbesserung der Expressionsstärke in Hefe wurde ein Teil, der den transmembranen Bereich von &agr;-Mannosidase-II kodiert, mit dem Transmembran eines Gens, das &agr;-1,6-Mannosyltransferase in Hefe (OCH1) kodiert, substituiert. D. h. eine doppelsträngige DNA, umfassend die Sequenz T (SEQ ID Nr. 20) wurde chemisch synthetisiert und wurde zwischen die SacI-Stelle und die EcoRI-Stelle von pBluescript eingeführt. Dieses Plasmid wurde als pBOCH1 bezeichnet. Im Gegensatz dazu wurde pYMAN2-HA als Matrize eingesetzt, um einen Teilbereich des Teils, der den katalytischen Bereich in &agr;-Mannosidase-II kodiert, unter Verwendung des Primers U (TTAGACTACCCATGGAACCCGCGCCGCGAGGGCTCCTTC: SEQ ID Nr. 21) und des Primers V (CAGGAGAACTTTGGTTCGAAAAAGCTTTGACTTCTT: SEQ ID Nr. 22) amplifiziert. Diese Sequenz wurde bestätigt und an der NcoI- und HindIII-Stelle anschließend gespalten, um zwischen der NcoI-Stelle und der HindIII-Stelle von pBOCH1 eingeführt zu werden. Ein Fragment wurde zwischen SacI und PstI dieses Plasmids herausgeschnitten und mit dem Fragment zwischen SacI und PstI von pYEMAN2-HA substituiert. Dieses Plasmid wurde als pYEOM2-HA bezeichnet.

S. cerevisiae Wildtyphefe YPH500 wurde als Wirt verwendet und die Transformation wurde durch das Lithiumacetatverfahren durchgeführt. pYEX-BX-3HA wurde als Kontrolle verwendet. Nach der Transformation wurden die Zellen auf der Platte, enthaltend SD-Ura-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Aminosäuren (Difco), eine Mischung aus Nucleobasen, außer Uracil und Aminosäuren (20-400 mg/l)) aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten.

Die transformierte Hefe wurde in SD-Ura-Medium bei 30°C bis OD660 = 0,8 kultiviert. Eine adäquate Kupfersulfatmenge wurde zugegeben, und die Mischung wurde zwei weitere Stunden kultiviert. Nach dem Ernten wurden die Zellen durch Glaskügelchen in SDS-Probenpuffer zerstört. Das erhaltene Zellextrakt wurde verwendet, um eine Westernblot-Analyse durchzuführen. Bei der Westernblot-Analyse wurde ein Anti-HA-Antikörper der Ratte als primärer Antikörper verwendet und ein Anti-Ratten-IgG Antikörper-Peroxidase-Komplex wurde als zweiter Antikörper verwendet und der Nachweis wurde durchgeführt, indem ein Röntgenfilm unter Einsatz von Super Signal Ultra als Substrat eingesetzt wurde. Im Ergebnis wurde überhaupt kein Signal bei der Kontrolle gesehen, ein Signal wurde an der Position eines Molekulargewichts von ungefähr 140.000 in dem mit pYEOM2-HA-transformierten Zellextrakts festgestellt (12).

Daraufhin wurde die Zuckerkette vom Hybridtyp (eine Struktur davon ist in Formel (IV) gezeigt), die in Beispiel 5 hergestellt wurde, als Substrat verwendet, um die Enzymaktivität der &agr;-Mannosidase-II zu messen. Die Zuckerkette vom Hybridtyp (100 pmol, eine Struktur davon ist in Formel (IV) gezeigt) wurde in einem Probenröhrchen getrocknet und 2 &mgr;l jeweils 0,2 M MnCl2, 1 M GlcNAc und 1 M Natriumacetatpuffer (pH 5,6) und 8 &mgr;l H2O wurden zu dem Röhrchen gegeben. Daraufhin wurden 8 &mgr;l Zellextrakt zugegeben, um die Enzymreaktion zu beginnen. Die Reaktionsmischung wurde über Nacht bei 37°C erwärmt und anschließend gekocht, um die Reaktion zu beendigen. Die Mischung wurde zentrifugiert, um eine unlösliche Fraktion zu entfernen und anschließend durch HPLC analysiert. Die HPLC-Analyse wurde unter den Bedingungen, die in Beispiel 5 verwendet wurden, durchgeführt. Im Ergebnis, wenn das Hefezellextrakt, in dem &agr;-Mannosidase-II exprimiert wurde, als Enzymquelle verwendet wurde, erhöhte sich ein Höchstwert entsprechend dem Elutionspunkt bei 40 Minuten deutlich im Vergleich zur Kontrolle (13, B). Der Höchstwert nach 40 Minuten entsprach der Elutionsposition einer einzelsträngigen Zuckerkette vom Komplextyp, die durch Formel (V) dargestellt ist (Oguri et al., J. Biol. Chem., 272, 22721-22727 (1997)):

wobei Man Mannose darstellt und GlcNAc N-Acetylglucosamin darstellt, das aus einem Enzymverdau des PA-Zuckerkettenstandards (PA-Sugar Chain 022, Takara Shuzo Co., Ltd.) erhalten wurde und folglich wurde bestätigt, dass der Höchstwert &agr;-Mannosidase-II-Aktivität entspricht.

[Beispiel 8] Herstellung der auxotrophen Dreifachmutante, in der ein Gen, das zur Herstellung einer doppelsträngigen Zuckerkette vom Komplextyp notwendig ist, eingeführt wurde

Über die Expression von humanem GnT-II in Hefe wurde von Yoshida et al. berichtet (Yoshida S. et al., Abstracts of the meeting on Yeast Cell Biology, S. 279, Cold Spring Harbor Laboratory (1997)). Der GnT-II-Genbereich, enthaltend einen Promotor, wurde an XbaI des Expressionsvektors pSY114-GnT-II herausgeschnitten und wurde in der XbaI-Stelle von pBluescript SK eingeführt. Dieses Plasmid wurde als pBlueGT2 bezeichnet. Danach wurde der GnT-I-Genbereich, enthaltend einen Promotor, an BamHI und XbaI des Plasmids pYOG4, das in Beispiel 6 beschrieben ist, herausgeschnitten und wurde in die BamHI-Stelle und die XbaI-Stelle von pBlueGT2 eingeführt. Das Zielfragment wurde an BssHII aus diesem Plasmid herausgeschnitten, durch DNA T4-Polymerase mit glatten Enden versehen und anschließend in die SmaI-Stelle des pASZ10-Plasmids mit ADE2 als Marker (Stotz & Linder, Gene, 95, 91-98 (1990)) eingeführt. Dieses Plasmid wurde als pASZGNI2 bezeichnet. pASZGNI2 wurde an HpaI linearisiert und der auxotrophe Dreifachmutantenstamm TIY19, der in Beispiel 1 hergestellt wurde, wurde durch das Lithiumacetatverfahren transformiert. Nach der Transformation wurden die Zellen auf eine Platte, enthaltend SD-Ade-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen, außer Adenin und Aminosäuren (20-400 mg/l)), enthaltend 0,3 M KCl, aufgetragen und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Die Genom-DNA wurde aus dem Transformanten hergestellt und die Einführung des GnT-I-Gens und des GnT-II-Gens in ein Chromosom im ADE2-Bereich durch PCR bestätigt. Dieser Transformant wurde als YCY22-Stamm bezeichnet. Ein Zellextrakt des YCY22-Stammes wurde verwendet, um die jeweiligen Enzymaktivitäten zu messen, um die Expression von GnT-I und GnT-II zu bestätigen.

Auf der anderen Seite wurde über die Expression von humanem &bgr;-1,4-GalT in Hefe durch Yoshida et al., oben beschrieben, berichtet (Yoshida S. et al., Abstracts of the meeting on Yeast Cell Biology, S. 279, Cold Spring Harbor Laboratory (1997)). Der &bgr;-1,4-GalT-Genbereich, enthaltend einen Promotor, wurde an SalI und XhoI aus dem Expressionsvektor pGalT13C herausgeschnitten und wurde in die SalI-Stelle und die XhoI-Stelle von pRS403 eingeführt. Dieses Plasmid wurde als pRSGAL1 bezeichnet. Über die Expression von humanem UDP-Gal-Transporter (Ugt2p) wurde von Kainuma et al. berichtet (Kainuma et al., Glycobioloy, 9, 133-141 (1999)).

Ein Genbereich, der einen Promotor enthält, wurde an BamHI des Plasmids YEp352-GAP-UGT2 zur Expression des Gens (UGT2) herausgeschnitten und in die BamHI-Stelle von pRSGAL1 eingeführt. Dieses Plasmid wurde als pRSGATP1 bezeichnet. pRSGATP1 wurde an NdeI linearisiert und der YCY22-Stamm wurde durch das Lithiumacetatverfahren transformiert. Nach der Transformation wurden die Zellen auf eine Platte, enthaltend SD-His-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen und Aminosäuren, außer Histidin (20-400 mg/l)), enthaltend 0,3 M KCl, aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Die Genom-DNA wurde aus dem Transformanten hergestellt und die Einführung des &bgr;-1,4-GalT-Gens und des UGT2-Gens in ein Chromosom im HIS3-Bereich durch PCR bestätigt. Dieser Transformant wurde als YCY42-Stamm bezeichnet. Ein Zellextrakt des YCY42-Stammes wurde verwendet, um die jeweiligen Enzymaktivitäten zu messen, wodurch die Expression von &bgr;-1,4-GalT und Ugt2p bestätigt wurde.

Daraufhin wurde ein Genfragment, enthaltend HA-tag, an SacI und SphI aus dem Vektor pYEOM2-HA zur Expression von &agr;-Mannosidase-II der humanen Leber herausgeschnitten und durch DNA T4-Polymerase mit glatten Enden versehen. Dieses Fragment wurde in die SmaI-Stelle von pAUR123 eingeführt. Nachdem bestätigt wurde, dass dieses Fragment an einen Promotor in der richtigen Richtung gebunden ist, wurde ein &agr;-Mannosidase-II-Genbereich, enthaltend einen Promotor, an BamHI herausgeschnitten und in die BamHI-Stelle von pRS406 eingeführt. Dieses Plasmid wurde an NdeI linearisiert und der YCY42-Stamm wurde durch das Lithiumacetatverfahren transformiert. Nach der Transformation wurden Zellen auf der Platte, enthaltend SD-Ura-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen, außer Uracil und Aminosäuren (20-400 mg/l)), enthaltend 0,3 M KCl, aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Genom-DNA wurde aus dem Transformanten hergestellt und die Einführung des Gens in ein Chromosom im URA3-Bereich durch PCR bestätigt. Dieser Transformant wurde als YCY52-Stamm bezeichnet. Ein Zellextrakt des YCY52-Stammes wurde verwendet, um die Enzymaktivität zu messen, wodurch die Expression von &agr;-Mannosidase-II bestätigt wurde.

Das &agr;-1,2-Mannosidase-Genfragment, enthaltend einen Promotorbereich, wurde an NaeI und SmaI des Vektors pGAMH1 zur Expression von &agr;-1,2-Mannosidase, wie in Beispiel 4 beschrieben, herausgeschnitten und in die SmaI-Stelle des pY0325-Vektors eingeführt. Dieses Plasmid wurde als pYOM5 bezeichnet. UDP-GlcNAc-Transportergen, das notwendig ist, um ein Substrat dem Golgiapparat zuzuführen, wurde außerdem eingeführt. Über die Expression von humanem UDP-GlcNAc-Transportergen in Hefe wurde von Ishida et al. berichtet (Ishida et al., J. Biochem., 1261, 68-77 (1999)). Dieser Expressionsvektor wurde als Matrize eingesetzt, um einen UDP-GlcNAc-Transportergenbereich durch PCR unter Verwendung des Primers W (AGAGCGGCCGCAAAATGTTCGCCAACCTAA: SEQ ID Nr. 23) und des Primers X (TTTTGTCGACTAGACGCGTGAAGCATGCCC: SEQ ID Nr. 24) amplifiziert. Diese Sequenz wurde bestätigt und anschließend an NotI und SalI gespalten und mit der Sequenz zwischen der NotI-Stelle und der SalI-Stelle von pG3-N substituiert. Das UDP-GlcNAc-Transportergenfragment, enthaltend einen Promotorbereich, wurde am NaeI und SmaI dieses Plasmids gespalten und anschließend in die SmaI-Stelle von pYOM5 eingeführt. Dieses Plasmid wurde als pYOMR5 bezeichnet. Der YCY52-Stamm wurde unter Verwendung dieses Plasmids durch das Lithiumacetatverfahren transformiert. Nach der Transformation wurden die Zellen auf die Platte, enthaltend SD-Leu-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen und Aminosäuren, außer Leucin (20-400 mg/l)), enthaltend 0,3 M KCl, aufgetragen und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Dieser Transformant wurde als YCY73-Stamm bezeichnet. Ein Zellextrakt des YCY73-Stammes wurde verwendet, um die Enzymaktivität zu messen, wodurch die Expression von &agr;-1,2-Mannosidase und UDP-GlcNAc-Transporter bestätigt wurde.

Ein Plasmid zum Integrieren von msdS und hUGTre12 wurde hergestellt. PGAMH wurde an SmaI und NaeI gespalten, und der GAP-Promotor und die msdS-Sequenz wurden herausgeschnitten, um in die PvuII-Stelle von pRS404 eingeführt zu werden. Dieses Plasmid wurde als msdS-pRS404 bezeichnet. Ein Plasmid hUGTre12-pG3, ein Plasmid, bei dem hUGTre12 stromabwärts des GAP-Promotors eingeführt wurde, wurde an SmaI und NaeI gespalten und der GAP-Promotor und die hUGTre12-Sequenz wurden herausgeschnitten, um die PstI-Stelle von msdS-pRS404 eingeführt zu werden. Dieses Plasmid wurde als HM-pRS404 bezeichnet. HM-pRS404 wurde an BstXI in TRP1 gespalten und verwendet zum Transformieren des YCY42-Stammes durch das Lithiumacetatverfahren. Der Transformant wurde kultiviert in 5 ml YPAD+0,3 M KCl bei 30°C 2 Tage, und die Einführung von msdS und hUGTre12 in TRP1 eines Chromosoms wurde durch PCR bestätigt. Ein Zellextrakt des Transformanten wurde verwendet, um die Enzymaktivität zu messen und die Expression von &agr;-1,2-Mannosidase und UDP-GlcNAc-Transporter in beiden Stämmen wurde bestätigt. Der Stamm, in den msdS und hUGTre12 in den YCY42-Stamm eingeführt wurden, wurde als TIY63-Stamm bezeichnet.

Darüber hinaus, ein Genfragment, enthaltend HA-tag wurde an SacI und SphI aus dem Vektor pYEOM2-HA zur Expression von &agr;-Mannosidase-II der humanen Leber herausgeschnitten und durch DNA T4-Polymerase mit glatten Enden versehen. Dieses Fragment wurde in die SmaI-Stelle von pAUR123 eingeführt. Nachdem bestätigt wurde, dass dieses Fragment an einen Promotor in der richtigen Richtung gebunden ist, wurde der &agr;-Mannosidase-II-Genbereich, enthaltend einen Promotorbereich, an BamHI herausgeschnitten und in die BamHI-Stelle von pRS406 eingeführt. Dieses Plasmid wurde an NdeI linearisiert und der TIY63-Stamm wurde durch das Lithiumacetatverfahren transformiert. Nach der Transformation wurden die Zellen auf die Platte, enthaltend SD-Ura-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen, außer Uracil und Aminosäurenmischung (20-400 mg/l)), enthaltend 0,3 M KCl, aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Die Genom-DNA wurde aus dem Transformanten hergestellt und die Einführung des Gens in ein Chromosom im URA3-Bereich durch PCR bestätigt. Dieser Transformant wurde als MSY3-Stamm bezeichnet. Ein Extrakt des MSY3-Stammes wurde verwendet, um die Enzymaktivität zu messen, wodurch die Expression von &agr;-Mannosidase-II bestätigt wurde.

[Beispiel 9] Herstellung der auxotrophen Vierfachmutante, bei der ein Gen, das zur Herstellung einer doppelsträngigen Zuckerkette vom Komplextyp notwendig ist, eingeführt worden ist

Zu Beginn wurde das in Beispiel 8 hergestellte Plasmid pASZGN12 an HpaI linearisiert und der auxotrophe vierfache Mutantenstamm YS123-4A, hergestellt in Beispiel 2, wurde durch das Lithiumacetatverfahren transformiert. Nach der Transformation wurden die Zellen auf der Platte, enthaltend SD-Ade-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen, außer Adenin und Amonosäuren (20-400 mg/l)), enthaltend 0,3 M KCl, aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Die Genom-DNA wurde aus dem Transformanten hergestellt und die Einführung des GnT-I-Gens und des GnT-II-Gens in ein Chromosom im ADE2-Bereich durch PCR bestätigt. Dieser Transformant wurde als YCY122-Stamm bezeichnet. Ein Zellextrakt des YCY122-Stammes wurde verwendet, um die jeweiligen Enzymaktivitäten zu messen, wodurch die Expression von GnT-I und GnT-II bestätigt wurde.

Daraufhin wurde das in Beispiel 8 hergestellte Plasmid pRSGATP1 an NdeI linearisiert und der YCY122-Stamm durch das Lithiumacetatverfahren transformiert. Nach der Transformatioin wurden die Zahlen auf der Platte, enthaltend SD-His-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen und Aminosäuren, außer Histidin (20-400 mg/l)), enthaltend 0,3 M KCl, aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Die Genom-DNA wurde aus dem Transformanten hergestellt und die Einführung des &bgr;-1,4-GalT-Gens und des UGT2-Gens in ein Chromosom im His3-Bereich durch PCR bestätigt. Der Stamm wurde als YCY142-Stamm bezeichnet. Ein Zellextrakt des YCY142-Stammes wurde verwendet, um die jeweiligen Enzymaktivitäten zu messen, wodurch die Expression von &bgr;-1,4-GalT und Ugt2p bestätigt wurde.

Darüber hinaus wurde das in Beispiel 8 hergestellte Plasmid pYOMR5 verwendet, um den YCY142-Stamm durch das Lithiumacetatverfahren zu transformieren. Nach der Transformation wurden die Zellen auf die Platte, enthaltend SD-Leu-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen und Aminosäuren, außer Leucin (20-400 mg/l)), enthaltend 0,3 M KCl, aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Dieser Transformant wurde als YCY163-Stamm bezeichnet. Ein Zellextrakt des YCY163-Stammes wurde verwendet, um die Enzymaktivität zu messen, wodurch die Expression von &agr;-1,2-Mannosidase und UDP-GlcNAc-Transporter bestätigt wurde.

Dieser YCY163-Stamm wurde auf Lectinfärbungsfähigkeit untersucht, um Änderungen in der Zuckerkettenstruktur des Mannoproteins auf der Zelloberfläche von Hefe zu beobachten. Von Concanavalin A ist bekannt, dass es spezifische Zuckerketten vom hohen Mannosetyp, Hybridtyp, doppelsträngigen Komplextyp und dergleichen, enthaltend 3 Mannosereste, bindet und die Affinität für Zuckerketten vom hohen Mannosetyp ist höher als die von Zuckerketten vom Hybridtyp und von Zuckerketten vom doppelsträngigen Komplextyp. Eine Lösung aus Texas-rot-markiertem Concanavalin A wurde mit geernteten Hefezellen gemischt und bei 4°C 2 Stunden stehen gelassen, wobei sporadisch gerührt wurde. Das Reaktionsprodukt wurde mit PBS und anschließend mit PBS, enthaltend 10 mM &agr;-Methylmannosid, gewaschen, um unter einem Fluoreszenzmikroskop untersucht zu werden. Als Ergebnis wurde die Peripherie einer Zelle im YS134-4A-Stamm sogar nach dem Waschen mit Fluoreszenz gefärbt, die Fluoreszenz, die auf der Peripherie einer Zelle im YCY163-Stamm festgestellt wurde, verringerte sich jedoch offensichtlich. Dies deutet darauf hin, dass sich die Zuckerketten vom hohen Mannosetyp verringern, während die Zuckerketten vom Komplextyp im YCY163-Stamm hergestellt wurden.

[Beispiel 10] Herstellung von humanem Fibroblasten-Wachstumsfaktor (FGF) in einer Hefemutante, die eine Zuckerkette vom Säugertyp herstellen kann, und die Modifizierung der Zuckerkettenstruktur

Das FGF6-1-chimäre Gen (secFGF (N35)) wurde von Atsuko Yoneda vom National Institute of Bioscience and Human-Technology (Yoneda et al., BioTechniques, 27, 576-590 (1999)) gespendet. SecFGF(N35)/pBS wurde an SmaI und NaeI gespalten und FGF wurde herausgeschnitten, um in die HindIII-Stelle von pGEM2-&agr;36 eingeführt zu werden. Dieses Plasmid wurde als pFGF&agr;23 bezeichnet. pFGF&agr;23 wurde an EcoRI geschnitten und der Prepro-&agr;-Faktor und FGF-Bereich wurde herausgeschnitten, um in die EcoRI-Stelle des Plasmids pUC119 eingeführt zu werden. Dieses Plasmid wurde als FGF-pUC119 bezeichnet. Um die EAEA-Sequenz des &agr;-Faktors zu entfernen, wurden der Primer Y (CGCCAGGGTTTTCCCAGTCACGAC: SEQ ID Nr. 25) und Primer Z (ATGGGCCGGCTCTTTTATCCAAAGATAC: SEQ ID Nr. 26) verwendet, um durch PCR zu amplifizieren. Dieses DNA-Fragment wurde in die EcoRI-Stelle von pUC18 eingeführt, um das Plasmid pAF02 herzustellen. pFGF01 wurde an NaeI und SmaI geschnitten, um FGF herauszuschneiden, um S in die NaeI-Stelle und die SmaI-Stelle von pAF92 einzuführen. Dieses Plasmid wurde als pAF03 bezeichnet. pAF03 wurde an EcoRI gespalten und der Prepro-&agr;-Faktor und der FGF-Bereich wurden herausgeschnitten und wurden stromabwärts des GAP-Promotors des Plasmids YEp352GAP eingeführt, um ein Plasmid pAFF2 herzustellen. pAFF2 wurde an AatII und HpaI gespalten und der 2 &mgr;m-Bereich wurde herausgeschnitten, um das Plasmid pAFF3 herzustellen, das in Hefe integriert wird. Daraufhin wurde pAFF3 an ApaLI und AccI gespalten, um Sequenzen des GAP-Promotors und FGF herauszuschneiden, um in die PvuII-Stelle des Plasmids pY0325, enthaltend einen Leu2-Marker, eingeführt zu werden. Der 2 &mgr;m-Bereich des Plasmids wurde außerdem am SpeI geschnitten und entfernt. Dieses Plasmid wurde als pAFF9 bezeichnet. pAFF9 wurde an EcoRV geschnitten, um linearisiert zu werden, und Hefe (der TIY19-Stamm, der YCY42-Stamm) wurde durch das Lithiumacetatverfahren transformiert. Nach der Transformation wurden die Zellen auf der Platte, enthaltend SD-Leu-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen und Aminosäuren, außer Leucin (20-400 mg/l)), aufgebracht und bei 30°C 2 Tage kultiviert, um die jeweiligen Transformanten zu erhalten.

Diese Transformanten wurden in 5 ml YPAD+0,3 M KCl bei 30°C 3 Tage kultiviert. 50 &mgr;l Bettvolumen der Heparin-Sepharosesuspension (Pharmacia) wurden zu einer Kulturüberstandsflüssigkeit gegeben, und die Mischung wurde bei 4°C über Nacht geschüttelt, um FGF an Heparin-Sepharose zu adsorbieren. Danach wurde die Heparin-Sepharose durch Zentrifugierung gewonnen und in SDS-Probenpuffer gekocht, um den Überstand einer SDS-PAGE zu unterwerfen. Westernblotting wurde unter Verwendung eines anti-FGF-Antikörpers durchgeführt, um die FGF-Expression zu bestätigen. Die FGF-Einführung in ein Chromosom bei LEU2 wurde durch PCR bestätigt. Ein Stamm, in den FGF in den TIY19-Stamm integriert wurde, wurde als TIY48-Stamm bezeichnet, und ein Stamm, in den FGF in den YCY42-Stamm integriert wurde, wurde als TIY49-Stamm bezeichnet.

Um stabil und effizient das Protein zu exprimieren, wurde ein Plasmid zum Integrieren von msdS hergestellt. Das Plasmid pGAMH, in das msdS stromabwärts des GAP-Promotors eingeführt worden war, wurde an EcoRI geschnitten, um ein Plasmid herzustellen, aus dem ein 2 &mgr;m-Bereich entfernt wurde. Dieser Stamm wurde als pImsdS bezeichnet. pImsd5 wurde am XbaI in TRP1 gespalten, und TIY48 (&Dgr;mnn1::hisG &Dgr;mnn4::hisG &Dgr;och1::hisG FGF::LEU2) und TIY49 (&Dgr;mm1::hisG &Dgr;mnn4::hisG &Dgr;och1::hisG FGF::LEU2 ade2::[GnT-I & Gnt-II] his3::[&bgr;-1,4-GalT & UGT2]) wurden durch das Lithiumacetatverfahren transformiert. Jede der erhaltenen Transformanten wurde in 5 ml YPAD+0,3 M KCL bei 30°C 3 Tage kultiviert. 50 &mgr;l Heparin-Sepharose (Pharmacia) wurden zu einer Kulturlösung gegeben, und die Mischung wurde bei 4°C über Nacht geschüttelt, um FGF an Heparin-Sepharose zu adsorbieren. Danach wurde Heparin-Sepharose gewonnen. Westernblotting wurde anschließend unter Verwendung eines FGF-Antikörpers durchgeführt, um die msdS-Expression zu bestätigen. Daraufhin wurde die Einführung von msdS in ein Chromosom in TRP1 durch PCR bestätigt. Ein Stamm, in den msdS in den TIY48-Stamm eingeführt wurde, wurde als TIY53-Stamm bezeichnet, und ein Stamm, in den msdS in den TIY49-Stamm eingeführt wurde, wurde als TIY54-Stamm bezeichnet.

Ein Plasmid zum Integrieren von msdS und hUGTre12 wurde hergestellt. PGAMH wurde an SmaI und NaeI gespalten und der GAP-Promotor und die msdS-Sequenz wurden ausgeschnitten, um in die PvuII-Stelle von pRS404 eingeführt zu werden. Dieses Plasmid wurde als msdS-pRS404 bezeichnet. hUGTre12-pG3, ein Plasmid, bei dem hUGTre12 stromabwärts des GAP-Promotors eingeführt wurde, wurde an SmaI und NaeI gespalten, und der GAP-Promotor und die hUGTre12-Sequenz wurden herausgeschnitten, um in die PstI-Stelle von msdS-pRS404 eingeführt zu werden. Dieses Plasmid wurde als HM-pRS404 bezeichnet. HM-pRS404 wurde an BstXI in TRP1 gespalten und der Stamm TIY48 und der Stamm TIY49 wurden durch das Lithiumacetatverfahren transformiert. Jede der Transformanten wurde in 5 ml YPAD+0,3 M KCL bei 30°C 3 Tage kultiviert. 50 &mgr;l Bettvolumen der Heparin-Sepharosesuspension (Pharmacia) wurden zu einer Kulturüberstandsflüssigkeit gegeben, und die Mischung wurde bei 4°C über Nacht geschüttelt, um FGF an Heparin-Sepharose zu adsorbieren. Danach wurde Heparin-Sepharose durch Zentrifugierung gewonnen und in SDS-Probenpuffer gekocht, um den Überstand einer SDS-PAGE zu unterwerfen. Westernblotting wurde unter Verwendung eines anti-FGF-Antikörpers durchgeführt, um die FGF-Expression zu bestätigen. Die Einführung von msdS und hUGTre12 in ein Chromosom in TRP1 wurde durch PCR außerdem bestätigt. Ein Zellextrakt wurde verwendet, um die Enzymaktivität zu messen, so dass die Expression von &agr;-1,2-Mannosidase und UDP-GlcNAc-Transporter in beiden Stämmen bestätigt werden konnte. Ein Stamm, in den msdS und hUGTre12 in den Stamm TIY48 integriert wurden, wurde als TIY59-Stamm bezeichnet, und ein Stamm, in den msdS und hUGTre12 in den Stamm TIY49 integriert wurden, wurde als TIY60-Stamm bezeichnet.

Zur Herstellung einer Zuckerkette wurden der TIY48-Stamm und der TIY53-Stamm, in den FGF in ein Chromosom bei LEU2 integriert worden war, verwendet, um FGF aus 3 l Kulturlösung zu reinigen. Nach dem Kultivieren in 3 l YPAD+0,3 M KCL bei 30°C über 3 Tage, wurden 2 ml Heparin-Sepharose zu der Kulturlösung, aus der die Zellen durch Zentrifugieren entfernt wurden, gegeben. Die Mischung wurde bei 4°C über Nacht geschüttelt, um FGF an Heparin-Sepharose zu adsorbieren. Heparin-Sepharose wurde gewonnen und in eine Säule gepackt. FGF wurde von Heparin-Sepharose durch Erhöhen der Salzkonzentration unter Verwendung von PBS+0,01 % CHAPS und PBS+2,5 M NaCl+0,01 % CHRPS als Lösungsmittel eluiert.

Ungefähr 150 &mgr;g gereinigter FGF wurden einer Umkehrphasensäule zum Entsalzen unterworfen. &mgr;RPC C2/C18 PC3.2/3-Säule (Pharmacia) wurde als Säule verwendet und 0,1 % Trifluoressigsäure und 0,1 %Trifluoressigsäure-60 % Acetonitril wurden als Lösungsmittel zum Eluieren von der Umkehrphasensäule verwendet.

Die von der Säule eluierte Probe wurde getrocknet und eine Hydrazinolyse wurde durchgeführt. 2 ml Hydrazin wurden im Vakuumzustand zugegeben, und die Mischung wurde bei 110°C 60 Minuten behandelt. Die Mischung wurde danach auf Raumtemperatur abgekühlt, um N-Acetylierung durchzuführen. 250 &mgr;l 0,2 M Ammoniumacetat und 25 &mgr;l Essigsäureanhydrid wurden zugegeben und die Mischung wurde gründlich gerührt und bei Raumtemperatur 30 Minuten stehen gelassen. Darüber hinaus wurden 250 &mgr;l 0,2 M Ammoniumacetat und 25 &mgr;l Essigsäureanhydrid zugegeben und die Mischung wurde gründlich gerührt und bei Raumtemperatur 30 Minuten stehen gelassen. Die Reaktionslösung wurde bis zur Trockenheit konzentriert, um ein Zuckerkettenpräparat herzustellen.

Die resultierende Zuckerkette wurde dem folgenden Vorgang zur Fluoreszenzmarkierung (Pyridylaminierung) unterworfen. Das Zuckerkettenpräparat wurde bis zur Trockenheit konzentriert, und 20 &mgr;l Kupplungsreagens (eine Lösung aus 300 mg 2-Aminopyridin in 100 &mgr;l Essigsäure) wurden anschließend zugegeben. Die Mischung wurde hermetisch versiegelt und anschließend bei 90°C 60 Minuten behandelt. Danach wurden 20 &mgr;l Reduktionsmittel (eine Lösung aus 10 mg Borandimethylaminkomplex in 50 &mgr;l Essigsäure) zugegeben. Die Mischung wurde anschließend hermetisch versiegelt und bei 80°C 60 Minuten behandelt. Nach der Reaktion wurden 20 &mgr;l Triethylaminmethanol zugegeben und gründlich gerührt. Daraufhin wurden 40 &mgr;l Toluol zugegeben und gründlich gerührt. Die Mischung wurde bis zur Trockenheit bei 60°C 10 Minuten unter einem Stickstoffgasstrom konzentriert.

Danach wurden 20 &mgr;l Methanol zu der Reaktionslösung gegeben und gründlich gerührt. 40 &mgr;l Toluol wurden anschließend zugegeben und gründlich gerührt. Die Mischung wurde bis zur Trockenheit bei 60°C 10 Minuten unter einem Stickstoffgasstrom konzentriert. Dieser Vorgang wurde dreimal wiederholt. 50 &mgr;l Toluol wurden zu dem Rückstand gegeben, um bis zur Trockenheit bei 60°C 10 Minuten unter einem Stickstoffgasstrom zu konzentrieren. Nach der Reaktion wurde HW-40-Gelfiltrations-Säulenbehandlung durchgeführt, um nicht umgesetztes 2-Aminopyridin zu entfernen.

Eine Zuckerkettenstruktur wurde durch HPLC unter Verwendung einer Aminosäule analysiert. Asahipak NH2P-40 (4,6 mm × 250 mm) wurde als Säule verwendet, und eine Mischlösung aus 200 mM Essigsäure-Triethylaminpuffer (pH 7,3) und Acetonitril (7:3, Lösungsmittel A) und eine Mischlösung aus 200 mM Essigsäure-Triethylaminpuffer (pH 7,3) und Acetonitril (2:8, Lösungsmittel B) wurden als Lösungsmittel hergestellt.

Die Säule wurde äquilibriert, indem das Lösungsmittel A zuvor bei einer Fließrate von 1,0 ml/min. durchgelaufen wurde. Sofort nach der Probeninjektion wurde das Verhältnis des Lösungsmittels B linear auf 100 % über eine Zeitspanne von 50 Minuten erhöht, und anschließend wurde das Lösungsmittel B 20 Minuten durchgeleitet, wobei dessen Verhältnis auf 100 % gelassen wurde, so dass PA-Oligosaccharid eluierte. Das Analyseergebnis ist in 14 gezeigt. Die von TIY48 abstammende Probe entfaltete primär einen Höchstwert (14, oben), wie im Beispiel 2, und dieser Höchstwert entsprach der Elutionsposition des Man8GlcNAc2-PA-Standards (Takara Shuzo Co., Ltd.). Der TIY53-Stamm, enthaltend das &agr;-1,2-Mannosidasegen, entfaltete dagegen primär einen Höchstwert (14, unten). Dieser Höchstwert entsprach der Elutionsposition des Man5GlcNAc2-PA-Standards. Dies deutet darauf hin, dass FGF, ein im TIY53-Stamm exprimiertes humanes Glycoprotein, eine Man5GlcNAc2-Zuckerkette aufwies, die ein Vorläufer von fast 100 % der Zuckerketten vom Hybridtyp und Komplextyp ist.

Ein Genfragment, enthaltend HA-tag, wurde außerdem aus SacI und SphI des Vektors pYEOM2-HA zum Exprimieren von &agr;-Mannosidase-II der humanen Leber ausgeschnitten und durch DNA T4-Polymerase mit glatten Enden versehen. Dieses Fragment wurde in die SmaI-Stelle von pAUR123 eingeführt. Nachdem bestätigt wurde, dass dieses Fragment an einen Promotor in der richtigen Richtung gebunden ist, wurde der &agr;-Mannosidase-II-Genbereich, enthaltend einen Promotorbereich, an BamHI ausgeschnitten und in die BamHI-Stelle von pRS406 eingeführt. Dieses Plasmid wurde an NdeI linearisiert und der TIY60-Stamm wurde durch das Lithiumacetatverfahren transformiert. Nach der Transformation wurden die Zellen auf der Platte, enthaltend SD-Ura-Medium (2 % Glucose, 0,67 % Hefestickstoffbase w/o Amonosäuren (Difco), eine Mischung aus Nucleobasen, außer Uracil und Aminosäuren (20-400 mg/l)), enthaltend 0,3 M KCL, aufgebracht und bei 30°C 2 Tage kultiviert, um einen Transformanten zu erhalten. Die Genom-DNA wurde aus dem Transformanten hergestellt und die Einführung des Gens in ein Chromosom im URA3-Bereich durch PCR bestätigt. Der Transformant wurde als MSY1-Stamm bezeichnet. Ein Zellextrakt des MSY1-Stammes wurde verwendet, um die Enzymaktivität zu messen, wodurch die Expression von &agr;-Mannosidase-II bestätigt wurde.

Industrielle Anwendbarkeit

Die neu gezüchtete auxotrophe Dreifachmutante und die auxotrophe Vierfachmutante der Erfindung können eine große Menge von neutralen Zuckerketten mit hoher Reinheit herstellen, die identisch mit Zuckerketten vom hohen Mannosetyp sind, die im Menschen und anderen Säugerzellen hergestellt werden, oder von Glycoproteinen mit den neutralen Zuckerketten. Die Einführung von Genen für die Biosynthese einer Zuckerkette vom Säugertyp in die Mutanten ermöglicht außerdem eine Zuckerkette vom Säugertyp des hohen Mannosetyps, des Hybridtyps, des Komplextyps etc. oder eines Proteins mit der Zuckerkette vom Säugertyp.

SEQUENZLISTE


Anspruch[de]
Verfahren zur Herstellung einer Hefemutante, die ein Glycoprotein herstellt, das eine Zuckerkette, dargestellt durch die nachfolgend aufgeführte Formel (IV), aufweist:
wobei Man Mannose darstellt und GlcNAc N-Acetylglucosamin darstellt, und wobei das Verfahren die Schritte umfasst:

Zerstören des MNN1-Gens, MNN4-Gens und OCH1-Gens in einer Hefe vom Wildtyp; und

Einführen eines Gens, das &agr;-Mannosidase I mit einem C-terminalen ER-Retentionssignal kodiert und eines GnT-I-Gens, das den ORF umfasst, in die Hefe.
Verfahren zur Herstellung einer Hefemutante, das die Schritte umfasst:

Zerstören des MNN1-Gens, MNN4-Gens und OCH1-Gens in einer Hefe vom Wildtyp; und

Einführen eines Gens, das &agr;-Mannosidase I mit einem C-terminalen ER-Retentionssignal kodiert und eines GnT-I-Gens, das den ORF umfasst, eines &agr;-Mannosidase II-Gens und eines GnT-II-Gens, in die Hefe.
Verfahren zur Herstellung einer Hefemutante, das die Schritte umfasst:

Zerstören des ALG3-Gens, des MNN1-Gens, des MNN4-Gens und des OCH1-Gens in einer Hefe vom Wildtyp; und

Einführen eines Gens, das eine &agr;-Mannosidase I mit einem C-terminalen ER-Retentionssignal kodiert, in die Hefe.
Verfahren nach Anspruch 3, außerdem umfassend das Einführen eines GnT-I-Gens, das den ORF umfasst, und eines GnT-II-Gens in die Hefe. Verfahren nach einem der vorhergehenden Ansprüche, wobei die Hefemutante mindestens eine auxotrophe Mutation aufweist, ausgewählt aus einer ura3-Mutation, his3-Mutation, leu2-Mutation, ade2-Mutation, trp1-Mutation und can1-Mutation. Verfahren nach einem der vorhergehenden Ansprüche, wobei die Hefemutante eine ura3-Mutation aufweist. Verfahren nach einem der vorhergehenden Ansprüche, wobei das &agr;-Mannosidase I-Gen von Aspergillus saitoi abstammt. Verfahren zum Herstellen einer Hefemutante nach den Ansprüchen 1 bis 7, das das Zerstören des OCH1-Gens mit einem Uracil-Marker umfasst. Verfahren nach Anspruch 8, wobei der Uracil-Marker ura3 ist. Verfahren zur Herstellung eines Glycoproteins mit einer Zuckerkette, dargestellt durch die nachfolgende Formel (IV):
wobei Man Mannose darstellt und GlcNAc N-Acetylglucosamin darstellt, wobei das Verfahren die Schritte umfasst:

– Kultivieren der Hefemutante, hergestellt durch das Verfahren nach Anspruch 1 in einem Medium,

– Herstellen und Anhäufen des Glycoproteins in dem Kulturprodukt, und

– Sammeln des Glycoproteins aus dem Kulturprodukt.
Mutante Hefe, hergestellt durch eines der Verfahren nach den Ansprüchen 1 bis 9.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com