PatentDe  


Dokumentenidentifikation DE69836809T2 11.10.2007
EP-Veröffentlichungsnummer 0000975655
Titel Verbesserungen bei der auf Adaptoren basierenden Sequenzanalyse
Anmelder Solexa, Inc., Hayward, Calif., US
Erfinder DUBRIDGE, B., Robert, Belmont, CA 94002, US;
ALBRECHT, Glenn, Redwood City, CA 94061, US;
BRENNER, Sydney, Cambridge CB2 3PJ, GB;
GRYAZNOV, Sergei M., San Mateo, CA 94402, US;
MCCURDY, N., Sarah, San Mateo, CA 94403, US
Vertreter Müller-Boré & Partner, Patentanwälte, European Patent Attorneys, 81671 München
DE-Aktenzeichen 69836809
Vertragsstaaten BE, CH, DE, FR, GB, IT, LI, NL, SE
Sprache des Dokument EN
EP-Anmeldetag 14.04.1998
EP-Aktenzeichen 989182522
WO-Anmeldetag 14.04.1998
PCT-Aktenzeichen PCT/US98/07592
WO-Veröffentlichungsnummer 1998046621
WO-Veröffentlichungsdatum 22.10.1998
EP-Offenlegungsdatum 02.02.2000
EP date of grant 03.01.2007
Veröffentlichungstag im Patentblatt 11.10.2007
IPC-Hauptklasse C07H 21/04(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12Q 1/68(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Gebiet der Erfindung

Die Erfindung bezieht sich allgemein auf verbesserte Verfahren und Zusammensetzungen zur Analyse von Nukleinsäuren, und stärker bevorzugt auf ein Verfahren zur Analyse terminaler Nukleotide von Polynukleotiden durch die spezifische Ligation markierter Adaptoren.

Hintergrund

Der Wunsch nach dem Verständnis der genetischen Grundlage einer Krankheit und eines Wirts anderer physiologischer Zustände, die unterschiedliche Muster der Genexpression assoziieren, führte zur Entwicklung mehrerer Ansätze hinsichtlich der großtechnischen Analyse von DNA, Adams et. al., Hrsg., Automated DNA Sequencing and Analysis (Academic Press, New York, 1994). Die derzeitigen Techniken zur Analyse von Genexpressionsmustern umfassen die großtechnische Sequenzierung, Differential-Display, Indexierungsschemata, Subtraktionshybridisierung, Hybridisierung mit Festphasenanordnungen von cDNAs oder Oligonukleotiden und zahlreiche DNA-Fingerprinting-Verfahren, z. B. Lingo et. al., Science, 257: 967–971 (1992); Erlander et. al., internationale Patentanmeldung PCT/US94/13041; McClelland et. al., US-Patent Nr. 5,437,975; Unrau et al. Gene, 145: 163–169 (1994); Schena et. al., Science, 270: 467–469 (1995); Velculescu et. al., Science, 270: 484–486 (1995) und dergleichen.

Eine wichtige Unterklasse solcher Techniken nutzt doppelsträngige Oligonukleotid-Adaptoren zur Klassifizierung von Polynukleotidpopulationen und/oder zur Identifizierung von Nukleotiden an Polynukleotidenden, z. B. Unrau et. al., (oben zitiert) und US-Patent Nr. 5,508,169; Sibson, internationale Anmeldungen PCT/GB93/01452 und PCT/GB95/00109; Cantor, US-Patent Nr. 5,503,980 und Brenner, internationale Anmeldung PCT/US95/03678 und US-Patent Nr. 5,552,278. Solche Adaptoren haben typischerweise herausstehende Stränge, die die spezifische Hybridisierung und Ligation an Polynukleotiden mit komplementären Enden ermöglichen. Die Identifizierung oder Klassifizierung erfolgt mittels Durchführen solcher Reaktionen in separaten Gefäßen oder durch die Bereitstellung von Markierungen, die eines oder mehrere Nukleotide in dem herausstehenden Strang des ligierten Adaptors identifizieren.

In diesen Techniken entstehen spezielle Probleme bei der Handhabung von Polynukleotidenden oder Adaptoren, die zur Selbst-Ligation fähig sind, wie denen, die in 1 veranschaulicht sind, wobei die um vier Nukleotide herausstehenden Stränge der fixierten Polynukleotide komplementär zueinander sind. Bei der Selbst-Ligation sind herausstehende Stränge der Adaptoren oder der Ziel-Polynukleotide für die Analyse oder zur Prozessierung nicht länger verfügbar. Dies wiederum führt zum Verlust oder zum Verschwinden von Signalen, die als Antwort auf korrekte Ligationen der Adaptoren an Ziel-Polynukleotide erzeugt wurden. Das Problem der Selbst-Ligation ist besonders akut, wenn identische Ziel-Polynukleotide an einem Festphasenträger fixiert werden. In diesem Fall ist die lokale Konzentration der Enden, die zur Selbst-Ligation fähig sind, in bezug auf die der doppelsträngigen Adaptoren für gewöhnlich sehr hoch, was die Selbst-Ligation zu der bevorzugten Reaktion macht, wenn komplementäre Sequenzen vorliegen. Wie in 1 veranschaulicht, bilden komplementäre Sequenzen bei der Hybridisierung einen Palindromdoppelstrang. Da die Wahrscheinlichkeit für das Auftreten eines Palindrom-4-mers in einer willkürlichen Sequenz die gleiche ist wie die Wahrscheinlichkeit eines sich wiederholenden Paares von Nukleotiden (6,25 %), ist die Fehlererwartung bei Adaptorenbasierenden Verfahren zur de novo-Sequenzierung nach einigen Kreisläufen aufgrund der Selbst-Ligation hoch. Hierdurch wird die weitere Analyse des Polynukleotids unmöglich.

Im Hinblick auf die steigende Wichtigkeit Adaptoren-basierender Verfahren bei der Nukleinsäuresquenzanalyse ist die Verfügbarkeit von Verfahren und Materialien zur Überwindung des Problems der Selbst-Ligation überaus wünschenswert.

Backmann et. al., (US-Patent Nr. 5,516,663) beschreiben ein verbessertes Verfahren zur LCR (Ligasekettenreaktion), in dem Oligonukleotidsonden, die an nachbarständigen Orten an eine Matrize hybridisieren, etwas modifiziert werden müssen, z. B. Deblockierung an einem Ende, bevor sie ligiert werden können.

Gibbs et. al., (WO 93/105183) beschreiben ein Basenadditionssequenzierungschema, in dem nacheinander Nukleotide an einen kurzen Primer, hybridisiert an ein Ziel-Polynukleotid, addiert werden. Die Nukleotide sind mit einer Blockierungsgruppe zur weiteren Blockierung der Addition und für gewöhnlich mit einer Reportergruppe zur Detektion modifiziert. Beide Gruppen werden vor der Addition des nächsten Nukleotids entfernt.

Brenner (WO 95/27080) beschreibt ein Verfahren zur Bestimmung einer Nukleotidsequenz eines Polynukleotids, in dem eine Sonde mit einer Nuklease-Erkennungsstelle getrennt von ihrer Spaltstelle an die Sonde ligiert wird, und eines oder mehrere Nukleotide in dem Polynukleotid identifiziert werden, über eine Markierung an der Sonde; oder durch Verlängerung eines Strangs von dem Polynukleotid oder der Sonde mit einem markierten Kettenabbruch-Nukleosid. Die Nuklease, die die Sondennuklease-Erkennungsstelle erkennt, wird dann zur Verkürzung des Ziel-Polynukleotids verwendet, und die Sequenzierung wird fortgesetzt.

Zusammenfassung der Erfindung

Demgemäß ist ein Ziel unserer Erfindung die Bereitstellung eines Adaptorenbasierenden Analyseverfahrens, in dem weder die Adaptoren noch die Ziel-Polynukleotide selbstligieren.

Ein weiteres Ziel unserer Erfindung ist die Bereitstellung eines verbesserten Verfahrens zur DNA-Sequenzierung durch Ligation, worin identische Ziel-Polynukleotide, die an einem Festphasenträger fixiert sind, in Anwesenheit einer Ligase nicht selbst aneinander ligieren können.

Ein weiteres Ziel unserer Erfindung ist die Bereitstellung von Oligonukleotid-Adaptoren, die nicht aneinander ligieren können, die gleichzeitig jedoch an ein Ziel-Polynukleotid mit einem komplementären herausstehenden Strang ligiert werden können.

Ein weiteres Ziel unserer Erfindung ist die Bereitstellung von Zusammensetzungen, die einheitliche Populationen identischer Polynukleotide, durch ein Ende an einen Festphasenträger fixiert, umfassen, wobei es den Polynukleotiden, die an ihren freien Enden einen herausstehenden Strang aufweisen, an einer 5'-Phosphatgruppe fehlt.

Die Erfindung bewirkt diese und andere Ziele durch die Bereitstellung von Verfahren und Zusammensetzungen zur Analyse von Polynukleotiden mittels doppelsträngiger Adaptoren. Ein wesentlicher Aspekt der Erfindung ist die Entfernung des 5'-Phosphats von dem Ende des zu analysierenden Polynukleotids, so daß keine Selbst-Ligation stattfinden kann, insbesondere in Ausführungsformen, die die enzymatische Ligation nutzen. Ein weiterer wesentlicher Aspekt der Erfindung ist die Verwendung von doppelsträngigen Adaptoren, die jeweils einen herausstehenden Strang komplementär zu dem der zu analysierenden Polynukleotide und jeweils einen Strang mit einem blockierten 3'-Kohlenstoff aufweisen, so daß der Strang nicht ligiert werden kann. Vorzugsweise werden die doppelsträngigen Adaptoren der Erfindung durch die Formeln

definiert, wobei

N ein Nukleotid und N' sein Komplement ist, p eine Phosphatgruppe ist, z eine 3'-Blockierungsgruppe ist, n eine ganze Zahl zwischen 2 und einschließlich 6 ist, q eine ganze Zahl größer als oder gleich 8 ist und r eine ganze Zahl größer als oder gleich 8 ist, welche gleich oder verschieden von q sein kann.

Vorzugsweise ist z eine Phosphatgruppe und der doppelsträngige Teil der Adaptoren enthält eine Nuklease-Erkennungsstelle einer Nuklease, deren Erkennungsstelle von ihrer Spaltstelle getrennt ist. Wie nachstehend ausführlicher beschrieben, ist letzteres Element in Ausführungsformen nützlich, die Wiederholungszyklen von Ligation und Spaltung zur DNA-Sequenzierung einsetzen.

In einer bevorzugten Ausführungsform, veranschaulicht in 2a, stellt die Erfindung ein Verfahren zur Bestimmung der Identität von Nukleotiden am Ende eines Polynukleotids bereit. Das Verfahren umfaßt die folgenden Schritte:

  • (a) Ligieren eines doppelsträngigen Adaptors an ein Ende des Polynukleotids, wobei das Ende des Polynukleotids ein dephosphoryliertes 5'-Hydroxyl und der doppelsträngige Adaptor einen ersten Strang und einen zweiten Strang aufweist, wobei der zweite Strang des doppelsträngigen Adaptors eine 3'-Blockierungsgruppe aufweist;
  • (b) Entfernen der 3'-Blockierungsgruppe nach der Ligation des ersten Strangs;
  • (c) Phosphorylierung des 5'-Hydroxyls des Polynukleotids;
  • (d) Ligieren eines zweiten Strangs mit einer unblockierten 3'-Einheit, um den doppelsträngigen Adaptor zu regenerieren; und
  • (e) Identifizieren eines oder mehrerer Nukleotide am Ende des Polynukleotids durch die Identifizierung des daran ligierten Adaptors. Der Schritt der Entfernung der 3'-Blockierungsgruppe kann auf verschiedene Arten durchgeführt werden, einschließlich physikalischer Entfernung, z. B. durch Waschen des gesamten 3'-blockierten zweiten Stranges, gefolgt vom Austausch mit einem unblockierten Strang, durch chemische oder enzymatische Entfernung der 3'-Blockierungsgruppe oder durch anderweitige Aktivierung oder Regenerierung eines 3'-Hydroxyls am zweiten Strang ohne Entfernung des zweiten Strangs. Ein 3'-Phosphat ist die bevorzugte 3'-Blockierungsgruppe und der Schritt des Entfernens wird vorzugsweise durch Behandlung des zweiten Strangs mit einer Phosphatase durchgeführt, um das 3'-Phosphat zu entfernen und ein freies 3'-Hydroxyl zu regenerieren.

Ferner umfaßt der doppelsträngige Adaptor bevorzugt eine Erkennungsstelle einer Nuklease, deren Erkennungsstelle von ihrer Spaltstelle getrennt ist. So können Wiederholungszyklen von Ligation und Spaltung zur Identifizierung zusätzlicher Nukleotide des Ziel-Polynukleotids durchgeführt werden. Dementsprechend umfaßt das Verfahren der Erfindung vorzugsweise die weiteren Schritte

  • (f) Spaltung des Polynukleotids mit einer Nuklease, die die Nuklease-Erkennungsstelle des doppelsträngigen Adaptors erkennt, so daß das Polynukleotid um eines oder mehrere Nukleotide verkürzt wird,
  • (g) Behandeln des gespaltenen Polynukleotids, um die 5'-terminate Phosphatgruppe zu entfernen, wenn der Spaltschritt zur Bildung einer solchen 5'-terminalen Phosphatgruppe führt, und
  • (h) Wiederholung der Schritte (a) bis (g), bis die Nukleotidsequenz des Polynukleotids bestimmt ist.

In einer anderen wichtigen Ausführungsform stellt die Erfindung ein Verfahren zur Klassifizierung von Polynukleotiden einer Population durch die Verwendung von doppelsträngigen Adaptoren bereit. Grundsätzlich werden Polynukleotide in diesem Aspekt der Erfindung durch

  • (a) Behandeln der Polynukleotide des Gemisches mit einer Endonuklease, um Polynukleotide mit herausstehenden Strängen zu produzieren;
  • (b) Ligieren eines doppelsträngigen Adaptors an ein Polynukleotid in dem Gemisch, wobei das Polynukleotid einen zu dem des doppelsträngigen Adaptors komplementären herausstehenden Strang aufweist, wobei das Ende des Polynukleotids ein dephosphoryliertes 5'-Hydroxyl aufweist, und der doppelsträngige Adaptor einen ersten Strang und einen zweiten Strang aufweist, wobei der zweite Strang des doppelsträngigen Adaptors eine 3'-Blockierungsgruppe aufweist,
  • (c) Entfernen der 3'-Blockierungsgruppe nach der Ligation des ersten Stranges,
  • (d) Phosphorylierung des 5'-Hydroxyls des Polynukleotids,
  • (e) Ligieren eines zweiten Stranges mit einer unblockierten 3'-Einheit, um den doppelsträngigen Adaptor zu regenerieren; und
  • (f) Klassifizierung des Polynukleotids durch die Identität des daran ligierten Adaptors.

Die vorliegende Erfindung überwindet Schlüsselprobleme in Adaptor-basierenden Verfahren zur Analysierung oder Sequenzierung von DNA: genauer gesagt die Probleme der Selbst-Ligation von Ziel-Polynukleotiden und Adaptoren. Ohne Selbst-Ligation sind Adaptor-basierende Verfahren signifikant effizienter und zuverlässiger, was wiederum ihre kommerzielle Anwendbarkeit stark verbessert.

Kurze Beschreibung der Zeichnungen

1 veranschaulicht das Phänomen der Selbst-Ligation identischer Polynukleotide, die an einem Festphasenträger fixiert sind.

2a veranschaulicht Schritte in einem bevorzugten Verfahren der Erfindung, in dem ein doppelsträngiger Adaptor mit einem blockierten 3'-Kohlenstoff an ein Ziel-Polynukleotid ligiert wird.

2b veranschaulicht die Verwendung der bevorzugten Ausführungsform in einem Verfahren zur DNA-Sequenzierung durch aufeinanderfolgende Zyklen von Ligation und Spaltung.

Die 3a3e veranschaulichen eine Ausführungsform der Erfindung zur DNA-Sequenzierung, bei der Ligations- und Spaltungszyklen nicht erforderlich sind.

Definitionen

Wie hierin verwendet ist unter dem Ausdruck „Ligation" die Bildung einer kovalenten Bindung zwischen den Enden eines oder mehrerer (normalerweise zweier) Oligonukleotide zu verstehen. Der Ausdruck bezieht sich normalerweise auf die Bildung einer Phosphodiesterbindung, die aus der folgenden Reaktion resultiert, die normalerweise durch eine Ligase katalysiert wird: oligo1(5')-OP(O-)(=O)O + HO-(3')oligo2-5' → oligo1(5')-OP(O-)(=O)O-(3')oligo2-5', wobei oligo1 und oligo2 jeweils zwei verschiedene Oligonukleotide oder verschiedene Enden desselben Oligonukleotids sind. Der Ausdruck umfaßt die nicht-enzymatische Bildung von Phosphodiesterbindungen sowie die Bildung kovalenter Nicht-Phosphodiesterbindungen zwischen den Enden der Oligonukleotide, wie Phosphorthioatbindungen, Disulfidbindungen und dergleichen.

Wie hierin verwendet umfaßt „Sequenzbestimmung" oder „Bestimmung einer Nukleotidsequenz" in Bezug auf Polynukleotide, die Bestimmung von Teilen sowie vollständiger Sequenzinformationen des Polynukleotids. Das heißt, der Ausdruck umfaßt Sequenzvergleiche, Fingerprinting und ähnliche Informationsniveaus über ein Ziel-Polynukleotid, sowie die Express-Identifikation und Anordnung der Nukleoside, gewöhnlich jedes Nukleosids, in einem Ziel-Polynukleotid. Der Ausdruck umfaßt ebenso die Bestimmung der Identifizierung, Ausrichtung und Lokationen von einem, zwei oder drei der vier Typen der Nukleotide in einem Ziel-Polynukleotid. Zum Bespiel kann die Sequenzidentifizierung in einigen Ausführungsformen durch die Identifizierung der Anordnung und der Lokationen einer einzelnen Nukleotidart, z. B. Cytosinen, in einem Ziel-Polynukleotid herbeigeführt werden, so daß seine Sequenz als ein Binärcode, z. B. „100101 ...„ für „C-(nicht C)-(nicht C)-C-(nicht C)-C ...„ und dergleichen dargestellt wird.

„Perfekt gepaarte Doppelstränge" bedeutet in bezug auf die herausstehenden Stränge von Sonden und Ziel-Polynukleotiden, daß der herausstehende Strang aus einem eine doppelsträngige Struktur mit dem anderen bildet, so daß jedes Nukleotid in der doppelsträngigen Struktur der Watson-Crick-Basenpaarung mit einem Nukleotid an dem gegenüberliegenden Strang unterliegt. Der Ausdruck umfaßt ebenso die Paarung von Nukleosidanaloga, wie Deoxyinosin, Nukleoside mit 2-Aminopurinbasen und dergleichen, die zur Reduzierung der Komplexität der Adaptoren eingesetzt werden.

Der Ausdruck „Oligonukleotid", wie hierin verwendet, umfaßt lineare Oligomere von Nukleosiden oder deren Analoga, einschließlich Desoxyribonukleoside, Ribonukleoside und dergleichen. Für gewöhnlich haben Oligonukleotide Größen im Bereich von einigen Monomereinheiten, z. B. 3–4, bis mehreren Hundert Monomereinheiten. Immer wenn ein Oligonukleotid durch eine Buchstabenfolge dargestellt wird, wie „ATGCCTG", ist darunter zu verstehen, daß sich die Nukleotide in 5' → 3'-Anordnung von links nach rechts befinden und daß „A" Desoxyadenosin kennzeichnet, „C" Desoxycytidin kennzeichnet, „G" Desoxyguanosin kennzeichnet und „T" Thymidin kennzeichnet, sofern nicht etwas anderes angegeben ist.

Wie hierin verwendet, umfaßt „Nukleosid" die natürlichen Nukleoside, einschließlich 2'-Desoxy- und 2'-Hydroxyl-Formen, wie beispielsweise in Kornberg and Baker, DNA Replication, 2. Aufl. (Freeman, San Francisco, 1992) beschrieben. „Analoga" umfassen in Bezug auf Nukleoside synthetische Nukleoside mit modifizierten Basenkomponenten und/oder modifizierten Zuckerkomponenten, wie allgemein beispielsweise von Scheit, Nukleotid Analogs (John Wiley, New York, 1980) beschrieben. Solche Analoga umfassen synthetische Nukleoside, die die Bindungseigenschaften verbessern, die Degeneration reduzieren, die Spezifität verstärken sollen und dergleichen.

Ausführliche Beschreibung der Erfindung

Die Verfahren und Zusammensetzungen der Erfindung finden in vielen Nukleinsäure-Analysetechniken, die doppelsträngige Oligonukleotidadaptoren nutzen, die an zu analysierende Polynukleotide ligiert werden, bevorzugt Indexierungsschemata (Unrau et. al., (oben zitiert) und Sibson (oben zitiert)), und DNA-Sequenzierungsschemata (Cantor (oben zitiert), Brenner (oben zitiert) und Sibson (oben zitiert)) Anwendung.

Wie in 1 veranschaulicht, war ein wesentliches Merkmal der Erfindung die Entdeckung, daß Adaptor-basierende Analyseverfahren komplett ausfallen können, wenn „selbst-komplementäre" Sequenzen (114) in freien herausstehenden Strängen vorhanden sind. Dieses Problem ist insbesondere in Ausführungsformen groß, in denen sich die zu analysierenden Polynukleotide (112) den Adaptoren als einheitliche Populationen identischer Polynukleotide, gebunden an einem Festphasenträger (110), darstellen. In diesem Fall können sich die freien Enden der gebundenen Polynukleotide zur Bildung perfekt gepaarter Doppelstränge (116) mit einander verdrehen. Wenn die 5'-Stränge der Enden phosphorylisiert sind, werden die Polynukleotide in Anwesenheit einer Ligase ohne weiteres ligiert. Ein ähnliches Problem existiert ebenso bei doppelsträngigen Adaptoren. Genauer gesagt, wenn deren 5'-Stränge phosphorylisiert sind, kann der 5'-Strang eines Adaptors an das freie 3'-Hydroxyl eines anderen Adaptors ligiert werden, wenn die Nukleotidsequenzen ihrer herausstehenden Stränge komplementär sind.

Im allgemeinen richten sich die Verfahren der Erfindung gegen die obigen Probleme durch folgende Schritte, welche in 2a für eine bevorzugte Ausführungsform veranschaulicht sind:

  • (a) Ligieren (120) eines doppelsträngigen Adaptors an ein Ende des Polynukleotids (122), wobei das Ende des Polynukleotids ein dephosphoryliertes 5'-Hydroxyl aufweist und das Ende des zu ligierenden doppelsträngigen Adaptors (124) einen ersten Strang (126) und einen zweiten Strang (128) aufweist, wobei der zweite Strang des doppelsträngigen Adaptors eine 3'-Blockierungsgruppe (130) aufweist;
  • (b) Entfernen der 3'-Blockierungsgruppe des zweiten Stranges nach Ligation, z. B. durch Auswaschen (132), oder durch enzymatisches oder chemisches Entfernen der Gruppe in situ, z. B. durch Behandeln mit einer Phosphatase, wenn die Blockierungsgruppe ein Phosphat ist;
  • (c) Phosphorylierung (134) des 5'-Hydroxyls des Polynukleotids;
  • (d) Ligieren (136) eines zweiten Stranges (142) mit einer unblockierten 3'-Einheit, um den doppelsträngigen Adaptor (138) zu regenerieren; und
  • (e) Identifizieren (144) eines oder mehrerer Nukleotide am Ende des Polynukleotids durch die Identität des daran ligierten Adaptors, z. B. mittels einer fluoreszierenden Markierung (140), eines kodierten Adaptors (nachstehend beschrieben), Amplifikation (durch Bereitstellung einer Primerbindungsstelle) oder dergleichen. Die doppelsträngigen Adaptoren und Ziel-Polynukleotide können zur Ligation einzeln oder als Gemische vereinigt werden. Beispielsweise kann ein einzelner Adaptor mit einer definierten Sequenz mit einem einzelnen Polynukleotid mit einer gemeinsamen (und möglicherweise unbekannten) Nukleotidsequenz vereinigt werden; oder ein einzelner Adaptor mit einer definierten Sequenz kann mit einem Gemisch aus Polynukleotiden, wie mehreren einheitlichen Populationen identischer Polynukleotide, gebunden an unterschiedlichen Festphasenträgern in dem selben Reaktionsgefäß vereinigt werden, wie beispielsweise von Brenner et. al., Internationale Anmeldung PCT/US96/09513; oder ein Gemisch aus doppelsträngigen Adaptoren, bevorzugt Gemische mit verschiedenen Nukleotidsequenzen in deren herausstehenden Strängen, können mit einem einzelnen Polynukleotid vereinigt werden; oder ein Gemisch aus doppelsträngigen Adaptoren kann mit einem Gemisch aus Polynukleotiden vereinigt werden. Die Verwendung des Ausdrucks „Adaptor" oder „doppelsträngiger Adaptor" im Singular bedeutet, daß dies Gemische aus Adaptoren mit verschiedenen Sequenzen herausstehender Stränge sowie eines einzelnen Adaptors mit der gleichen Sequenz des herausstehenden Stranges, ähnlich wie bei der Verwendung des Ausdrucks „Sonde", einschließt.

Eine bevorzugte Ausführungsform, die Ligations- und Spaltungszyklen nutzt, umfaßt die folgenden Schritte:

  • (a) Ligieren (220) eines doppelsträngigen Adaptors an ein Ende des Polynukleotids (222), wobei das Ende des Polynukleotids ein dephosphoryliertes 5'-Hydroxyl umfaßt, das Ende des zu ligierenden doppelsträngigen Adaptors (224) einen ersten Strang (226) und einen zweiten Strang (228) aufweist, wobei der zweite Strang des doppelsträngigen Adaptors eine 3'-Blockierungsgruppe (230) aufweist, und der doppelsträngige Adaptor eine Nuklease-Erkennungsstelle (250) einer Nuklease, deren Erkennungsstelle von ihrer Spaltstelle getrennt ist, aufweist;
  • (b) Entfernen der 3'-Blockierungsgruppe nach der Ligation, z. B. durch Waschen des zweiten Stranges (232);
  • (c) Phosphorylierung (234) des 5'-Hydroxyls des Polynukleotids;
  • (d) Ligieren (236) eines zweiten Stranges (242) mit einer unblockierten 3'-Einheit, um den doppelsträngigen Adaptor (238) und die Nuklease-Erkennungsstelle (250) zu regenerieren;
  • (e) Identifizieren (244) eines oder mehrerer Nukleotide am Ende des Polynukleotids durch die Identität des daran ligierten Adaptors;
  • (f) Spalten (252) des Polynukleotids mit einer Nuklease, die die Erkennungsstelle erkennt, so daß das Polynukleotid um eines oder mehrere Nukleotide verkürzt wird, wobei die Erkennungsstelle in dem veranschaulichten Adaptor (224) so angeordnet ist, daß die Spaltung (254) zwei Nukleotide aus dem Polynukleotid (222) entfernt;
  • (g) Dephosphorylieren (256) des 5'-Endes des Polynukleotids; und
  • (h) Wiederholen (258) der Schritte (a) bis (g).

Typischerweise werden vor der Ligation die zu analysierenden Enden der Polynukleotide präpariert, indem sie mit einer oder mehreren Restriktionsendonukleasen digeriert werden, die vorbestimmte Spaltungen erzeugen, für gewöhnlich mit 3' oder 5' herausstehenden Strängen, d. h. „kohäsive" Enden. Solche Digestionen hinterlassen für gewöhnlich phosphorylierte 5' Stränge. Vorzugsweise werden diese 5' phosphorylierten Enden durch Behandlung mit einer Phosphatase, wie Kalb-Intestinal-alkalische Phosphatase, oder einem ähnlichen Enzym, mittels Standardprotokollen, dephosphoryliert, wie beispielsweise in Sambrook et al, Molecular Cloning, 2. Aufl. (Cold Spring Harbor Laboratory, New York, 1989) beschrieben. Durch die Entfernung des 5'-Phosphats können die Ziel-Polynukleotide in Anwesenheit einer Ligase nicht ligiert werden. Der Schritt der Dephosphorylierung führt vorzugsweise zu einem freien 5'-Hydroxyl.

Die Ligation des doppelsträngigen Adaptors an das dephosphorylierte Ende eines Polynukleotids kann enzymatisch oder chemisch durchgeführt werden, was von der jeweiligen Ausführungsform abhängt. Vorzugsweise wird die Ligation enzymatisch unter Verwendung einer Ligase in einem Standardprotokoll durchgeführt. Es sind viele Ligasen bekannt und zur Verwendung in der Erfindung geeignet, z. B. Lehman, Science, 186: 790–797 (1974); Engler et. al., DNA Ligases, Seiten 3–30 in Boyer, Hrsg., The Enzymes, Bd. 15B (Academic Press. New York, 1982); und dergleichen. Bevorzugte Ligasen umfassen T4-DNA-Ligase, T7-DNA-Ligase, E. coli-DNA-Ligase, Taq-Ligase, Pfu-Ligase und Tth-Ligase. Protokolle für deren Verwendung sind allgemein bekannt, z. B. Sambrook et. al., (oben zitiert); Barany, PCR Methods and Applications, 1: 5–16 (1991); Marsh et. al., Strategies, 5: 73–76 (1992); und dergleichen. Im allgemeinen erfordern Ligasen die Anwesenheit einer 5'-Phosphatgruppe zur Ligation an das 3'-Hydroxyl eines angrenzenden Strangs. Somit muß der 5'-Strang des komplementären Endes des doppelsträngigen Adaptors phosphoryliert sein, wenn eine Ligase zur Ligation des doppelsträngigen Adaptors an ein Ziel-Polynukleotid eingesetzt wird.

Im allgemeinen liefern die doppelsträngigen Adaptoren der Erfindung die gleichen Funktionen wie die in Unrau et. al. (oben zitiert), Sibson (oben zitiert) und Brenner (oben zitiert) beschriebenen Adaptoren, von denen insbesondere der letztere wegen seiner Beschreibung von Adaptoren (oder wie in den Referenzen bezeichnet, "Sonden") und seiner Beschreibung ihrer Funktionsweise bei der DNA-Sequenzierung durch aufeinanderfolgende Ligation und Spaltung relevant ist. Adaptoren liefern eine „Plattform" zur Durchführung einer oder beider Operationen: Zunächst durch spezifische Hybridisierung seines (ihrer) komplementären herausstehenden Strangs (Stränge) an den (die) eines Ziel-Polynukleotids, ein Adaptor (oder manchmal ein Paar von Adaptoren) liefert ein Mittel zum Identifizieren eines oder mehrerer Nukleotide in dem herausstehenden Strang des Ziel-Polynukleotids oder ein Mittel zur Klassifizierung von Unterpopulationen der Ziel-Polynukleotide, z. B. durch die Bereitstellung von Primerbindungsstellen zur selektiven Amplifikation, wie in Unrau et. al. (oben zitiert) beschrieben. Zweitens liefert ein Adaptor eine Erkennungsstelle, von der eine Nuklease das Ziel-Polynukleotid, an das ein Adaptor ligiert wird, abspalten kann. Wie in Brenner (oben zitiert) veranschaulicht, liefern Adaptoren nicht notwendigerweise in jeder Ausführungsform beide Funktionen.

In Bezug auf die oben angegebene Formel für die doppelsträngigen Adaptoren liegt n vorzugsweise im Bereich von 2 bis einschließlich 6, r und q liegen separat im Bereich von 8 bis einschließlich 50. Die 3'-Blockierungsgruppe „z" kann verschiedenen Formen annehmen und kann fast jedes chemische Gebilde, das die Ligation ausschließt und das nicht mit anderen Verfahrensschritten, z. B. der Entfernung des 3'-blockierten Stranges, der Ligation oder dergleichen interferiert, umfassen. Beispielsweise umfassen 3'-Blockierungsgruppen Wasserstoff (d. h. 3'-Desoxy), Phosphat, Phosphorthioat, Acetyl und dergleichen, sind aber nicht darauf beschränkt. Vorzugsweise ist die 3'-Blockierungsgruppe aufgrund der bequemen Zugabe der Gruppe während der Synthese des 3'-blockierten Stranges und der bequemen Entfernung der Gruppe mit einer Phosphatase, damit der Strang mit einer Ligase ligiert werden kann, ein Phosphat. Ein Oligonukleotid mit einem 3'-Phosphat kann unter Verwendung des in Kapitel 12 von Eckstein, Hrsg., Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991) beschriebenen Protokolls synthetisiert werden.

Neben der Entfernung durch Schmelzen kann ein 3'-Desoxy aus einem zweiten Strang durch eine Polymerase-„Austausch"-Reaktion, offenbart in Kuijper et. al., Gene, 112: 147–155 (1992); Aslanidis et. al., Nucleic Acids Research. 18: 6069–6074 (1990) und ähnlichen Referenzen, entfernt werden. Kurz gesagt, kann die 5' → 3' Exonukleaseaktivität von T4-DNA-Polymerase und ähnlichen Enzymen zum Austausch von Nukleotiden in einem Starterstrang gegen ihre Triphosphatgegenstücke in Lösung verwendet werden. Durch eine solche Reaktion kann ein 3'-Didesoxynukleotid gegen ein 2'-Desoxy-3'-hydroxynukleotid aus einem Reaktionsgemisch ausgetauscht werden, wodurch der zweite Strang nach Behandlung mit einer Polynukleotidkinase an ein Ziel-Polynukleotid ligiert werden kann.

Weitere 3'-Blockierungsgruppen sind aus den Chemien erhältlich, die für umkehrbare Kettenabbruchnukleotide in Base-um-Base-Sequenzierungsschemata entwickelt wurden, wie beispielsweise in den folgenden Referenzen offenbart: Cheeseman, US-Patent Nr. 5,302,509: Tsien et. al., Internationale Anmeldung WO 91/06678: Canard et. al., Gene, 148: 1–6 (1994) und Metzker et. al., Nucleic Acids Research, 22: 4259–4267 (1994). Grob gesagt, ermöglichen diese Chemien die chemische oder enzymatische Entfernung spezifischer Blockierungsgruppen (für gewöhnlich mit einer anhängenden Markierung) um ein freies Hydroxyl am 3'-Ende eines Starterstrangs zu erzeugen.

Die komplementären Stränge der Adaptoren werden günstigerweise auf einem automatischen DNA-Synthetisierer, z. B. einem DNA/RNA-Synthesizer, Modell 392 oder 394, von Applied Biosystems, Inc. (Foster City, CA), unter Verwendung von Standardchemien, wie der Phosphoramiditchemie, synthetisiert, wie beispielsweise in den folgenden Referenzen offenbart: Beaucage und lyer, Tetrahedron, 48: 2223–2311 (1992); Molko et. al., US-Patent Nr. 4,980,460; Koster et. al., US-Patent Nr. 4,725,677; Caruthers et. al., US-Patent Nr. 4,415,732; 4,458,066 und 4,973,679 und dergleichen. Alternative Chemien, die beispielsweise zu nicht-natürlichen Hauptkettengruppen führen, wie Phosphorthioat, Phosphoramidat und dergleichen, können auch eingesetzt werden, vorausgesetzt, daß die resultierenden Oligonukleotide mit den Ligations- und Spaltungreagenzien kompatibel sind. Nach der Synthese werden die komplementären Stränge zur Bildung eines doppelsträngigen Adaptors vereinigt. Der herausstehende Strang eines Adaptors kann als ein Gemisch synthetisiert werden, so daß jede mögliche Sequenz in dem herausstehenden Teil dargestellt wird, wie in Brenner (oben zitiert) beschrieben.

Wie ebenso in Brenner (oben zitiert) erläutert, ist die Tatsache, ob der herausstehende Strang des Adaptors ein 5'- oder 3'-Ende ist, nicht kritisch. Es ist jedoch wichtig, daß die herausstehenden Stränge der Ziel-Polynukleotide und Adaptoren (oder mindestens einer aus einem Gemisch, das auf das Ziel-Polynukleotid angewendet wurde) perfekt gepaarte Doppelstränge bilden können, um so eine spezifische Hybridisierung und Ligation zu ermöglichen. Wenn die herausstehenden Stränge des Ziel-Polynukleotids und des Adaptors unterschiedliche Längen haben, kann der resultierende Spalt vor der Ligation mittels einer Polymerase gefüllt werden, wie beispielsweise in „gap LCR", offenbart in Backmann et. al., Europäische Patentanmeldung 91100959.5. Das Füllen eines solchen Spalts kann als ein Mittel zur Identifizierung eines oder mehrerer Nukleotide in dem herausstehenden Strang des Ziel-Polynukleotids genutzt werden. Vorzugsweise ist die Anzahl der Nukleotide in den jeweiligen herausstehenden Strängen die gleiche, so daß beide Stränge des Adaptors und des Ziel-Polynukleotids ohne einen Füllschritt ligiert werden können. Vorzugsweise ist der herausstehende Strang des Adaptors 2 bis 6 Nukleotide lang.

Wie oben erwähnt, wird ein bevorzugter doppelsträngiger Adaptor durch die Formel:

definiert, wobei bevorzugte Werte für p, N, N', n, q und r wie oben definiert sind. Stärker bevorzugt liegt n im Bereich von 2 bis 5; und q und r liegen im Bereich von 12 bis 50, und können gleich oder verschieden sein. Am stärksten bevorzugt ist n 4. Ein 5'-Monophosphat kann entweder chemisch oder enzymatisch mit einer Kinase befestigt werden, z. B. Sambrook et. al., Molecular Cloning: A Laboratory Manual, 2. Aufl. (Cold Spring Harbor Laboratory, New York, 1989). Die chemische Phosphorylierung wird von Horn und Urdea, Tetrahedron Lett., 27: 4705 (1986) beschrieben, und Reagenzien zur Durchführung der offenbarten Protokolle sind kommerziell erhältlich, z. B. 5'-Phosphat-ONTM von Clontech Laboratories (Palo Alto, CA).

Die Adaptoren der Erfindung können auf verschiedene Arten markiert werden, einschließlich durch direkte oder indirekte Befestigung radioaktiver Einheiten, fluoreszierender Einheiten, kolorimetrischer Einheiten und dergleichen, wie in Brenner (oben zitiert) offenbart, das bezogen auf die Beschreibung von Markierungsmodalitäten für Adaptoren durch Referenz einbezogen ist. Die Adaptoren werden bevorzugt mit einem oder mehreren fluoreszierenden Farbstoffen markiert, wie beispielsweise von Menchen et. al., US-Patent Nr. 5,188,934; Begot et. al., PCT-Anmeldung PCT/US90/05565, offenbart. Farbstoffpaare, die die Fluoreszenz-Energieübertragung nutzen, können bei jedem Adaptor eingesetzt werden, wie von Ju et. al., Proc. Natl. Acad. Sci., 92: 4347–4351 (1995) und Ju et. al., Nature Medicine, 2: 246–249 (1996) gelehrt.

In einigen Ausführungsformen können nach Bedarf eine oder zwei signalerzeugende Einheiten, wie ein oder zwei Arten fluoreszierender Farbstoffe, in einem Sequenzierungsvorgang verwendet werden. Unter solchen Bedingungen kann eine Sequenz durch die Gegenwart oder Abwesenheit eines bestimmten Nukleotids an aufeinanderfolgenden Stellen entlang eines Polynukleotids charakterisiert werden. Zum Bespiel kann die Sequenz „acggttaat" hinsichtlich der Gegenwart und Abwesenheit von t beschrieben werden, ausgedrückt als: „(nicht t)-(nicht t)-(nicht t)-(nicht t)-tt-(nicht t)-(nicht t)-t". Oder eine solche Sequenz kann hinsichtlich der Gegenwart und Abwesenheit von Purinen beschrieben werden, ausgedrückt als: „Purin-(nicht Purin)-Purin-Purin-(nicht Purin)-(nicht Purin)-Purin-Purin-(nicht Purin)". Vorzugsweise werden in solchen Ausführungsformen zwei Farbstoffe eingesetzt, so daß ein positives Signal gemessen wird, selbst wenn die Abwesenheit eines bestimmten Nukleotids oder einer bestimmten Base aufgezeigt werden soll. Solche binären Sequenzen können zur einmaligen Identifizierung von Polynukleotiden aus einer Population, wie einer cDNA-Bibliothek, verwendet werden, vorrausgesetzt, die Sequenz ist lang genug.

Es kann eine einzelne signalerzeugende Einheit, wie ein einzelner fluoreszierender Farbstoff, in einem parallelen Sequenzierungsvorgang eingesetzt werden, wenn mehrere unterschiedliche Ziel-Polynukleotide, gebunden an unterschiedliche räumlich addressierbare Festphasenträger, sequenziert werden, wie in der Internationalen Patentanmeldung PCT/US95/12791 beschrieben. Dies kann durch die Bereitstellung von vier Adaptorengruppen, die nacheinander auf mehrere Ziel-Polynukleotide angewandt werden, erreicht werden. Exemplarische Gruppen solcher Adaptoren werden nachstehend gezeigt:

worin jeder der aufgeführten Adaptoren ein Gemisch aus 43 = 64 Oligonukleotiden darstellt, so daß die Identität des 3'-terminalen Nukleotids des oberen Stranges feststeht und die anderen Positionen in dem herausstehenden Strang durch jede Permoation einer Sequenz von drei Nukleotiden, oder die Komplexität reduzierende Analoga gefüllt sind. Die aufgeführten Adaptoren werden ebenso mit einem einsträngigen poly-T-Schwanz mit einer signalerzeugenden Einheit, die an das terminale Thymidin, gezeigt als „T*", gebunden ist, gezeigt. Das „d" an den nicht markierten Adaptoren kennzeichnet eine Ligationsblockiereinheit oder die Abwesenheit von 3'-Hydroxyl, wodurch nicht markierte Adaptoren nicht ligiert werden. Vorzugsweise sind solche 3'-terminalen Nukleotide Didesoxynukleotide. In dieser Ausführungsform werden die Adaptoren der Gruppe 1 zuerst auf die vielen Ziel-Polynukleotide angewandt und mit einer Ligase behandelt, so daß Ziel-Polynukleotide mit einem Thymidin, komplementär zu dem 3'-terminalen Adenosin der markierten Adaptoren, ligiert werden. Die nicht markierten Adaptoren werden gleichzeitig angewendet, um ungeeignete Ligationen zu minimieren. Die Lokationen der Ziel-Polynukleotide, die ligierte Komplexe mit Adaptoren bilden, die mit „A" enden, werden durch das von der Markierung auf dem Adaptor erzeugte Signal identifiziert. Nach dem Waschen und Spalten werden die Adaptoren aus der Gruppe 2 angewandt. In diesem Fall werden die Ziel-Polynukleotide, die ligierte Komplexe mit Adaptoren bilden, die auf „C" enden, anhand der Lokation identifiziert. Dem ähnlich werden die Adaptoren aus den Gruppen 3 und 4 angewandt und die Lokationen positiver Signale identifiziert. Das Verfahren der aufeinanderfolgenden Anwendung der vier Adaptorengruppen geht weiter, bis die gewünschte Anzahl von Nukleotiden auf den Ziel-Polynukleotiden identifiziert ist.

In einer anderen Ausführungsform können zwei Markierungen, beispielsweise fluoreszierende Farbstoffe, zur alternativen Identifizierung von Purinen und Pyrimidinen in einem parallelen DNA-Sequenzierungsschema eingesetzt werden, wie in der Internationalen Patentanmeldung PCT/US95/12791 beschrieben. Zwei Gruppen von Adaptoren werden mit Erkennungsstellen für unterschiedliche Typ-IIs-Nukleasen, d. h. eine erste Nuklease und eine zweite Nuklease, ausgestattet. Die Nukleasen werden so ausgewählt, daß sie identische Arten von Überhängen nach der Spaltung hinterlassen. Die Adaptoren jeder Gruppe werden entweder mit einer ersten Markierung oder einer zweiten Markierung markiert, was davon abhängig ist, ob sie in Anwesenheit von A bzw. G für die erste Gruppe oder in Anwesenheit von C bzw. T für die zweite Gruppe zu einer erfolgreichen Ligation führen sollen. Die Adaptoren der beiden Gruppen werden bei einer Sammlung immobilisierter Ziel-Polynukleotide mit einem geeigneten herausstehenden Strang angewandt und gemäß der Erfindung ligiert. Die Positionen und Merkmale, z. B. Farben, der durch die Markierungen erzeugten Signale werden aufgezeichnet. Als nächstes werden die ligierten Adaptoren mit der ersten Nuklease gespalten und gewaschen. Die Stellen, an denen die Signale verschwinden, entsprechen den Stellen, an denen A's und G's in dem Ziel-Polynukleotid vorkommen, und die Stellen, an denen Signale verbleiben, entsprechen den Stellen mit C's und T's in dem Ziel-Polynukleotid. Die Adaptoren werden dann mit der zweiten Nuklease gespalten, um den Zyklus der Ligation und Nukleasespaltung zu vervollständigen.

Oligonukleotidmarkierungen und kodierte Adaptoren

Unter Verwendung kodierter Adaptoren kann ein Ziel-Polynukleotid basierend auf einer einzelnen Ligation einer oder mehrerer Gruppen kodierter Adaptoren an seinem Ende (oder an den Enden mehrerer Ziel-Polynukleotide, wenn sie in einem parallelen Sequenzierungsvorgang verwendet werden) analysiert werden. Das heißt, Ligations- und Spaltungszyklen können verwendet werden, sind aber nicht erforderlich. Wie hierin verwendet ist unter dem Ausdruck „kodierter Adaptor" ein doppelsträngiger Adaptor, wie oben beschrieben, welcher eine Oligonukleotidmarkierung, ausgewählt aus einem minimal kreuz-hybridisierenden Satz von Oligonukleotiden, umfaßt. Kodierte Adaptoren, deren herausstehende Stränge perfekt gepaarte Doppelstränge mit den komplementären herausstehenden Strängen des Ziel-Polynukleotids bilden, werden gemäß der Erfindung ligiert. Nach der Ligation wird die Identität und Anordnung der Nukleotide in den herausstehenden Strängen durch die spezifische Hybridisierung eines markierten Markierungskomplements an die entsprechende Markierung an dem ligierten Adaptor bestimmt oder „dekodiert".

Wenn beispielsweise ein kodierter Adaptor mit einem herausstehenden Strang von vier Nukleotiden, sagen wir 5'-AGGT, einen perfekt gepaarten Doppelstrang mit dem komplementären herausstehenden Strang eines Ziel-Polynukleotids bildet und ligiert wird, werden die vier komplementären Nukleotide, 3'-TCCA, an dem Polynukleotid durch eine einzigartige Oligonukleotid-Markierung, ausgewählt aus einem Satz von 256 solcher Markierungen, eine für jede mögliche der vier Nukleotidsequenzen der herausstehenden Stränge, identifiziert. Markierungskomplements werden bei ligierten Adaptoren unter Bedingungen angewandt, die eine spezifische Hybridisierung nur der Markierungskomplements, die perfekt gepaarte Doppelstränge (oder Triplexe) mit den Oligonukleotid-Markierungen der ligierten Adaptoren bilden, ermöglichen. Die Markierungskomplements können einzeln oder als eines oder mehrere Gemische angewendet werden, um die Identität der Oligonukleotid-Markierungen und so die Sequenz der herausstehenden Stränge zu bestimmen. Wie nachstehend ausführlicher erläutert, werden bevorzugt aufeinanderfolgende Sätze kodierter Adaptoren bei den Ziel-Polynukleotiden angewendet, so daß jeder Satz die Nukleotidsequenz eines anderen Teils des Ziel-Polynukleotids identifizieren kann.

Ein wesentliches Merkmal der kodierten Adaptoren ist die Verwendung von Oligonukleotid-Markierungen, die Mitglieder eines minimal kreuz-hybridisierenden Satzes von Oligonukleotiden sind, wie beispielsweise in der Internationalen Patentanmeldung PCT/US96/09513 und in US-Patent Nr. 5,604,097 beschrieben, von denen letzteres wegen der Beschreibung von Oligonukleotid-Markierungen relevant ist. Die Oligonukleotidensequenzen eines solchen Satzes unterscheiden sich von den Sequenzen jedes anderen Mitglieds desselben Satzes durch mindestens zwei Nukleotide. Daher kann nicht jedes Mitglied eines solchen Satzes einen Doppelstrang (oder Triplex) mit dem Komplement eines anderen Mitglieds mit weniger als zwei fehlenden Übereinstimmungen bilden. Vorzugsweise unterscheidet sich jedes Mitglied eines minimal kreuz-hybridisierenden Satzes von jedem anderen Mitglied in Übereinstimmung mit der Größe des Satzes, die für eine bestimmte Anwendung erforderlich ist, durch so viele Nukleotide wie möglich. Werden beispielsweise längere Oligonukleotid-Markierungen, wie 12- bis 20-mere, zur Abgabe von Markierungen an kodierte Adaptoren verwendet, ist die Differenz zwischen den Mitgliedern eines minimal kreuz-hybridisierenden Satzes vorzugsweise signifikant größer als 2. Vorzugsweise, unterscheidet sich jedes Mitglied eines solchen Satzes von jedem anderen Mitglied durch mindestens vier Nukleotide. Stärker bevorzugt unterscheidet sich jedes Mitglied eines solchen Satzes von jedem anderen Mitglied durch mindestens sechs Nukleotide. Die Komplements der Oligonukleotid-Markierungen der Erfindung werden hierin als „Markierungskomplements" bezeichnet.

Oligonukleotid-Markierungen können einsträngig sein und für die spezifische Hybridisierung an einsträngige Markierungskomplements durch Doppelstrangbildung konstruiert sein. Oligonukleotid-Markierungen können auch doppelsträngig sein und für die spezifische Hybridisierung an einsträngige Markierungskomplements durch Triplexbildung konstruiert sein.

Es können mehrere Sätze kodierter Adaptoren eingesetzt werden, die an ein Ziel-Polynukleotid an versetzten Spaltungspunkten ligiert werden, so daß die kodierten Adaptoren Sequenzinformationen aus jedem der vielen angrenzenden Teile des Ziel-Polynukleotids liefern. Solche angrenzenden Teile entsprechen vorzugsweise den herausstehenden Strängen des in dem Verfahren erzeugten Ziel-Polynukleotids.

Die Erfindung macht Gebrauch von Nukleasen, deren Erkennungsstellen von ihren Spaltstellen getrennt sind. Wie nachstehend ausführlich erläutert, sind solche Nukleasen vorzugsweise Type IIs-Restriktionsendonukleasen. Die Nukleasen werden zur Erzeugung herausstehender Stränge an Ziel-Polynukleotiden, an die kodierte Adaptoren ligiert werden, verwendet. Die Menge an Sequenzinformationen, die in einer vorgegebenen Ausführungsform der Erfindung erhalten wird, hängt zum Teil davon ab, wie viele solcher Nukleasen eingesetzt werden und von der Länge des herausstehenden Stranges, der bei der Spaltung erzeugt wird.

Ein wesentlicher Aspekt der Erfindung ist die Fähigkeit zur parallelen Sequenzierung vieler Ziel-Polynukleotide. In diesem Aspekt umfaßt das Verfahren der Erfindung die folgenden Schritte:

  • (a) Binden einer ersten Oligonukleotid-Markierung aus einem Repertoire an Markierungen an jedes Polynukleotid in einer Population von Polynukleotiden, so daß jede erste Oligonukleotid-Markierung aus dem Repertoire aus einem ersten minimal kreuz-hybridisierenden Satz ausgewählt ist;
  • (b) Probennahme der Population von Polynukleotiden, so daß im wesentlichen alle unterschiedlichen Polynukleotide in der Population daran gebundene unterschiedliche erste Oligonukleotid-Markierungen aufweisen;
  • (c) Ligieren eines oder mehrerer kodierter Adaptoren an ein Ende der Polynukleotide in der Population, wobei die Polynukleotide dephosphorylierte 5'-Enden aufweisen und jeder kodierte Adaptor eine 3'-Blockierungsgruppe, eine zweite Oligonukleotid-Markierung, ausgewählt aus einem zweiten minimal kreuz-hybridisierenden Satz und einen herausstehenden Strang, der komplementär zu einem herausstehenden Strang eines Polynukleotids der Population ist, aufweist;
  • (d) Sortieren der Polynukleotide aus der Population durch spezifische Hybridisierung der ersten Oligonukleotid-Markierungen mit ihren jeweiligen Komplements, wobei die jeweiligen Komplements als einheitliche Populationen von im wesentlichen identischen Oligonukleotiden in räumlich getrennten Bereichen an den einen oder mehrere Festphasenträger gebunden sind; und
  • (e) Identifizieren einer Vielzahl von Nukleotiden in den herausstehenden Strängen der Polynukleotide durch spezifische Hybridisierung eines Markierungskomplements an jede zweite Oligonukleotid-Markierung von einem oder mehreren kodierten Adaptor(en).

Der obige Aspekt der Erfindung wird durch eine in den 3a bis 3e gezeigte Ausführungsform veranschaulicht. In dieser Ausführungsform werden k Ziel-Polynukleotide hergestellt, wie nachstehend und in Brenner, Internationale Patentanmeldung PCT/US95/12791, beschrieben. Das heißt, es wird eine Probe aus einer Population von Polynukleotiden, konjugiert mit Oligonukleotid-Markierungen, gekennzeichnet durch kleine „t's", genommen. Diese Markierungen werden manchmal als Oligonukleotid-Markierungen zum Sortieren oder als „erste" Oligonukleotid-Markierungen bezeichnet. Diese Markierungs-Polynukleotid-Konjugate der Probe werden z. B. durch Polymerasekettenreaktion (PCR) oder durch Klonen amplifiziert, um 1 bis k Populationen von Konjugaten zu erhalten, angezeigt durch (14)–(18) in 3a. Vorzugsweise werden die Enden der Konjugate, die den der (kleines „t") Markierungen gegenüberliegen, zur Ligation eines oder mehrerer Adaptoren, von denen jeder eine Erkennungsstelle für eine Nuklease enthält, deren Spaltstelle von ihrer Erkennungsstelle getrennt ist, vorbereitet. In der veranschaulichten Ausführungsform wurden drei solche Adaptoren, hierin als „Spaltungsadaptoren" bezeichnet, verwendet. Die Anzahl solcher verwendeten Adaptoren hängt von der gewünschten Menge an Sequenzinformationen ab. Vorzugsweise werden ein bis drei Spaltungsadaptoren verwendet.

Wenn das Verfahren der Erfindung auf die Signatursequenzierung einer cDNA-Population angewendet wird, können vor der Ligation der Spaltungsadaptoren die markierten Polynukleotidkonjugate mit einer Restriktionsendonuklease mit einer hohen Häufigkeit an Erkennungsstellen, wie Taq I, Alu I, HinP1 I oder dergleichen, abgespalten werden. Für Enzyme wie Alu I, die stumpfe Enden hinterlassen, kann ein versetztes Ende mit T4 DNA-Polymerase erzeugt werden, wie beispielsweise in Brenner, Internationale Patentanmeldung PCT/US95/12791 und Kuijper et. al., Gene, 112: 147–155 (1992) beschrieben. Wenn die Ziel-Polynukleotide durch Spaltung mit Taq I hergestellt werden, sind zur Ligation dann die folgenden Enden verfügbar:

cgannnn ... -3'

tnnnn ... -5'

Daher kann ein exemplarischer Satz dreier Spaltungsadaptoren wie folgt konstruiert sein:

wobei die Spaltungsadaptoren (1), (2) und (3) in Großbuchstaben dargestellt sind und die jeweiligen Erkennungsstellen der Nukleasen Bbs I, Bbv I und Bsm FI unterstrichen sind und ein 5'-Phosphat als „p" gekennzeichnet ist. Die doppelt unterstrichenen Teile des Ziel-Polynukleotids kennzeichnen die Position der herausstehenden Stränge nach der Ligation und Spaltung. In allen Fällen befindet sich das Ziel-Polynukleotid links mit einem 5' herausstehenden Strang aus vier Nukleotiden. Genauer gesagt können unter Verwendung unterschiedlicher Anzahlen und Arten von Nukleasen viele verschiedene Ausführungsformen konstruiert werden.

Um auf die veranschaulichte Ausführungsform zurückzukommen, die Spaltungsadaptoren A1, A2 und A3 werden in einem Konzentrationsverhältnis von 1 : 1 : 1 an die k Ziel-Polynukleotide ligiert (20), um so die in 1b gezeigten Konjugate zu erhalten, so daß in jeder Population von Markierungs-Polynukleotid-Konjugaten ungefähr die gleiche Anzahl an Konjugaten mit daran gebundenen A1, A2 und A3 vorhanden ist. Nach der Ligation (20) werden die Ziel-Polynukleotide nacheinander mit jeder Nuklease der Spaltungsadaptoren abgespalten und an einen Satz kodierter Adaptoren ligiert. Zunächst werden die Ziel-Polynukleotide mit der Nuklease des Spaltungsadaptors A1 abgespalten (22), wonach ein erster Satz kodierter Adaptoren an die resultierenden herausstehenden Stränge ligiert wird. Die Spaltung führt dazu, daß etwa ein drittel der Ziel-Polynukleotide jeder Art, d. h. t1, t2, ... tk, für die Ligation zur Verfügung steht. Vorzugsweise werden die kodierten Adaptoren als ein Gemisch aus Adaptoren angewendet, das jede mögliche Sequenz des herausstehenden Stranges enthält. Die Reaktionsbedingungen werden so ausgewählt, daß ausschließlich kodierte Adaptoren, deren herausstehende Stränge perfekt gepaarte Doppelstränge mit denen des Ziel-Polynukleotids bilden, zur Bildung kodierter Konjugate (28), (30) und (32) ligiert werden. Die großgeschriebenen „T's" mit Tiefzahlen zeigen an, daß einzigartige Oligonukleotid-Markierungen von den kodierten Adaptoren zur Markierung getragen werden. Die von kodierten Adaptoren getragenen Oligonukleotid-Markierungen werden manchmal als Markierungen zur Abgabe von Markierungen (labels) an die kodierten Adaptoren oder als „zweite" Oligonukleotid-Markierungen bezeichnet. Wie nachstehend ausführlicher beschrieben, bestehen einsträngige Oligonukleotid-Markierungen, die zur Sortierung verwendet werden, vorzugsweise aus nur drei der vier Nukleotide, so daß eine T4 DNA-Polymerase-„Stripping"-Reaktion zur Herstellung von Ziel-Polynukleotiden zur Ladung auf Festphasenträger verwendet werden kann. Andererseits können Oligonukleotid-Markierungen, die zur Abgabe von Markierungen (labels) eingesetzt werden, aus allen vier Nukleotiden bestehen.

Wie oben erwähnt, umfassen kodierte Adaptoren einen herausstehenden Strang (24) und eine Oligonukleotid-Markierung (26). Wenn daher die „A1"-Spaltung der t1-Polynukleotidkonjugate zu den folgenden Enden führt:

5'- ... nnnnnnnnn

3'- ... nnnnnnnnnacct

könnte die Oligonukleotid-Marierung T24 die folgende Struktur aufweisen (SEQ ID NO: 1):

tggattctagagagagagagagagagag -3'

aagatctctctctctctctctctc,

wobei der doppelsträngige Teil einer aus einem Satz von 768 (= 3 × 256) doppelsträngigen 20-mer Oligonukleotid-Markierungen sein kann, der einen perfekt übereinstimmenden Triplex mit einem einzigartigen Markierungskomplement und einen Triplex mit mindestens 6 fehlenden Übereinstimmungen mit allen anderen Markierungskomplements bildet. Gegebenenfalls kann ein kodierter Adaptor auch einen Spacerbereich umfassen, wie im obigen Beispiel gezeigt, wobei die 4 Nukleotide lange Sequenz „ttct" als ein Spacer zwischen dem herausstehenden Strang und der Oligonukleotid-Markierung dient.

Nach der Ligation des ersten Satzes kodierter Adaptoren (28), (30) und (32) werden die Markierungs-Polynukleotid-Konjugate mit der Nuklease des Spaltungsadaptors A2 gespalten (34), wonach ein zweiter Satz kodierter Adaptoren zur Bildung der Konjugate (36), (38) und (40) angewendet wird. Schließlich werden Markierungs-Polynukleotid-Konjugate mit der Nuklease des Spaltungsadaptors A3 gespalten (42), wonach ein dritter Satz kodierter Adaptoren zur Bildung der Konjugate (44), (46) und (48) angewendet wird. Nach Beendigung aufeinanderfolgender Spaltungen und Ligationen der kodierten Adaptoren wird das Gemisch mittels der Oligonukleotid-Markierungen t1 bis tk, wie nachstehend ausführlicher beschrieben und wie von Brenner (oben zitiert) gelehrt, auf einen oder mehrere Festphasenträger geladen. Es sollte klar sein, daß bei der Analyse eines einzelnen Ziel-Polynukleotids nicht mehrere Oligonukleotid-Markierungen, t1, t2, ... tk, notwendig sind. In einer solchen Ausführungsform kann ein Biotin oder eine ähnliche Einheit zur Fixierung des Polynukleotid-kodierter Adaptor-Konjugats eingesetzt werden, wenn keine Verkürzung erforderlich ist.

Eine Sequenzinformation ist erhältlich, indem nacheinander markierte (labeled) Markierungskomplements, entweder einzeln oder als Gemische, angewendet werden. Vorzugsweise werden für die in den 3a bis 3e veranschaulichte Ausführungsform die Markierungskomplements nacheinander in 12 Gemischen aus jeweils 64 Markierungskomplements angewendet. In jedem Gemisch gibt es vier separate Untergruppen von Markierungskomplements jeweils mit einer anderen fluoreszierenden Markierung (label). Die vier Untergruppen entsprechen Markierungskomplements, die eines der vier Nukleotide an einer vorgegebenen Position in dem herausstehenden Strang (an den der kodierte Adaptor ligiert wurde) dekodieren oder identifizieren. Beispielsweise kann ein Gemisch aus 64 Markierungskomplements Nukleotid „x" in der Sequenz „nnxn" des herausstehenden Stranges identifizieren, so daß eine erste fluoreszierende Markierung (label) zu erkennen ist, wenn x = A, eine zweite fluoreszierende Markierung (label) zu erkennen ist, wenn x = C, eine dritte fluoreszierende Markierung (label) zu erkennen ist, wenn x = G, und so weiter. Vier der 12 Gemische sollen die Nukleotide in den herausstehenden Strängen, erzeugt durch Spaltung mit der Nuklease des Spaltungsadaptors A1, identifizieren, vier sollen die Nukleotide in den herausstehenden Strängen, erzeugt durch Spaltung mit der Nuklease des Spaltungsadaptors A2, identifizieren, und vier sollen die Nukleotide in den herausstehenden Strängen, erzeugt durch Spaltung mit der Nuklease des Spaltungsadaptors A3, identifizieren.

Weitere Sequenzinformationen sind unter Verwendung der oben beschriebenen Ausführungsform in einem analogen Verfahren zu dem „Mehrschritt"-Verfahren, offenbart in Brenner, Internationale Patentanmeldung PCT/US95/03678, erhältlich. In dieser Ausführungsform wird ein vierter Adaptor, hierin als ein „Schritt-Adaptor" bezeichnet, zusammen mit den Spaltungsadaptoren A1, A2 und A3, beispielsweise in einem Konzentrationsverhältnis von 3 : 1 : 1 : 1, an die Enden der Ziel-Polynukleotide ligiert. So wird ungefähr die Hälfte der verfügbaren Enden an den Schritt-Adaptor ligiert. Der Schritt-Adaptor umfaßt eine Erkennungsstelle für eine Typ-IIs-Nuklease, die so positioniert ist, daß ihre Reichweite (nachstehend definiert) die Spaltung der Ziel-Polynukleotide am Ende der mittels der Spaltungsadaptoren A1, A2 und A3 bestimmten Sequenz ermöglicht. Ein Beispiel für einen Schritt-Adaptor, der mit dem obigen Satz an Spaltungsadaptoren verwendet werden kann, lautet wie folgt:

NN ... NCTGGAGA cgannnnnnnnnnnnnnnnnnn ... -3'

NN ... NGACCTCTGCp tnnnnnnnnnnnnnnnnnnn ... -5',

wobei, wie oben, die Erkennungsstelle der Nuklease, in diesem Fall BpM I, einfach unterstrichen ist und die Nukleotide an der Spaltstelle doppelt unterstrichen sind. Die Ziel-Polynukleotide, die mit der Nuklease des Schritt-Adaptors gespalten wurden, können an einen weiteren Satz von Spaltungsadaptoren A4, A5 und A6, die Nukleaseerkennungsstellen enthalten können, die gleiche oder andere als die in den Spaltungsadaptoren A1, A2 und A3 enthaltenen sind, ligiert werden. Ob ein vergrößerter Satz kodierter Adaptoren erforderlich ist oder nicht, hängt davon ab, ob Spaltungs- und Ligationsreaktionen in dem Signalmeßgerät toleriert werden können oder nicht. Wenn es wie oben erforderlich ist, die Enzymreaktionen in Verbindung mit der Signalmessung zu minimieren, müssen zusätzliche Sätze kodierter Adaptoren eingesetzt werden. Das heißt, wenn oben 768 Oligonukleotid-Markierungen und Markierungskomplements verlangt waren, wären bei sechs Spaltungsreaktionen, die herausstehende Stränge aus jeweils vier Nukleotiden erzeugen, 1536 Oligonukleotid-Markierungen und Markierungskomplements (24 Gemische aus jeweils 64 Markierungskomplements) erforderlich. Als Beispiel sehen die Spaltungsadaptoren A4, A5 und A6 mit den gleichen Nukleaseerkennungsstellen wie A1, A2 und A3, die mit dem oben gezeigten Schritt-Adaptor verwendet werden können, wie folgt aus:

wobei die Spaltstellen durch doppelte Unterstreichung angezeigt sind. Die Spaltungsadaptoren A4, A5 und A6 werden vorzugsweise als Gemische angewendet, so daß jeder mögliche zwei Nukleotide herausstehende Strang dargestellt wird.

Nach der Ligation der kodierten Adaptoren werden Ziel-Polynukleotide zur Ladung auf Festphasenträger, vorzugsweise Mikroteilchen, hergestellt, wie in Brenner, Internationale Patentameldung PCT/US95/12791, offenbart. Kurz gesagt, die Oligonukleotid-Markierungen zur Sortierung werden unter Verwendung einer „Stripping"-Reaktion mit T4 DNA-Polymerase, nachstehend ausführlich erörtert, einsträngig gemacht. Die einsträngigen Oligonukleotid-Markierungen werden an ihren Markierungskomplements auf Mikroteilchen spezifisch hybridisiert und ligiert. Die beladenen Mikroteilchen werden dann in einem Gerät, wie in Brenner (oben zitiert) beschrieben, analysiert, was die sequentielle Abgabe, spezifische Hybridisierung und Entfernung markierter (labeled) Markierungskomplements an und aus kodierte(n) Adaptoren ermöglicht.

Kodierte Adaptoren können mit der in Brenner et. al. (oben zitiert) beschriebenen Sortiermethodologie verwendet werden, um so die Shotgun-Sequenzierung an Ziel-Polynukleotiden von einigen Kilobasen bis einigen zehn Kilobasen in der Länge, z. B. 10–25 Kilobasen, wenn 12–16 Nukleotide in jeden zehn- bis fünfzigtausend Fragmenten identifiziert werden, durchführen zu können.

Synthese von Adaptoren

Die kodierten Adaptoren und Spaltungsadaptoren werden günstigerweise auf einem automatichen DNA-Synthetisierer unter Verwendung von Standardchemien, wie Phosphoramiditchemie, die beispielsweise in den folgenden Referenzen offenbart werden, synthetisiert: Beaucage und lyer, Tetrahedron, 48: 2223–2311 (1992); Molko et. al., US-Patent Nr. 4,980,460; Koster et. al., US-Patent Nr. 4,725,677; Caruthers et. al., US-Patent Nr. 4,415,732; 4,458,066 und 4,973,679 und dergleichen. Alternative Chemien, die beispielsweise zu nicht natürlichen Hauptkettengruppen führen, wie Phosphorthioat, Phosphoramidat und dergleichen, können ebenso eingesetzt werden, vorrausgesetzt, daß die resultierenden Oligonukleotide mit den Ligations- und Spaltungsreagenzien kompatibel sind. Nach der Synthese der komplementären Stränge werden die Stränge zur Bildung eines doppelsträngigen Adaptors vereinigt. Der herausstehende Strang eines kodierten Adaptors kann als ein Gemisch synthetisiert werden, so daß jede mögliche Sequenz in dem herausstehenden Teil dargestellt wird. Solche Gemische sind unter Verwendung allgemein bekannter Verfahren, wie z. B. in Telenius et. al., Genomics, 13: 718–725 (1992); Welsh et. al., Nucleic Acids Research, 19: 5275–5279 (1991); Grothues et. al., Nucleic Acids Research. 21: 1321–1322 (1993); Hartley, Europäische Patentanmeldung 90304496.4 und dergleichen offenbart, ohne weiteres zu synthetisieren. Im allgemeinen verlangen diese Verfahren einfach nur die Auftragung von Gemischen aus den aktivierten Monomeren auf das wachsende Oligonukleotid während der Paarungsschritte, bei denen mehrere Nukleotide eingeführt werden müssen. Wie oben erörtert kann in einigen Ausführungsformen die Reduktion der Komplexität der Adaptoren wünschenswert sein. Diese kann unter Verwendung von Analoga, die die Komplexität reduzieren, wie Desoxyinosin, 2-Aminopurin oder dergleichen, erfolgen, wie z. B. in Kong Thoo Lin et. al., Nucleic Acids Research, 20: 5149–5152, oder von US-Patent Nr. 5,002,867; Nichols et. al., Nature. 369: 492–493 (1994) und dergleichen, gelehrt.

In einigen Ausführungsformen kann die Synthese kodierter Adaptoren oder Spaltungsadaptoren als ein einzelnes Polynukleotid, welches selbst-komplementäre Bereiche enthält, erforderlich sein. Nach der Synthese können die selbstkomplementären Bereiche unter Bildung eines Adaptors mit einem herausstehenden Strang an einem Ende und einer einsträngigen Schleife an dem anderen Ende Basenpaare bilden. In solchen Ausführungsformen kann die Schleifenregion vorzugsweise etwa 3 bis 10 Nukleotide oder andere vergleichbare Linkereinheiten, z. B. Alkylethergruppen, umfassen, wie in US-Patent Nr. 4,914,210 offenbart. Für die Bindung reaktiver Gruppen an die Basen- oder Internukleosidverbindungen zur Markierung sind viele Verfahren verfügbar, wie in den nachstehend zitierten Referenzen erörtert.

Werden herkömmliche Ligasen in der Erfindung eingesetzt, wie nachstehend ausführlicher beschrieben, kann das 5'-Ende des Adaptors in einigen Ausführungsformen phosphoryliert sein. Ein 5'-Monophosphat kann entweder chemisch oder enzymatisch mit einer Kinase an ein zweites Oligonukleotid gebunden werden, z. B. Sambrook et. al., Molecular Cloning: A Laboratory Manual, 2. Aufl. (Cold Spring Harbor Laboratory, New York, 1989). Die chemische Phosphorylierung wird von Horn und Urdea, Tetrahedron Lett., 27: 4705 (1986) beschrieben, und Reagenzien zur Durchführung der offenbarten Protokolle sind kommerziell erhältlich, z. B. 5'-Phosphate-ONTM von Clontech Laboratories (Palo Alto, CA).

Herstellung von Ziel-Polynukleotiden

Vorzugsweise ist ein Ziel-Polynukleotid für die Verwendung in der Erfindung doppelsträngig und ist so ausgerüstet, daß es ein oder mehrere herausstehende Stränge hat. Der herausstehende Strang kann entweder 5' oder 3' sein und die Anzahl der Nukleotide in dem herausstehenden Teil des Stranges liegt bevorzugt im Bereich von 2 bis 6. Ein Ziel-Polynukleotid wird als „–k" bezeichnet, wenn k eine ganze Zahl ist, für gewöhnlich beispielsweise zwischen 2 und 6, immer dann, wenn der 5'-Strang heraussteht. Im Gegensatz dazu wird ein Ziel-Polynukleotid als „+k" bezeichnet, wenn der 3'-Strang heraussteht. Zum Bespiel wäre gemäß dieser Nomenklatur folgendes ein -4-Ziel-Polynukleotid:

5'-AACGTTTAC ...

AAATG ...

In einer bevorzugten Ausführungsform der Erfindung ist das Ziel-Polynukleotid an einem Festphasenträger, wie einem Magnetteilchen, einem polymeren Mikrokügelchen, einem Filtermaterial oder dergleichen fixiert, was die sequentielle Anwendung der Reagenzien ohne komplizierte und zeitaufwendige Reinigungsschritte ermöglicht. Die Länge des Ziel-Polynukleotids kann stark variieren, für eine bequemere Herstellung sind jedoch Längen, die bei der herkömmlichen Sequenzierung eingesetzt werden, bevorzugt. Zum Bespiel werden Längen im Bereich von einigen hundert Basenpaaren, 200–300, bis 1 bis 2 Kilobasenpaaren bevorzugt.

Die Ziel-Polynukleotide können durch viele herkömmliche Verfahren hergestellt werden. Beispielsweise können Ziel-Polynukleotide als Inserts herkömmlicher Klonvektoren, einschließlich derer, die bei der herkömmlichen DNA-Sequenzierung verwendet werden, hergestellt werden. Eine ausführliche Anleitung zur Auswahl und Verwendung geeigneter Klonvektoren ist in Sambrook et. al., Molecular Cloning: A Laboratory Manual, 2. Auflage (Cold Spring Harbor Laboratory, New York, 1989), und ähnlichen Referenzen zu finden. Sambrook et. al. und Innis et. al., Hrsg., PCR Protocols (Academic Press, New York, 1990) stellen ebenso eine Anleitung zur Verwendung von Polymerasekettenreaktionen zur Herstellung von Ziel-Polynukleotiden bereit. Vorzugsweise werden geklonte oder PCR-amplifizierte Ziel-Polynukleotide hergestellt, die die Bindung an Magnetkügelchen oder andere feste Träger ermöglichen, um so die Abtrennung des Ziel-Polynukleotids von anderen Reagenzien, die in den Verfahren verwendet werden, zu vereinfachen. Protokolle für solche Herstellungstechniken werden in Wahlberg et. al., Electrophoresis, 13: 547–551 (1992); Tong et. al., Anal. Chem., 64: 2672–2677 (1992); Hultman et. al., Nucleic Acids Research, 17: 4937–4946 (1989); Hultman et. al., Biotechniques, 10: 84–93 (1991); Syvanen et. al., Nucleic Acids Research, 16: 11327–11338 (1988); Dattagupta et. al., US-Patent Nr. 4,734,363; Uhlen, PCT-Anmeldung PCT/GB89/00304; und ähnlichen Referenzen ausführlich beschrieben. Auch Kits sind kommerziell zur Praktizierung solcher Verfahren erhältlich, z. B. das DynabeadsTM-Templatepräparationskit von Dynal AS. (Oslo, Norwegen).

Populationen von Ziel-Polynukleotiden können parallel durch die Verwendung von Mikroteilchen, z. B. Magnetkügelchen, Controlled Pore Glass-Partikeln oder dergleichen, hergestellt werden, die alle eine daran gebundene einheitliche Population identischer minimal kreuz-hybridisierender Oligonukleotide aufweisen, wie in Brenner et. al., Internationale Anmeldung PCT/US96/09513, beschrieben.

Unter dem Ausdruck „Nuklease", wie er gemäß der Erfindung verwendet wird, ist ein Enzym, eine Kombination von Enymen oder anderer chemischer Reagenzien, oder Kombinationen chemischer Reagenzien und Enzyme zu verstehen, die, wenn auf einen ligierten Komplex angewendet, nachstehend ausführlicher beschrieben, den ligierten Komplex unter Erzeugung eines größeren Adaptors und eines verkürzten Ziel-Polynukleotids spalten. Eine Nuklease der Erfindung muß nicht unbedingt ein einzelnes Protein sein oder ausschließlich aus einer Kombination von Proteinen bestehen. Ein Schlüsselmerkmal der Nuklease oder der Kombination aus Reagenzien, die als eine Nuklease verwendet werden, ist, daß ihre Spaltstelle von ihrer Erkennungsstelle getrennt ist. Der Abstand zwischen der Erkennungsstelle einer Nuklease und ihrer Spaltstelle wird hierin als ihre „Reichweite" bezeichnet. Für gewöhnlich wird „Reichweite" durch zwei ganze Zahlen definiert, die die Anzahl an Nukleotiden zwischen der Erkennungsstelle und den hydrolysierten Phosphodiesterbindungen jedes Stranges angeben. Beispielsweise werden die Erkennungs- und Spaltmerkmale von Fok I typischerweise als „GGATG(9/13)" dargestellt, da es eine doppelsträngige DNA (SEQ ID NO: 2) wie folgt erkennt und schneidet:

wobei die fetten Nukleotide Fok I-Erkennungsstellen sind und die N's beliebige Nukleotide und deren Komplements sind.

Es ist wichtig, daß die Nuklease nur das Ziel-Polynukleotid spaltet, nachdem es einen Komplex mit seiner Erkennungsstelle gebildet hat; und vorzugsweise hinterläßt die Nuklease nach der Spaltung einen herausstehenden Strang an dem Ziel-Polynukleotid.

Vorzugsweise sind Nukleasen, die in der Erfindung eingesetzt werden, natürliche Proteinendonukleasen (i) deren Erkennungsstelle von ihrer Spaltstelle getrennt ist und (ii) deren Spaltung zu einem herausstehenden Strang an dem Ziel-Polynukleotid führt. Am stärksten bevorzugt werden Restriktionsendonukleasen der Klasse IIs als Nukleasen in der Erfindung eingesetzt, wie zum Beispiel in Szybalski et. al., Gene. 100: 13–26 (1991); Roberts et. al., Nucleic Acids Research, 21: 3125–3137 (1993); und Livak und Brenner, US-Patent Nr. 5,093,245, beschrieben. Exemplarische Klasse IIs-Nukleasen zur Verwendung in der Erfindung umfassen Alw XI, Bsm AI, Bbv I, Bsm FI, Sts I, Hga I, Bsc AI, Bbv II, Bce fI, Bce 85I, Bcc I, Bcg I, Bsa I, Bsg I, Bsp MI, Bst 71I, Ear I, Eco 57I, Esp 3I, Fau I, Fok I, Gsu I, Hph I, Mbo II, Mme I, Rle AI, Sap I, Sfa NI, Taq II, Tth 111II, Bco 5I, Bpu AI, Fin I, Bsr DI und deren Isoschizomere. Die bevorzugte Nuklease ist Bbv I.

Vorzugsweise wird vor den Nuklease-Spaltungschritten, für gewöhnlich zu Beginn des Sequenzierungsvorganges, das Ziel-Polynukleotid behandelt, um die Erkennungsstellen und/oder Spaltstellen der eingesetzten Nuklease zu blockieren. So wird aufgrund des zufälligen Auftretens von Nuklease-Erkennungsstellen innerhalb des Ziel-Polynukleotids eine unerwünschte Spaltung des Ziel-Polynukleotids verhindert. Die Blockierung kann auf unterschiedliche Arten herbeigeführt werden, einschließlich Methylierung und Behandlung mit Sequenz-spezifischen Aptameren, DNA-Bindungsproteinen oder Oligonukleotiden, die Triplexe bilden. Beim Einsatz natürlicher Proteinendonukleasen können die Erkennungsstellen günstigerweise durch die Methylierung des Ziel-Polynukleotids mit der zugehörigen Methylase der verwendeten Nuklease blockiert werden. Das heißt, für die meisten, wenn auch nicht alle, bakterielle Type II-Restriktionsendonukleasen existieren so genannte „zugehörige" Methylasen, die ihre Erkennungsstelle methylieren. Viele solcher Methylasen werden in Roberts et. al. (oben zitiert) und Nelson et. al., Nucleic Acids Research, 21: 3139–3154 (1993) offenbart und sind kommerziell von vielen Quellen, bevorzugt New England Biolabs (Beverly, MA), erhältlich. Alternativ können, wenn ein PCR-Schritt bei der Herstellung von Ziel-Polynukleotiden zur Sequenzierung eingesetzt wird, 5-Methylcytosintriphosphate während der Amplifikation verwendet werden, so daß das natürliche Cytosin durch methylierte Cytosine in dem Amplicon ersetzt wird. Dieser späte Ansatz hat den zusätzlichen Vorteil, daß eine Behandlung des mit einem anderen Enzym an einen Festphasenträger gebundenen Ziel-Polynukleotids nicht erforderlich ist.

Das Verfahren der Erfindung kann einen oder mehrere Capping-Schritte in jedem Zyklus umfassen. Der Ausdruck „Capping" wird hierin analog zur Verwendung des Ausdrucks in der Polynukleotidsynthese verwendet, z. B. Andrus et. al., US-Patent Nr. 4,816,571. Er bezieht sich auf die Behandlung eines Ziel-Polynukleotids, das in einem vorhergehenden Schritt keiner Transformation unterlegen hat oder nicht an dieser beteiligt war. Die Capping-Behandlung macht ein Ziel-Polynukleotid inaktiv gegen die Beteiligung in irgendeinem Behandlungsschritt der nachfolgenden Zyklen. Auf diese Weise werden falsche Signale aus „phasenverschobenen" Spaltungen oder Ligationen verhindert. Die Capping-Schritte können nach Ligationsschritten und/oder Spaltungsschritten eingeführt werden. Beispielsweise kann ein erster Capping-Schritt eingeführt werden, nachdem ein nicht-ligierter Adaptor aus dem Ziel-Polynukleotid gewaschen worden ist. Wenn die eingesetzte Nuklease einen 5' herausstehenden Strang an den Ziel-Polynukleotiden hinterläßt, wird das Capping vorzugsweise durch das Aussetzen der nicht reagierten Ziel-Polynukleotide einem Gemischaus den vier Didesoxynukleosidtriphosphaten oder anderen Kettenabbruch-Nukleosidtriphosphaten und einer DNA-Polymerase herbeigeführt. Die DNA-Polymerase erweitert den 3'-Strang des nicht reagierten Ziel-Polynukleotids um ein Kettenabbruch-Nukleotid, z. B. ein Didesoxynukleotid, wodurch es in den folgenden Zyklen nicht ligiert werden kann.

Ein zweiter Capping-Schritt kann nach dem Spaltungsschritt eingeführt werden. In Abhängigkeit der Erkennungsstelle der eingesetzten Type IIs-Nuklease können nicht gespaltene Adaptoren durch die Behandlung mit einer Methylase geschützt („capped") werden, um so die Type IIs-Erkennungsstelle in dem Adaptor zu blockieren, was den ligierten Komplex für weitere Verfahrensschritte inaktiv macht. Es können ebenso Adaptoren konstruiert werden, die eine zusätzliche Restriktionsstelle umfassen, die das Capping durch Spaltung von Adaptoren, die bei der Behandlung der Typ-IIs-Nuklease nicht gespalten wurden, ermöglichen. Ein Beispiel eines solchen Adaptors wird nachstehend gezeigt (SEQ ID NO: 3):

Die Behandlung mit Eco RV führt zur Bildung eines stumpf endenden Ziel-Polynukleotids, das an nachfolgenden Ligationen nicht teilnehmen kann (in Ausführungsformen, die herausstehende Enden erfordern). Derartige Capping-Ansätze haben den zusätzlichen Vorteil, daß alle Markierungen (labels), die sich am Ende des ligierten Adaptors befinden, entfernt werden, wodurch ein Beitrag zum Rauschen in den folgenden Detektionsschritten reduziert wird.

Genauer gesagt, kann ein Fachmann Merkmale der oben angegebenen Ausführungsformen kombinieren, um so weitere Ausführungsformen gemäß der Erfindung, die nicht bereits genauer angegeben wurden, zu gestalten.

Festphasenträger

Festphasenträger zur Verwendung in der Erfindung können viele Formen annehmen, einschließlich Mikroteilchen, Kügelchen und Membranen, Objektträger, Platten, feinverarbeitete Chips und dergleichen. Dem ähnlich können die Festphasenträger der Erfindung viele Zusammensetzungen umfassen, einschließlich Glas, Kunststoff, Silicium, Alkanthiolat-derivatisiertes Gold, Cellulose, wenig vernetztes und stark vernetztes Polystyrol, Kieselgel, Polyamid und dergleichen. Vorzugsweise wird entweder eine Population aus diskreten Teilchen eingesetzt, so daß jedes eine einheitliche Beschichtung hat, oder eine Population aus im wesentlichen identischen Polynukleotiden, oder es werden ein einzelner oder wenige Träger mit räumlich getrennten Bereichen mit jeweils einer einheitlichen Beschichtung eingesetzt, oder eine Population aus im wesentlichen identischen Polynukleotiden. In der letzten Ausführungsform kann die Fläche der Bereiche gemäß der jeweiligen Anwendungen variieren; für gewöhnlich nehmen die Bereiche aber eine Fläche von mehreren &mgr;m2, z. B. 3–5, bis mehreren hundert &mgr;m2, z. B. 100–500, ein. Vorzugsweise sind solche Bereiche räumlich getrennt, so daß durch Ereignisse, wie zum Beispiel fluoreszierende Emissionen, erzeugte Signale an benachbarten Bereichen durch das eingesetzte Detektionssystem getrennt werden können.

Vorzugsweise sind die in der Erfindung eingesetzten Festphasenträger Mikroteilchen, einschließlich Mikroteilchen aus Controlled Pore Glass (CPG), stark venetztem Polystyrol, Acrylcopolymeren, Cellulose, Nylon, Dextran, Latex, Polyacrolein und dergleichen, die in den folgenden exemplarischen Referenzen offenbart sind: Meth. Enzymol. Teil A, Seiten 11–147, Bd. 44 (Academic Press, New York, 1976); US-Patent Nr. 4,678,814; 4,413,070 und 4,046;720; und Pon, Kapitel 19, in Agrawal, Hrsg., Methods in Molecular Biology, Bd. 20, (Humana Press, Totowa, N.J., 1993). Mikroteilchenträger umfassen ferner kommerziell erhältliches CPG und Polystyrolkügelchen (z. B. erhältlich von Applied Biosystems, Foster City, CA); derivatisierte Magnetkügelchen, Polystyrol, gepfropft mit Polyethylenglykol (z. B., TentaGelTM, Rapp Polymere, Tübingen, Deutschland) und dergleichen. Die Auswahl der Trägermerkmale, wie Material, Porosität, Größe, Form und dergleichen, und die Art der eingesetzten Linkereinheit hängt von den Bedingungen ab, unter denen die Kugel-Polynukleotid-Konjugate verwendet werden. In Anwendungen, die die aufeinanderfolgende Prozessierung mit Enzymen umfassen, sind beispielsweise Träger und Linker bevorzugt, die die sterische Hinderung der Enzyme minimieren und die den Zugriff auf das Substrat erleichtern. Andere wesentliche Faktoren, die bei der Auswahl des am besten geeigneten Mikroteilchenträgers berücksichtigt werden müssen, umfassen eine einheitliche Größe, die Effizienz als Syntheseträger, das Ausmaß der bekannten Oberfläche und optische Eigenschaften, beispielsweise liefern klare ebene Kügelchen technische Vorteile, wenn sich viele Kügelchen auf einer Oberfläche befinden. Im allgemeinen sind Größe und Form eines Mikroteilchens nicht kritisch; Mikroteilchen mit einem Durchmesser in einer Größenordnung von wenigen, z. B. 1–2, bis mehreren Hundert, z. B. 200–1000 &mgr;m, sind jedoch bevorzugt.

In anderen bevorzugten Anwendungen werden wegen ihrer optischen Eigenschaften nicht-poröse Mikroteilchen eingesetzt, die vorteilhafterweise dann verwendet werden, wenn viele Mikroteilchen auf ebenen Trägern, wie einem Objektträger, verfolgt werden. Besonders bevorzugte nicht-poröse Mikroteilchen sind die Glycidmethacrylat-Kügelchen (GMA-Kügelchen), erhältlich von Bangs Laboratories (Carmel, IN). Solche Mikroteilchen sind in vielen Größen und derivatisiert mit einer Vielzahl von Linker-Gruppen zur Synthese von Markierungen oder Markierungskomplements nützlich. Vorzugsweise werden für massive parallele Manipulationen markierter Mikroteilchen GMA-Kügelchen mit einem Durchmesser von 5 &mgr;m eingesetzt.

Experimenteller Teil Seguenzierung eines Ziel-Polynukleotids, amplifiziert aus pGEM7Z: Identifizierung von Nukleotiden durch die Ligationsreaktion

In diesem Beispiel wird ein Segment aus Plasmid pGEM7Z (Promega, Madison, WI) amplifiziert und an Glaskügelchen über einen doppelsträngigen DNA-Linker, von dem ein Strang direkt auf die Kügelchen synthetisiert wird (und daher kovalent mit diesen verknüpft ist), gebunden. In jedem Sequenzierungszyklus nach der Ligation wird ein Aliquot Kügelchen aus dem Reaktionsgemisch entfernt und zur Analyse des nicht kovalent gebundenen Strangs des ligierten Komplexes auf eine Gelelektrophoresesäule geladen. Die Sonden sind so gestaltet, daß der nicht kovalent gebundene Strang zur Analyse immer eine fluoreszierende Markierung (label) trägt.

Ein 47-mer Oligonukleotid wird unter Verwendung eines automatischen Standard-DNA-Synthetisierer-Protokolls direkt auf KF169 Ballotini-Kügelchen synthetisiert. Der zu dem 47-mer komplementäre Strang wird separat synthetisiert und durch HPLC gereinigt. Sofern hybridisiert weißt der resultierende Doppelstrang eine Bst XI-Restriktionsstelle am distalen Ende der Kügelchen auf. Der komplementäre Strang wird an das gebundene 47-mer in dem folgenden Gemisch hybridisiert: 25 &mgr;l komplementärer Strang bei 200 pmol/&mgr;l; 20 mg KF169 Ballotini-Kügelchen mit dem 47-mer; 6 &mgr;l New England Biolabs #3-Restriktionspuffer und 25 &mgr;l destilliertes Wasser. Das Gemisch wurde auf 93 °C erhitzt und dann langsam auf 55 °C abgekühlt, wonach 40 Einheiten Bst XI (bei 10 Einheiten/&mgr;l) zugegeben wurden, um das Reaktionsvolumen auf 60 &mgr;l zu bringen. Das Gemisch wurde bei 55 °C für 2 Stunden inkubiert, wonach die Kügelchen dreimal in TE (pH 8,0) gewaschen wurden.

Das an die Kügelchen zu bindende pGEM7Z-Segment wurde wie folgt hergestellt: Zwei PCR-Primer wurden unter Verwendung von Standardprotokollen hergestellt (SEQ ID NO: 4 und SEQ ID NO: 5):

Primer 1: 5'-CTAAACCATTGGTATGGGCCAGTGPAATTGTAATA

Primer 2: 5'-CGCGCAGCCCGCATCGTTTATGCTACAGACTGTCAGTGCAGCTCTCCGATCCAAA

Das PCR-Reaktionsgemisch bestand aus folgendem: 1 &mgr;l pGEM7Z bei 1 ng/&mgr;l; 10 &mgr;l Primer 1 bei 10 pmol/&mgr;l; 10 &mgr;l Primer 2 bei 10 pmol/&mgr;l; 10 &mgr;l Desoxyribonukleotidtriphosphate bei 2,5 mM; 10 &mgr;l 10 × PCR-Puffer (Perkin-Elmer); 0,5 &mgr;l Taq-DNA-Polymerase bei 5 Einheiten/&mgr;l; und 58 &mgr;l destilliertes Wasser, um ein Gesamtvolumen von 100 &mgr;l zu erhalten. Das Reaktionsgemisch wurde 25 Zyklen bei 93 °C für 30 s; 60 °C für 15 s und 72 °C für 60 s unterzogen, um ein Produkt mit 172 Basenpaaren zu erhalten, das nacheinander mit Bbv I (100 &mgr;l PCR-Reaktionsgemisch, 12 &mgr;l 10 × #1 New England Biolabs-Puffer, 8 &mgr;l Bbv I bei 1 Einheit/&mgr;l, inkubiert bei 37 °C für 6 Stunden) und mit Bst XI (dem Bbv I-Reaktionsgemisch wurde zugegeben: 5 &mgr;l 1 M NaCl, 67 &mgr;l destilliertes Wasser und 8 &mgr;l Bst XI bei 10 Einheiten/&mgr;l, und das resultierende Gemisch wurde bei 55 °C für 2 Stunden inkubiert) digestiert wurde.

Nachdem das obige Reaktionsgemisch gemäß dem Protokoll des Herstellers durch eine Centricon 30 (Amicon, Inc.) Spinsäule geführt worden war, wurde das Bbv I/Bst XI-geschnittenes Fragment in dem folgenden Gemisch an den doppelsträngigen Linker, gebunden an die Ballotini-Kügelchen, ligiert: 17 &mgr;l Bbv I/Bst XI-geschnittenes Fragment (10 &mgr;g), 10 &mgr;l Kügelchen (20 mg), 6 ml 10 × Ligationspuffer (New England Biolabs, nachstehend als NEB bezeichnet), 5 &mgr;l T4 DNA-Ligase bei 2000 Einheiten/&mgr;l und 22 &mgr;l destilliertes Wasser, wobei das Gemisch bei 25 °C für 4 Stunden inkubiert wurde, wonach die Kügelchen dreimal mit TE (pH 8,0) gewaschen wurden, wodurch das folgende Ziel-Polynukleotid zur Sequenzierung mit einem 5'-Phosphat erhalten wurde:

Das 5'-Phosphat wurde durch die Behandlung des Kügelchengemisches mit einer Alkaliphosphatase, z. B. aus Kalbsdarm, erhältlich von New England Biolabs (Beverly, MA), unter Verwendung des Herstellerprotokolls entfernt.

Die Stränge der folgenden Adaptoren (24 Nukleotide in einem markierten Strang und 18 Nukleotide in einem nicht markierten Strang) wurden separat auf einem automatischen DNA-Synthetisierer (Modell 392, Applied Biosystems, Foster City) unter Verwendung von Standardverfahren synthetisiert (SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 und SEQ ID NO: 9):

wobei p ein Monophosphat ist, N A, C, G oder T anzeigt, Q ein verzweigter Linker ist, der eine geschützte Aminogruppe zur Bindung einer Markierung (label) trägt (z. B. Uni-Link AminoModifier, erhältlich von Clontech Laboratories, Palo Alto, CA), TAMRA (Tetramethylrhodamin), FAM (Fluorescein), ROX (Rhodamin X) und JOE (2',7'-Dimethoxy-4',5'-dichlorfluorescein) von Perkin-Elmer Applied Biosystems Division (Foster City, CA) erhältlich sind. Es wurden gleiche molare Mengen von jedem Adaptor in TE kombiniert, um ein Gemisch mit einer Konzentration von 1000 pmol/&mgr;l zu bilden.

Die Ligation der Adaptoren an das Ziel-Polynukleotid wurde in einem Gemisch, bestehend aus 5 &mgr;l Kügelchen (20 mg), 3 &mgr;l NEB 10 × Ligasepuffer, 5 &mgr;l Adaptorenmischung, 2,5 &mgr;l NEB T4 DNA-Ligase (2000 Einheiten/&mgr;l) und 14,5 &mgr;l destilliertem Wasser, durchgeführt. Das Gemisch wurde bei 16 °C für 30 Minuten inkubiert, wonach die Kügelchen dreimal mit TE (pH 8,0) gewaschen wurden.

Nach der Zentrifugation und Entfernung von TE wurden die 3'-Phosphate der ligierten Adaptoren durch die Behandlung des Polynukleotid-Kügelchen-Gemisches mit Kalbsdarm-Alkaliphosphatase (CIP) (New England Biolabs, Beverly, MA) unter Verwendung des Herstellerprotokolls entfernt. Nach der Entfernung der 3'-Phosphate wurde die CIP durch proteolytische Digestion, z. B. unter Verwendung von PronaseTM (erhältlich von Boeringer Mannheim, Indianapolis, IN.) oder einer äquivalenten Protease gemäß dem Herstellerprotokoll inaktiviert. Das Polynukleotid-Kügelchen-Gemisch wurde dann gewaschen, mit T4 Polynukleotidkinase (New England Biolabs, Beverly, MA) behandelt, wodurch ein 5'-Phosphat an dem Spalt zwischen dem Ziel-Polynukleotid und den Adaptor addiert wurde. Nach dem Waschen wurde das Kügelchen-Polynukleotid-Gemisch mit T4 DNA-Ligase, wie oben beschrieben, behandelt, um so die Ligation der Adaptoren an das Ziel-Polynukleotid zu vervollständigen.

Die Spaltungen wurden in einem Gemisch, bestehend aus 5 &mgr;l Kügelchen (20 mg), 3 &mgr;l 10 × NEB-Puffer #3, 3 &mgr;l NEB Fok I (4 Einheiten/&mgr;l) und 19 &mgr;l destilliertem Wasser durchgeführt. Das Gemisch wurde bei 37 °C für 30 Minuten inkubiert, wonach die Kügelchen dreimal in TE (pH 8,0) gewaschen wurden.

Nach jeder Ligation wurde eine Probe der Kügelchen mit dem ligierten Komplex zur Größenanalyse auf einem DNA-Sequenzer, Modell 373, unter Verwendung der 672 GeneScan-Software (Applied Biosystems) entfernt. Das Auslesen des Systems lieferte eine unterschiedlich gefärbte Kurve für Fragmente, die mit den vier unterschiedlichen Farbstoffen markiert waren (schwarz für TAMRA, blau für FAM, grün für JOE und rot für ROX). Gemäß dem Herstellerprotokoll wurde ein 6%iges Denaturations-(8 M Harnstoff) Polyacrylamidgel eingesetzt. Gemäß dem Herstellerprotokoll wurden etwa 0,5 mg der Kügelchen zur Analyse der Sequenzierungsfragmente in 4 &mgr;l Formamidbeladungspuffer plaziert. Die Proben wurden auf 95 °C für 2 min erhitzt, dann durch Plazierung auf Eis abgekühlt, wonach die gesamte Probe in eine Analysespur geladen wurde.

Sequenzprotokoll


Anspruch[de]
Verfahren zur Bestimmung einer Nukleotid-Sequenz eines Ziel-Polynukleotids, wobei das Verfahren die Schritte:

(a) Bereitstellen (i) eines doppelsträngigen Ziel-Polynukleotids, umfassend einen ersten Strang und einen zweiten Strang, wobei der erste Strang an einem Ende des Polynukleotids mit einer 5'-Hydroxylgruppe endet, und (ii) eines doppelsträngigen Polynukleotid-Adaptors, umfassend einen ersten Strang und einen zweiten Strang, wobei der erste Strang an einem Ende des Adaptors mit einer 3'-Hydroxyl-Blockierungsgruppe endet, und der zweite Strang an dem gleichen Ende des Adaptors mit einer 5'-Phosphatgruppe endet,

wobei die Enden des Ziel-Polynukleotids und des Polynukleotid-Adaptors entweder 5'-Überhänge, welche komplementär zueinander sind, oder 3'-Überhänge, welche komplementär zueinander sind, enthalten;

(b) Ligieren des Endes des Ziel-Polynukleotids an das Ende des Adaptors, sodass der zweite Strang des Ziel-Polynukleotids an den zweiten Strang des Adaptors ligiert wird, um ein einfach ligiertes Ziel-Adaptor-Addukt zu bilden,

(c) Umwandeln der 3'-Hydroxyl-Blockierungsgruppe in dem Addukt in eine 3'-Hydroxylgruppe und Umwandeln der 5'-Hydroxylgruppe in dem Addukt in eine 5'-Phosphatgruppe, wobei die Umwandlungen gleichzeitig oder in beliebiger Reihenfolge aufeinander folgend bewirkt werden,

(d) Ligieren des zweiten Strangs des Ziel-Polynukleotids an den zweiten Strang des Adaptors nach Schritt (c), um ein doppelt ligiertes Ziel-Adaptor-Addukt zu bilden, und

(e) nachfolgend zu Schritt (d), Identifizieren einer oder mehrerer Nukleotide im Ziel-Polynukleotid,

umfasst.
Verfahren nach Anspruch 1, wobei der Adaptor eine Typ IIs Endonuklease-Erkennungsstelle mit einer Ausrichtung relativ zum Ende des Adaptors enthält, sodass (i) die Spaltstelle der Endonuklease mindestens ein Nukleotid jenseits des Endes des Adaptors auftritt, und (ii) das Spaltmuster der Endonuklease wirksam ist, ein gestutztes Ziel-Polynukleotidfragment mit einem zum Ende des Adaptors komplementären Ende zu erzeugen, wenn das doppelt ligierte Ziel-Adaptor-Adukt von Schritt (d) mit der Endonuklease umgesetzt wird, und das Verfahren weiter den Schritt des Spaltens des doppelt ligierten Addukts mit einer für die Erkennungsstelle spezifischen Typ IIs Endonuklease einschließt, um ein gestutztes Polynukleotidfragment, welches um ein oder mehrere Nukleotide verkürzt ist, herzustellen. Verfahren nach Anspruch 2, wobei nach dem Spalten das gestutzte Ziel-Polynukleotidfragment behandelt wird, um eine durch den Spaltschritt erzeugte 5'-terminale Phosphatgruppe zu entfernen. Verfahren nach einem vorhergehenden Anspruch, wobei die 3'-Blockierungsgruppe eine Phosphatgruppe ist und der Schritt des Umwandelns der 3'-Blockierungsgruppe in eine 3'-Hydroxylgruppe unter Verwendung einer Phosphatase erreicht wird. Verfahren nach einem der Ansprüche 1 bis 3, wobei der Schritt des Umwandelns der 3'-Blockierungsgruppe in eine 3'-Hydroxylgruppe das Ersetzen des zweiten Strangs des Adaptors mit einem neuen zweiten Strang einschließt, welcher (i) einer Sequenz aufweist, welche die Gleiche wie die des ersetzten Strangs ist, und (ii) eine 3'-Hydroxylgruppe statt einer 3'-Blockierungsgruppe enthält. Verfahren nach einem vorhergehenden Anspruch, wobei der Adaptor die Formel:
aufweist, wobei N und N' komplementäre Nukleotide sind, p eine Phosphatgruppe ist, z eine 3'-Blockierungsgruppe ist, n eine ganze Zahl zwischen 2 und 5, einschließlich, ist, q eine ganze Zahl von größer als oder gleich 8 ist und r eine ganze Zahl von größer als oder gleich 8 ist und gleich oder verschieden von q sein kann.
Verfahren nach Anspruch 6, wobei z eine Phosphatgruppe ist, q im Bereich zwischen 12 und 50 liegt, und r im Bereich zwischen 12 und 50 liegt. Verfahren nach einem vorhergehenden Anspruch, wobei das Polynukleotid an einen Festphasenträger gebunden ist. Verfahren nach einem vorhergehenden Anspruch, wobei die Schritte (b) bis (e) ein oder mehrere Mal(e) wiederholt werden. Vielzahl von doppelsträngigen Nukleinsäure-Adaptoren, jeder mit einem 3'-herausstehenden Strang, wobei jede mögliche Sequenz des herausstehenden Strangs in der Vielzahl der Adaptoren dargestellt ist, und wobei jeder Adaptor die Formel:
aufweist, wobei N und N' komplementäre Nukleotide sind, p eine Phosphatgruppe ist, z eine 3'-Blockierungsgruppe ist, n eine ganze Zahl zwischen 2 und 5, einschließlich, ist, q eine ganze Zahl von größer als oder gleich 8 ist und r eine ganze Zahl von größer als oder gleich 8 ist und gleich oder verschieden von q sein kann;

und wobei jeder Adaptor weiter eine oder mehrere:

(i) einer Nuklease-Erkennungsstelle einer Nuklease, deren Erkennungsstelle von ihrer Spaltstelle getrennt ist, im doppelsträngigen Teil des Adaptors, und

(ii) einer einzigartigen Oligonukleotid-Markierung, ausgewählt aus einer Vielzahl von Markierungen, welche eine Markierung für jede mögliche Sequenz des herausstehenden Strangs einschließt, wobei die Oligonukleotid-Markierungen Mitglieder eines minimal kreuzhybridisierenden Satzes von Oligonukleotiden sind, sodass sich die Sequenz jeden Mitglieds eines solchen Satzes von der Sequenz jeden anderen Mitglieds des Satzes um mindestens zwei Nukleotide unterscheidet,

einschließt.
Vielzahl von doppelsträngigen Nukleinsäure-Adaptoren, jeder mit einem 5'-herausstehenden Strang, wobei jede mögliche Sequenz des herausstehenden Strangs in der Vielzahl von Adaptoren dargestellt ist, und wobei jeder Adaptor die Formel:
aufweist, wobei N und N' komplementäre Nukleotide sind, p eine Phosphatgruppe ist, z eine 3'-Blockierungsgruppe ist, n eine ganze Zahl zwischen 2 und 5, einschließlich, ist, q eine ganze Zahl von größer als oder gleich 8 ist und r eine ganze Zahl von größer als oder gleich 8 ist und gleich oder verschieden von q sein kann;

und wobei jeder Adaptor weiter eine oder mehrere:

(i) einer Nuklease-Erkennungsstelle einer Nuklease, deren Erkennungsstelle von ihrer Spaltstelle getrennt ist, im doppelsträngigen Teil des Adaptors,

(ii) einer einzigartigen Oligonukleotid-Markierung, ausgewählt aus einer Vielzahl von Markierungen, welche eine Markierung für jede mögliche Sequenz des herausstehenden Strangs einschließt,

wobei die Oligonukleotid-Markierungen Mitglieder eines minimal kreuzhybridisierenden Satzes von Oligonukleotiden sind, sodass sich die Sequenz jeden Mitglieds eines solchen Satzes von der Sequenz jeden anderen Mitglieds des Satzes um mindestens zwei Nukleotide unterscheidet, und

(iii) einer an den obersten Strang des Adaptors gebundene Markierung einschließt.
Adaptor wie in Anspruch 10 oder Anspruch 11 dargestellt, wobei der Adaptor, im doppeltsträngigen Teil des Adaptors, eine Nuklease-Erkennungsstelle einer Nuklease einschließt, deren Erkennungstelle von der Spaltstelle getrennt ist. Adaptor nach Anspruch 10 oder Anspruch 11, wobei z eine Phosphatgruppe ist, q im Bereich zwischen 12 und 50 liegt und r im Bereich zwischen 12 und 50 liegt. Festphasenträger mit daran in räumlich getrennten Bereichen gebundenen gleichförmigen Populationen von im Wesentlichen identischen doppelsträngigen Polynukleotiden, wobei jedes Polynukleotid mit dem gleichen Ende an den Träger gebunden ist und jedes Polynukleotid einen dephosphorylierten 5'-hervorstehenden Strang am zum Träger distalen Ende aufweist. Träger nach Anspruch 14, wobei der Träger eine Oberfläche mit einer Vielzahl von räumlich getrennten Bereichen ist. Träger nach Anspruch 14, wobei der Träger eine Population von Mikroteilchen ist, wobei jedes Mikroteilchen ein räumlich getrennter Bereich ist. Träger nach Anspruch 14, wobei der hervorstehende Strang zwischen 2 und 5 Nukleotide lang ist. Träger nach Anspruch 14 oder Anspruch 17, wobei die im Wesentlichen identischen Polynukleotide im Wesentlichen identische cDNAs sind. Träger nach Anspruch 16, wobei das Mikroteilchen ein CPG-Mikroteilchen, ein GMA-Mikroteilchen oder ein Polystyrol-Mikroteilchen ist.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com