PatentDe  


Dokumentenidentifikation DE69636899T2 31.10.2007
EP-Veröffentlichungsnummer 0000815200
Titel WIRTSZELLE, DIE REDUZIERTE MENGEN EINER METALLOPROTEASE EXPRIMIERT UND METHODEN ZUR VERWENDUNG DIESER WIRTSZELLE ZUR PROTEINPRODUKTION
Anmelder Novozymes A/S, Bagsvaerd, DK
Erfinder LEHMBECK, Jan, DK-2880 Bagsvaerd, DK
Vertreter Patentanwälte Isenbruck Bösl Hörschler Wichmann Huhn, 81675 München
DE-Aktenzeichen 69636899
Vertragsstaaten AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 20.03.1996
EP-Aktenzeichen 969057686
WO-Anmeldetag 20.03.1996
PCT-Aktenzeichen PCT/DK96/00111
WO-Veröffentlichungsnummer 1996029391
WO-Veröffentlichungsdatum 26.09.1996
EP-Offenlegungsdatum 07.01.1998
EP date of grant 14.02.2007
Veröffentlichungstag im Patentblatt 31.10.2007
IPC-Hauptklasse C12N 1/19(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse C12N 15/81(2006.01)A, L, I, 20051017, B, H, EP   C12P 21/02(2006.01)A, L, I, 20051017, B, H, EP   
IPC additional class C12N 9/58  (2006.01)  A,  L,  N,  20051017,  B,  H,  EP

Beschreibung[de]
TECHNISCHES GEBIET

Die vorliegende Erfindung betrifft neuartige Wirtszellen und Verfahren zur Herstellung von Proteinen. Insbesondere betrifft die Erfindung eine Aspergillus-Wirtszelle, die verwendbar bei der Expression von heterologen Proteinen ist. Darüber hinaus betrifft die Erfindung ein Verfahren zur Herstellung eines heterologen Proteins, wobei das Verfahren die Kultivierung der Wirtszelle in einem geeigneten Wachstumsmedium gefolgt von Isolieren des gewünschten Proteins umfasst.

TECHNISCHER HINTERGRUND

Die Verwendung rekombinanter Wirtszellen zur Expression von heterologen Proteinen hat in den vergangenen Jahren die Herstellung großer Mengen kommerziell wertvoller Proteine, die auf anderem Wege lediglich durch Reinigung aus ihren natürlichen Quellen erhältlich waren, stark vereinfacht. Derzeit gibt es eine vielfältige Auswahl an Expressionssystemen, aus denen zur Herstellung eines jeglichen vorgegebenen Proteins ausgewählt werden kann, einschließlich eubakterieller und eukaryotischer Wirte. Die Auswahl eines geeigneten Expressionssystems hängt häufig nicht nur von der Fähigkeit der Wirtszelle ab, das Protein in einem aktiven Zustand in entsprechenden Ausbeuten zu produzieren, sondern auch zu einem großen Anteil von dem beabsichtigten Zweck des Proteins beeinflusst werden.

Ein Problem, dem häufig zu begegnen ist, ist der hohe Anteil an proteolytischen Enzymen, die von einer vorgegebenen Wirtszelle produziert werden oder in dem Kulturmedium vorhanden sind. Es wurde vorgeschlagen, dem Wirtsorganismus die Fähigkeit zu entziehen, spezifische proteolytische Verbindungen herstellen zu können. Beispielsweise beschreibt die internationale Patentanmeldung WO 90/00192 filamentöse Pilzwirte, die nicht in der Lage sind, die enzymatisch aktive Aspartatproteinase zu sekretieren. Aspergillus awamori, der defizient in einer Aspartatproteinase ist, wurde verwendet, um bovines Chymosin zu exprimieren, was zu einer um Faktor zwei gesteigerten Expression im Vergleich zu dem Stamm führte. EP 574 347 beschreibt Aspergillus-Wirte, welche bezüglich einer Serinprotease des subtilisin Typs fehlerhaft sind.

Metalloproteasen wurden aus einer Anzahl von eukaryotischen Quellen isoliert. Neutrale Metalloproteasen, d.h. Metalloproteasen, die eine optimale Aktivität bei neutralem pH haben, isoliert aus Aspergillus-Stämmen, sind ebenfalls bekannt. Neutrale Metalloproteasen sind in zwei Gruppen unterteilt worden, NpI und NpII [Sekine; Agric. Biol. Chem., 1972 36 207–216]. Kürzlich wurde die Nukleotidsequenz einer neutralen Metalloprotease II cDNA aus Aspergillus oryzae offenbart [Tatsumi H., Murakami S., Tsuji R.F., Ishida Y., Murakami K., Masaki A., Kawabe H., Arimura H., Nakano E. und Motal H.; Mol. Gen. Genet., 1991 228 97–103]. Die Nukleotidsequenz der neutralen Metalloprotease I cDNA aus Aspergillus oryzae ist noch nicht offenbartt worden.

Obwohl über Metalloproteasen berichtet worden ist, wurde ihre Rolle in Bezug auf die Verminderung der Stabilität dieser Produkte, die aus diesen Organismen erhalten worden waren, nie beschrieben.

ZUSAMMENFASSUNG DER ERFINDUNG

Im Rahmen der vorliegenden Erfindung wurde nun herausgefunden, dass neutrale Metalloproteasen des Aspergillus die Stabilität der Produkte, die von einer Zelle erhalten werden, signifikant reduzieren.

Dementsprechend stellt die vorliegende Erfindung eine Aspergillus-Wirtszelle zur Verfügung, die für die Expression eines heterologen Proteinprodukts nützlich ist, wobei die Zelle genetisch modifiziert wurde, um signifikant verminderte Mengen einer neutralen Metalloprotease von Aspergillus, NpII, zu exprimieren, die eine optimale proteolytische Aktivität im Bereich von pH 6–8, verglichen mit einer parentalen Zelle, aufweist, zur Verfügung.

Gemäß eines weiteren Gegenstandes stellt die Erfindung ein Verfahren zur Herstellung eines heterologen Proteinprodukts in einer Wirtszelle gemäß der Erfindung zur Verfügung, wobei das Verfahren das Einführen einer Nukleinsäuresequenz, die das Protein kodiert, in die Wirtszelle, Kultivieren der Wirtszelle in einem geeigneten Wachstumsmedium und Isolieren des heterologen Proteinprodukts, umfasst.

Mithilfe des erfindungsgemäßen Verfahrens wurde die proteolytische Aktivität, die von der Metalloprotease NpII herrührt, signifikant reduziert, wodurch die Stabilität des Proteins, welches mithilfe des Verfahrens erhalten wird, verbessert wird. Darüber hinaus kann das Protein, welches mittels des erfindungsgemäßen Verfahrens erhalten wird, als Precursorprotein, beispielsweise als Zymogen, ein Hybridprotein, ein Protein, das als Prosequenz oder Prä-Prosequenz erhalten wird, oder in nicht reifer Form, erhalten werden.

KURZE BESCHREIBUNG DER ABBILDUNGEN

Die vorliegende Erfindung wird durch Bezugnahme auf die beiliegenden Zeichnungen näher veranschaulicht, in denen:

1 eine Karte des Plasmids pSO2, von Beispiel 1 zeigt;

2 die Herstellung des Aspergillus oryzae-Stammes HowB101 aus Beispiel 1 zeigt;

3 die Herstellung des Plasmids pJa1218 aus Beispiel 4 zeigt und

4 eine Karte des Plasmids pToC56 aus Beispiel 3 zeigt.

DETAILLIERTE OFFENBARUNG DER ERFINDUNG Wirtszellen

Die vorliegende Erfindung stellt eine Aspergillus-Wirtszelle zur Verfügung, die für die Expression eines heterologen Proteinprodukts nützlich ist, wobei die Zelle genetisch modifiziert wurde, um signifikant verminderte Mengen einer neutralen Metalloprotease NpII zu exprimieren, die eine optimale proteolytische Aktivität im Bereich von pH 6–8, verglichen mit einer parentalen Zelle, aufweist.

Die parenterale Zelle bildet den Ursprung der Wirtszelle. Sie kann eine Wildtypzelle sein. Außerdem kann sie neben der verminderten Menge an neutralen Metalloproteasen in anderer Hinsicht genetisch verändert sein.

Um das gewünschte Protein zu produzieren, muss die erfindungsgemäße Wirtszelle offensichtlich strukturelle (beispielsweise Regionen, die die kodierende Nukleotidsequenzen umfassen) und regulatorische (das heisst Regionen, welche die Nukleinsäuresequenzen, die das heisst für die Transkription, Translation und Termination notwendig sind) genetische Regionen, die für die Expression des gewünschten Produktes notwendig sind, beinhalten. Die Natur derartiger struktureller und regulatorischer Regionen hängt stark von dem Produkt und der fraglichen Wirtszelle ab. Die genetische Ausgestaltung der erfindungsgemäßen Wirtszelle kann von dem Fachmann unter Verwendung von standardmäßigen rekombinanten DNA-Techniken zur Transformation oder Transfektion einer Wirtszelle ausgeführt werden [siehe beispielsweise Sambrook et al.; Molecular Cloning, Cold Spring Harbor, N.Y., 1989].

Bevorzugt wird die Wirtszelle mithilfe von Verfahren, die dem Fachmann zur Einführung eines geeigneten Klonierungsvehikels, das heisst eines Plasmids oder Vektors, der ein DNA-Fragment, welches das gewünschte Produkt umfasst, bekannt sind, modifiziert. Das Klonierungsvehikel kann in die Wirtszelle entweder als ein autonom replizierendes Plasmid oder in das Chromosom integriert eingeführt werden. Bevorzugt umfasst das Klonierungsvehikel eine oder mehrere strukturelle Regionen, die an eine oder mehrere geeignete regulatorische Regionen operativ verknüpft sind.

Die strukturellen Regionen sind Regionen, welche Nukleotidsequenzen, die das gewünschte Produkt kodieren, enthalten. Die regulatorischen Regionen umfassen Promotorregionen umfassend Transkriptions- und Translationskontrollsequenzen, Terminationsregionen umfassend Stoppsignale und Polyadenylierungsregionen. Der Promotor, das heisst eine Nukleotidsequenz, welche Transkriptionsaktivität in der Wirtszelle der Wahl aufweist, kann eine abgeleitet von einem Gen, welches ein extrazelluläres oder intrazelluläres Protein kodiert, bevorzugt ein Enzym, die beispielsweise eine Amylase, Glucoamylase, eine Protease, eine Lipase, eine Cellulase, eine Xylanase, eine Oxidoreduktase, eine Pektinase, eine Cutinase oder ein glykolytisches Enzym kodiert, sein. Beispiele von geeigneten Promotoren zur Transkription in einer Pilzwirtszelle sind Promotoren abgeleitet von den Genen, welche die Aspergillus oryzae-TAKA-Amylase, Aspergillus niger-neutrale &agr;-Amylase, Aspergillus niger-säurestabile &agr;-Amylase, Aspergillus niger oder Aspergillus awamsii-Glucoamylase (gluA), Aspergillus niger-Acetamidase, Aspergillus oryzae-alkalische Protease, Aspergillus oryzae-Triosephosphatatisomerase, Rhizopus meihei-Asparaginsäureproteinase und Rhizopus meihei-Lipase kodieren, abgeleitet sein. Bevorzugt sind die Aspergillus oryzae-TAKA-Amylase- und Aspergillus awamsii (gluA)-Promotoren.

Das Klonierungsvehikel kann ebenfalls einen Selektionsmarker umfassen, beispielsweise ein Gen, dessen Produkt einen Defekt in der Wirtszelle bewirkt, oder das Resistenz gegenüber Antibiotika, wie beispielsweise Ampicillin, Kanamycin, Chloramphenicol oder Tetracyclin-Resistenz verleiht. Beispiele von Aspergillus-Selektionsmarkern umfassen amdS, pyrG, argB, niaD und sC, ein Marker, welcher die Hygromycin-Resistenz auslöst. Bevorzugt zur Verwendung in einer Aspergillus-Wirtszelle sind die amdS- und pyrG-Marker des Aspergillus nidulans oder Aspergillus oryzae. Ein häufig verwendeter Säugetiermarker ist das Dihydrofolatreduktase-(DHFR-)-Gen. Darüber hinaus kann die Selektion ebenfalls mithilfe der Co-Transformation durchgeführt werden.

Die Verfahren, die verwendet wurden, um das erfindungsgemäße DNA-Konstrukt, den Promotor, Terminator und andere Elemente jeweils zu ligieren, und diese in geeignete Klonierungsvehikel, welche die Information, die notwendig zur Replikation ist, enthalten, sind den Fachleuten sehr gut bekannt [siehe beispielsweise Sambrook et al.; Molecular Cloning, Cold Spring Harbor, NY, 1989].

Die erfindungsgemäße Wirtszelle kann jegliche Aspergillus-Wirtszelle, die gewöhnlich zur Expression heterologer Proteine verwendet wird, sein. Gemäß einer bevorzugten Ausführungsform ist der Aspergillus-Pilz ein Stamm, ausgewählt aus der Gruppe bestehend aus Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus awamori, Aspergillus phoenicis, Aspergillus japonicus, Aspergillus foetus.

Produkte

Das gewünschte Endprodukt, das heisst das heterologe Protein exprimiert von der erfindungsgemäßen Wirtszelle, kann jegliches eubakterielle oder eukaryotische Protein sein.

Wie hierin definiert, ist ein „heterologes Proteinprodukt" ein Protein, welches in der Wirtszelle nicht nativ vorhanden ist, oder ein natives Protein, in das Modifikationen eingeführt wurden, um die native Sequenz zu verändern oder ein natives Protein, dessen Expression quantitativ verändert ist, als Ergebnis einer Veränderung der nativen regulatorischen Sequenz, welche zur Expression des nativen Proteins benötigt ist, wie beispielsweise eines Promotors, einer ribosomalen Bindestelle, etc., oder anderer Manipulation der Wirtszelle mittels rekombinanter DNA-Techniken.

Infolge der Abwesenheit der neutralen Metalloprotease kann das heterologe Protein, welches von der Wirtszelle exprimiert wird, ein Precursorprotein, das heisst ein Zymogen, ein Hybridprotein, ein Protein, welches als Prosequenz oder Prä-Prosequenz erhalten wird, oder in unreifer Form sein. Gemäß einer bevorzugten Ausführungsform ist das Produkt ein Enzym.

Gemäß einer spezifischeren Ausführungsform ist das Produkt ein eukaryotisches Enzym, wie beispielsweise Insulin, Wachstumshormon, Glucagon, Somatostatin, Interferon, PDGF, Faktor VII, Faktor VIII, Urokinase, EPO, Chymosin, Gewebeplasminogenaktivator oder Serumalbumin.

Gemäß einer weiteren bevorzugten Ausführungsform ist das Produkt ein Enzym von Pilz- oder Hefe- oder bakteriellem Ursprung.

Bevorzugt ist das Enzym ein Glucosidaseenzym, beispielsweise eine Amylase, insbesondere eine &agr;-Amylase (EC 3.2.1.1), eine &bgr;-Amylase (EC 3.2.1.2), eine Glucan-l,4-&agr;-glucosidase (EC 3.2.1.3), eine Cellulase (EC 3.2.1.4) eine Endo-1,3(4)-&bgr;-glucanase (EC 3.2.1.6), eine Endo-l,4-&bgr;-glucanase (EC 3.2.1.8), eine Polygalacturonase (EC 3.2.1.15), eine &agr;-Glucosidase (EC 3.2.1.20), eine &bgr;-Glucosidase (EC 3.2.1.21), eine &agr;-Galactosidase (EC 3.2.1.22), eine &bgr;-Galactosidase (EC 3.2.1.23), eine Xylan-endo-l,3-&bgr;-xylosidase (EC 3.2.1.32), eine Endo-l,3-&bgr;-glucanase (EC 3.2.1.39), eine Endo-l,3-&agr;-glucanase (EC 3.2.1.59), eine Endo-1,2,-&bgr;-glucanase (EC 3.2.1.71), eine Endo-l,6-&dgr;-glucanase (EC 3.2.1.75), eine Cellulose-1,4-&bgr;-cellobiosidase (EC 3.2.1.91, ebenfalls bekannt als Cellobiolhydrolasen).

Gemäß einer weiteren bevorzugten Ausführungsform ist das Enzym ein lipolytisches Enzym, insbesondere eine Lipase, eine Esterase, eine Phopholipase, oder eine Lysophospholipase.

In einer dritten bevorzugten Ausführungsform ist das Enzym eine Phytase, insbesondere eine 3-Phytase (EC 3.1.3.8) oder eine 6-Phytase (EC 3.1.3.26).

Gemäß einer vierten bevorzugten Ausführungsform ist das Enzym ein proteolytisches Enzym.

Gemäß einer fünften bevorzugten Ausführungsform ist das Enzym eine Oxidoreduktase, wie beispielsweise eine Peroxidase oder Laccase, eine Pektinase oder eine Cutinase.

Bevorzugte Hybridpolypeptide sind Prochymosin und Protrypsin-ähnliche Proteasen.

Metalloproteasen

Im Zusammenhang mit dieser Erfindung ist eine Metalloprotease ein proteolytisches Enzym, welches ein katalytisches Zinkmetallzentrum enthält, welches an der Hydrolyse des Peptidrückgrades beteiligt ist. Das aktive Zinkzentrum differenziert diese Proteasen von Calpainen, deren Aktivitäten von der Anwesenheit von Calcium abhängen. Der Nachweis einer Protease als eine Metalloprotease liegt im Verlust der proteolytischen Aktivität, infolge des Entfernens des Zinkzentrums. Das Zinkzentrum kann mittels 1,10-Phenanthrolin (1 mM) entfernt werden. Nach Titration mit Zn2+ (0,1–100 &mgr;M) ist die proteolytische Aktivität wiederhergestellt.

Gemäß einer bevorzugten Ausführungsform ist die Metalloprotease, die im Zusammenhang mit dieser Erfindung genannt wird, eine neutrale Metalloprotease, welche eine Metalloprotease ist, welche optimale proteolytische Aktivität im neutralen pH-Bereich, das heisst in dem Bereich von etwa pH 6–8, bevorzugt im Bereich von etwa 6,5-7,5, in etwa bei pH 7, hat.

Mehr bevorzugt ist die Metalloprotease, die im Zusammenhang mit dieser Erfindung genannt wird, eine neutrale Aspergillus-Metalloprotease der Gruppe NpII.

Genetische Veränderungen

Die erfindungsgemäße Wirtszelle, die genetisch verändert ist, um signifikant verringerte Mengen einer neutralen Metalloprotease zu exprimieren, kann unter Verwendung der standardmäßigen rekombinanten DNA-Technologien, die dem Fachmann bekannt sind, modifiziert sein. Die Gensequenz, die für die Produktion der Metalloprotease verantwortlich ist, kann inaktiviert oder komplett eliminiert sein.

Gemäß einer bevorzugten Ausführungsform ist die erfindungsgemäße Wirtszelle an den strukturellen oder regulatorischen Regionen, welche die Metalloprotease kodieren, genetisch verändert. Bekannte und nützliche Techniken umfassen, sind jedoch nicht beschränkt auf spezifische oder Zufallsmutagenese, PCR-generierte Mutagenese, ortsspezifische DNA-Deletion, -Insertion und/oder -Substitution, Genunterbrechungs- oder Genersatztechniken, Antisense-Techniken oder eine Kombination davon.

Die Mutagenese kann unter Verwendung eines geeigneten physikalischen oder chemischen Mutagenierungsagens durchgeführt werden. Beispiele für ein physikalisches oder chemisches Mutagenierungsagens, die für den Zweck geeignet sind, umfassen ultraviolette (UV-) Bestrahlung, Hydroxylamin, N-Methyl-N'-nitro-N-nitrosoguanidin (MNNG), O-Methylhydroxylamin, Salpetersäure, Ethylmethansulfonat (EMS), Natriumbisulfit, Ameisensäure und Nukleotidanaloge. Wenn derartige Agenzien verwendet werden, wird die Mutagenese typischerweise durch Inkubieren der Zelle, die mutageniert werden soll in Anwesenheit des gewählten Mutagenierungsagens unter geeigneten Bedingungen, dass die Mutagenese stattfinden kann, durchgeführt und es wird auf mutierte Zellen selektiert, die eine signifikant reduzierte Produktion von Metalloproteasen aufweisen. Die Veränderung kann ebenfalls durch Einführung, Substitution oder Entfernung von einem oder mehreren Nukleotide in der Metalloprotease kodierenden Sequenz oder eines regulatorischen Elements, welches für die Transkription oder Translation dieser benötigt wird, durchgeführt werden. Nukleotide können beispielsweise insertiert oder entfernt werden, so dass es zu der Einführung eines Stoppkodons, dem Entfernen des Startkodons oder einer Änderung in dem offenen Leserahmen kommt. Die Veränderung oder Inaktivierung der strukturellen Sequenz oder eines regulatorischen Elements kann mittels ortsspezifischer Mutagenese oder PCR-generierter Mutagenese in Übereinstimmung mit dem Fachmann bekannten Methoden durchgeführt werden. Obwohl die Veränderung prinzipiell in vivo, d.h. direkt in der Zelle, welche das Metalloproteinasegen trägt, durchgeführt werden kann, ist es zugleich bevorzugt, die Veränderung in vitro durchzuführen.

Ein geeigneter Weg, die Metalloproteaseproduktion einer gewählten Wirtszelle zu inaktivieren oder reduzieren, basiert auf den Prinzipien der Genunterbrechung. Dieses Verfahren umfasst die Verwendung einer DNA-Sequenz, welche mit dem endogenen Gen oder Genfragment, welches zerstört werden soll, korrespondiert. Diese DNA-Sequenz wird in vitro zu einem defekten Gen mutiert und in die Wirtszelle transformiert. Mittels homologer Rekombination ersetzt das defekte Gen das endogene Gen oder Genfragment. Es kann wünschenswert sein, dass das defekte Gen oder Genfragment einen Marker kodiert, der für die Selektion der Transformanten, in denen das Gen, welches die Metalloprotease kodiert, modifiziert oder zerstört wurde, verwendet werden kann.

Alternativ kann die Modifikation oder Inaktivierung der DNA-Sequenz unter Verwendung der etablierten Antisense-Techniken unter Verwendung einer zu der Metalloprotease kodierenden Sequenz komplementären Nukleotidsequenz durchgeführt werden.

Aufgrund der genetischen Veränderung exprimiert die erfindungsgemäße Wirtszelle signifikant verringerte Mengen an Metalloproteasen. Gemäß einer bevorzugten Ausführungsform ist die Menge der von der Wirtszelle exprimierten Metalloprotease um mehr als etwa 50 %, bevorzugt mehr als etwa 85 %, mehr bevorzugt mehr als etwa 90 %, am meisten bevorzugt mehr als etwa 95 % vermindert. Gemäß einer am meisten bevorzugten Ausführungsform ist das Produkt, welches von der Wirtszelle exprimiert wird, im Wesentlichen frei von jedweder Metalloproteaseaktivität.

Verfahren zur Herstellung der Proteine

Gemäß eines weiteren Aspekts stellt die Erfindung ein Verfahren zur Herstellung von Proteinen (das heisst Polypeptiden und/oder Proteinen) zur Verfügung, wobei das Verfahren umfasst: Kultivieren der erfindungsgemäßen Wirtszelle in einem geeigneten Wachstumsmedium, gefolgt von dem Isolieren des gewünschten Produktes.

Mit dem erfindungsgemäßen Verfahren ist die proteolytische Aktivität der neutralen Metalloprotease signifikant reduziert worden, wodurch die Stabilität des erhaltenen Produktes verbessert ist. Darüber hinaus kann aufgrund der Abwesenheit von Metalloproteasen das heterologe Protein, welches von der Wirtszelle exprimiert wird, als ein Precursorprotein, d.h. ein Zymogen, ein Hybridprotein, ein Protein, das als Prosequenz oder Prä-Prosequenz oder in unreifer Form erhalten wurde, erhalten werden.

Die Brühe oder das zur Kultivierung verwendete Medium kann jegliches konventionelle Medium sein, welches für das Wachstum der in Frage kommenden Wirtszelle geeignet ist, und kann nach den Prinzipien des Stands der Technik zusammengesetzt sein. Das Medium enthält bevorzugt Kohlenstoff- und Stickstoffquellen und andere anorganische Salze. Geeignete Medien, beispielsweise Minimal- oder komplexe Medien sind von kommerziellen Händlern erhältlich, oder können gemäß den veröffentlichten Rezepten, beispielsweise der American Type Culture Collection (ATCC)-Katalogen der Stämme, hergestellt werden.

Nach der Kultivierung wird das Protein mittels konventioneller Techniken zur Isolierung und Reinigung von Proteinen aus einer Kulturbrühe isoliert. Gut bekannte Reinigungsverfahren umfassen das Abtrennen der Zellen von dem Medium mittels Zentrifugation oder Filtration, Präzipitation der proteinösen Komponenten des Mediums mithilfe eines Salzes wie beispielsweise Ammoniumsulfat und chromatographische Verfahren wie beispielsweise Ionenaustauschchromatographie, Gelfiltrationschromatographie, Affinitätschromatographie, etc.

BEISPIELE

Die Erfindung wird nachfolgend unter Bezugnahme auf die nachfolgenden Beispiele, welche in keiner Weise den Schutzbereich der beanspruchten Erfindung limitieren sollen, näher erläutern.

Materialien und Methoden Stämme

  • Aspergillus oryzae IFO 4177, erhältlich von dem Institut für Fermentation, Osaka, 17–25 Juso Hammachi 2-Chome Yodogawa-Ku, Osaka, Japan.
  • Escherichia coli DH5&agr;, Hanahan D, J. Mol. Biol. 1983 166 557.

Gene

  • NpII, dessen Gen die neutrale Metalloprotease II kodiert.
  • pyrG: dessen Gen die Orotidin-5'-phosphatdecarboxylase, ein Enzym involviert in die Biosynthese des Uridins, kodiert.

Plasmide

  • pUC118: Yanish-Perron et al., 1985 Gene 33 103.
  • pSO2 : die Herstellung dieses Plasmids ist in Beispiel 1 beschrieben.
  • pJers4; ein Subklon von pSO2.
  • pSO5; die Herstellung dieses Plasmids aus pSO2 ist in Beispiel 1 beschrieben.
  • pJaL198; die Herstellung dieses Plasmids aus pJal198 ist in Beispiel 1 beschrieben.
  • pJaL218; die Herstellung dieses Plasmids aus pJal218 ist in Beispiel 2 beschrieben.
  • P3SR2; Kelly J M and Hynes M J, EMBO Journal 1985 4 475–479.
  • pToC90; ein Subklon von p3SR2.
  • pToC56; die Herstellung dieses Plasmids ist in EP 238,023 B beschrieben.
  • pCRTMII, erhältlich von Invitrogen Corporation, San Diego, CA, USA.

BEISPIEL 1 Klonierung der Aspergillus oryzae-neutralen Metalloprotease II (NpII) Aufbau des pJaL198

Aus der veröffentlichten cDNA-Nukleotidsequenz, welche die Aspergillus oryzae NpII-Sequenz kodiert [Tatsumi et al., Mol. Gen. Genet. 1991 228 97–103] wurden zwei Oligonukleotide konstruiert, so dass der kodierende Teil des NpII-Gens in einer PCR-Reaktion amplifiziert wurde.

Ein Primer (CTAGGATCCAAGGCATTTATGCGTGTCACTACTCTC, SEQ ID NR. 7) wurde hergestellt, so dass das 3'-Ende der Nukleotidsequenz mit dem N-terminalen Teil des NpII-Gens (unterstrichen) korrespondiert und dass das 5'-Ende einer erleichterten Klonierung dient (enthält eine BamHI-Restriktionsendonukleasestelle).

Ein Primer (CTACTCGAGTTAGCACTTGAGCTCGATAGC; SEQ ID NR. 8) wurde hergestellt, so das 3'-Ende der Nukleotidsequenz mit dem C-terminalen Teil des NpII-Gens (unterstrichen) korrespondiert und dass das 5'-Ende zum vereinfachten Klonieren geeignet ist (enthält eine XhoI-Restriktionsendonukleasestelle).

Genomische DNA aus Aspergillus oryzae IFO 4177 wurde als Templat in der PCR-Reaktion verwendet. Die Amplifizierungsreaktion wurde in 100 &mgr;l Volumina enthaltend 2,5 Einheiten Taq-Polymerase, 100 ng von genomischer Aspergillus oryzae-DNA, 50 mM KCl, 10 mM Tris-HCl, pH 8,0, 1,5 mM MgCl2, 250 nM von jedem dNTP und 100 pM von jedem der zwei vorstehend beschriebenen Primer durchgeführt.

Die Amplifizierung wurde in einem Perkin-Elmer Cetus DNA Terminal 480 durchgeführt und bestand aus einem 3-minütigen Zyklus bei 94 °C, gefolgt von 25 Zyklen von 1 Minute bei 94 °C, 30 Sekunden bei 55 °C und 1 Minute bei 72 °C. Die PCR-Reaktion lieferte ein DNA-Fragment von schätzungsweise 1,1 kb Länge. Dieses Fragment wurde mittels Gelelektrophorese isoliert, gereinigt und in den Vektor pCRTMII (Invitrogen Corporation) kloniert und unter Verwendung von Standardmethoden auf dem Gebiet der Molekularbiologie sequenziert. Das erhaltene Plasmid wurde pJaL198 genannt.

BEISPIEL 2 Genomische Unterbrechung der NpII Herstellung von JaL121

Um Stämme des Aspergillus oryzae, die spezifisch defizient in der Herstellung der NpII sind herzustellen, wurde eine Genaustauschstrategie, wie von Miller et al.; Mol. Cell. Biol., 1985 5 1714–1721 beschrieben, durchgeführt.

Klonierung des Aspergillus oryzae pyrG-Gens

Das Aspergillus oryzae-pyrG-Gen wurde mittels Kreuzhybridisierung mit dem Aspergillus niger pyrG-Gen kloniert [W. van Hartingsveldt et al.; Mol. Gen. Genet., 1987 206 71–75]. Eine Lambda-Bibliothek einer partiellen SauIIIA-verdauten Aspergillus oryzae-IFO-4177-DNA wurde bei geringer Stringenz mit einem 1 kb DNA-Fragment aus dem Aspergillus niger-pyrG-Gen-sondiert. DNA aus einem positiven Klon wurde in einen pUC118-Vektor subkloniert. Es wurde mittels Komplementation an einer Aspergillus niger-pyrG-Mutante aus 1 gezeigt, dass das resultierende Plasmid pSO2 das pyrG-Gen enthält.

Herstellung eines Aspergillus oryzae-pyrG-Minusstammes

Ein pyrG-Deletionsplasmid, pSO5, enthaltend etwa 1 kb pyrG-flankierender Sequenzen an jedem Ende wurde aus dem Plasmid pSO2 hergestellt. Der Stamm Aspergillus oryzae IFO 4177 wurde mit diesem Konstrukt transformiert und Transformanten wurden durch Resistenz gegenüber 5-Fluoroorotsäure selektiert, ein Phänotyp, der charakteristisch für pyrG-Mutanten ist. Mittels Southern-Analyse wurde gezeigt, dass eine Transformante, HowB101, die erwartete Deletion an der pyrG-Stelle hat. Als eine pyrG-Mutante benötigt HowB101 zum Wachstum Uridin. HowB101 kann mit dem Wildtyp pyrG-Gen transformiert werden, durch Selektion auf die Fähigkeit, ohne Uridin zu wachsen.

Die Schritte, welche bei der Herstellung des HowB101 involviert sind, sind in 2 gezeigt.

Herstellung des unterbrochenen Plasmids pJaL218

Das Plasmid pJaL198 wird mit BstEII verdaut und mit der Klenow-Polymerase behandelt, um glatte Enden zu erhalten. Das 4,9-kb-Fragment wurde mittels Gelelektrophorese isoliert und gereinigt. Dieses DNA-Fragment wurde daraufhin mit bakterieller alkalischer Phosphatase nach Herstellerangaben behandelt, um die 5'-Phosphatgruppen zu entfernen, Phenol extrahiert und präzipitiert.

Das Plasmid pJers4 wurde mit HindIII verdaut und mit Klenow-Polymerase behandelt, um glatte Enden zu erhalten. Das 1,8-kb-Fragment, welches das Aspergillus oryzae-pyrG-Gen kodiert, wurde mittels Gelelektrophorese isoliert und gereinigt.

Die zwei Fragmente wurden gemischt und ligiert. Nach Transformationen von E. coli DH5&agr; wurden die Kolonien, welche die korrekten Plasmide tragen, wurden durch Verdau der Miniplasmidpräparationen mittels Restriktionsenzymen identifiziert. Die Herstellung des pJaL218 ist in 3 gezeigt.

pJaL218 besteht aus dem pCRTMII-Vektor, welcher ein Fragment enthält, welcher das NpII-Gen trägt, flankiert von zwei EcoRI-Stellen, in denen das zentrale BstEII-Fragment durch ein 1,8-kb-DNA-Fragment, welches das Aspergillus oryzae-pyrG-Gen kodiert, ersetzt worden ist.

Transformation des Aspergillus oryzae

15 &mgr;g des Plasmids pJaL218 wurden komplett mittels EcoRI verdaut. Die Vollständigkeit des Verdaus wurde dadurch überprüft, indem ein Aliquot auf einem Gel aufgetrennt wurde. Die übrige DNA wurde phenolextrahiert, präzipitiert und in 10 &mgr;l sterilem Wasser resuspendiert.

Die Transformation des Aspergillus oryzae-HowB101-Wirtsstammes wurde mittels der Protoplastenmethode durchgeführt [Christensen et al.; Biotechnology 1988 6 1419–1422]. Typischerweise war das Aspergillus oryzae-Myzel in einer nährstoffreichen Brühe gewachsen. Das Myzel wurde von der Brühe mittels Filtration getrennt. NovozymeTM (erhältlich von Novo Nordisk A/S Dänemark) wurde dem Myzel in einem osmotisch stabilisierenden Puffer, 1,2 M MgSO4, Natriumphosphatpuffer pH 5,0 zugegeben. Die Suspension wurde für 60 Minuten bei 37 °C unter Schütteln inkubiert. Der Protoplast wurde durch ein Miracloth gefiltert, um myceliale Bruchstücke zu entfernen. Der Protoplast wurde geerntet und zweimal mit STC (1,2 M Sorbitol, 10 mM CaCl2, 10 mM Tris-HCl pH 7,5) gewaschen. Der Protoplast wurde schließlich in 200–1000 &mgr;l STC resuspendiert.

Zur Transformation wurden 5 &mgr;g DNA zu 100 &mgr;l Protoplastsuspension hinzugegeben. 200 &mgr;l PEG-Lösung (60 % PEG 4000, 10 mM CaCl2, 10 mM Tris-HCl pH 7,5) wurden zugegeben und die Mischung für 20 Minuten bei Raumtemperatur inkubiert. Der Protoplast wurde geerntet und zweimal mit 1,2 M Sorbitol gewaschen. Der Protoplast wurde schließlich in 200 &mgr;l 1,2 M Sorbitol resuspendiert, ausplattiert auf Selektionsplatten (Minimalmedium + 10 g/l Bacto-Agar (Difco), und bei 37 °C inkubiert.

Nach 3–4 Tagen Wachstum bei 37 °C erscheinen stabile Transformanten als energisch wachsende und sporenbildende Kolonien.

Identifikation der Genunterbrechungen

Von den stabilen Kolonien wurden einzelne Sporen auf frischen Minimalplatten ausgestrichen. Einzelne Kolonien wurden selektiert und erneut ausgestrichen, um reine Kulturen zu erhalten.

Dreiunddreißig Transformanten wurden mittels PCR gescreent, um zu sehen, ob das transformierte DNA-Fragment durch ein Double Overcross in das korrespondierende Gen auf dem Chromosom integriert worden ist. Die PCR-Reaktion und die genomische DNA von den Transformanten wurden wie vorstehend beschrieben durchgeführt.

Die verwendeten Primer waren CCCTTCTTTCCAAACCG (SEQ ID Nr. 9), welches sich am 5'-Ende der kodierenden Sequenz des NpII-Gens befindet und pyrG-5' (GGGTGAGCCACTGCCTC; SEQ ID Nr. 10), welche spezifisch für das pyrG-Gen ist. Ein Transformant enthielt das erwartete PCR-Produkt von 1,1 kb.

Durch Southern-Blots, in denen genomische DNA von dem Transformanten und von Aspergillus oryzae mit EcoRI verdaut, aufgetrennt mittels Agarosegelelektrophorese, überführt auf Immobilan-N-Membranfilter und sondiert mit dem 1,1-kb-EcoRI-Fragment von dem pJaL198 enthaltenden NpII-Gen wurde herausgefunden, dass die Wildtyp-Bande von 3,8 kb zu einer 10-kb-Bande in dem Transformanten verschoben war. Dieses beweist, dass die transformierte DNA in das NpII-Gen in multiplen Kopien integriert war. Der Stamm wurde JaL121 genannt.

BEISPIEL 3 Herstellung von Chymosin in JaL121

Der Aspergillus oryzae-Stamm JaL121 wurde mit dem Plasmid pToC56 (von 4) transformiert, welcher ein Pilzexpressionsplasmid für das Säugerenzym Chymosin ist, durch Cotransformation mit pToC90. Die Herstellung des Plasmids pToC56 ist in EP 98 993 A beschrieben.

Die Transformanten wurden durch Wachstum auf minimalem Medium, welches 10 mM Acetamid enthielt, selektiert und auf die Anwesenheit des pToC56 aufgrund der Fähigkeit, Chymosin herzustellen, gescreent. Eine Transformante wurde in Schüttelkolben für 4 Tage bei 30 °C in einem Medium, welches Maltodextrin, Sojamehl und Pepton enthielt, gezüchtet. Eine Transformante des pToC56 in Aspergillus oryzae IFO 4177 wurde gemeinsam mit der JaL121-Transformante kultiviert.

Täglich wurden Proben der Fermentationsbrühe gesammelt und SDS-Page und Western-Blot unterworfen. Die Blotmembran wurde mit Chymosin-spezifischem Kaninchen-Antikörper inkubiert, gefolgt von einem Ziege-Anti-Kaninchen-Antikörper, gekoppelt an Peroxidase.

Die Membranfärbung zeigte, dass am ersten und zweiten Tag der Fermentation die Überstände der Transformanten des Aspergillus oryzae IFO 4177 kleine Mengen von Chymosin oder Abbauprodukte davon enthielten. Später wurde gar kein Chymosin nachgewiesen. Im Gegensatz dazu enthielten die Transformanten des JaL121 zumindest das 10fache des vollständigen Chymosins. Die Menge an Chymosin in den Überständen stieg innerhalb der ersten zwei bis drei Tage an und blieb dann konstant.

SEQUENZPROTOKOLL


Anspruch[de]
Aspergillus-Wirtszelle, die für die Expression eines heterologen Proteinprodukts nützlich ist, wobei die Zelle genetisch modifiziert wurde, um signifikant verminderte Mengen einer neutralen Metalloprotease von Aspergillus, NpII, zu exprimieren, die eine optimale proteolytische Aktivität im Bereich von pH 6 bis 8, verglichen mit einer Mutterzelle, aufweist. Wirtszelle nach Anspruch 1, die ein Stamm ist, ausgewählt aus der Gruppe bestehend aus Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus awamori, Aspergillus phoenicis, Aspergillus japonicus, Aspergillus foetus. Wirtszelle nach einem der Ansprüche 1 bis 2, die an den strukturellen oder regulatorischen Regionen genetisch modifiziert wurde, die die Metalloprotease kodieren. Wirtszelle nach Anspruch 3, die durch spezifische Mutagenese oder Zufallsmutagenese, PCR-generierte Mutagenese, ortsspezifische DNA-Deletion, Insertion und/oder -Substitution, Genunterbrechungs- oder Genersatz-Techniken, Antisense-Techniken oder einer Kombination davon genetisch modifiziert wurde. Wirtszelle nach einem der Ansprüche 1 bis 4, wobei in der Zelle die Menge der exprimierten Metalloprotease um mehr als etwa 50 %, vorzugsweise um mehr als etwa 85 %, bevorzugter um mehr als etwa 90 %, am bevorzugtesten um mehr als etwa 90 % vermindert ist. Wirtszelle nach einem der Ansprüche 1 bis 4, wobei die Zelle im wesentlichen frei von jedweder Metalloprotease-Aktivität ist. Verfahren zur Herstellung eines heterologen Proteinproduktes in der Wirtszelle nach Anspruch 1, wobei das Verfahren umfasst:

(a) Einführen einer Nucleinsäuresequenz, die das Proteinprodukt kodiert, in die Wirtszelle,

(b) Kultivieren der Wirtszelle von Schritt (a) in einem geeigneten Wachstumsmedium und

(c) Isolieren des heterologen Proteinprodukts.
Verfahren nach Anspruch 7, wobei die Wirtszelle ein Stamm ist, ausgewählt aus der Gruppe bestehend aus Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus awamori, Aspergillus phoenicis, Aspergillus japonicus, Aspergillus foetus. Verfahren nach einem der Ansprüche 7 bis 8, wobei die Wirtszelle an den strukturellen oder regulatorischen Regionen genetisch modifiziert wurde, die die Metalloprotease kodieren. Verfahren nach Anspruch 9, wobei die Wirtszelle durch spezifische Mutagenese oder Zufallsmutagenese, PCR-generierte Mutagenese, ortsspezifische DNA-Deletion, Insertion und/oder -Substitution, Genunterbrechungs- oder Genersatz-Techniken, Antisense-Techniken oder einer Kombination davon genetisch modifiziert wurde. Verfahren nach einem der Ansprüche 7 bis 10, wobei die Menge der von der Wirtszelle exprimierten Metalloprotease um mehr als etwa 50 %, vorzugsweise um mehr als etwa 85 %, bevorzugter um mehr als etwa 90 %, am bevorzugtesten um mehr als etwa 90 % vermindert ist. Verfahren nach einem der Ansprüche 7 bis 10, wobei das von der Wirtszelle exprimierte Produkt im wesentliche frei von jedweder Metalloprotease-Aktivität ist. Verfahren nach einem der Ansprüche 7 bis 12, wobei das Proteinprodukt ein eukaryontisches Enzym ist, wie Insulin, Wachstumshormon, Glucagon, Somatostatin, Interferon, PDGF, Faktor VII, Faktor VIII, Urokinase, EPO, Chymosin, Gewebeplasminogenaktivator oder Serumalbumin. Verfahren nach einem der Ansprüche 7 bis 13, wobei das Proteinprodukt ein Protein pilzlichen Ursprungs ist. Verfahren nach Anspruch 14, wobei das Proteinprodukt ein Pilzenzym ist, insbesondere ein amylolytisches Enzym, wie eine alpha-Amylase, eine beta-Amylase, eine Glucoamylase, eine beta-Galactosidase, ein cellulytisches Enzym, ein lipolytisches Enzym, ein xylanolytisches Enzym, ein proteolytisches Enzym, eine Oxidoreduktase, wie eine Peroxidase oder eine Laccase, eine Pektinase oder eine Cutinase. Verfahren nach einem der Ansprüche 7 bis 15, wobei das Proteinprodukt ein Bakterienprotein ist. Verfahren nach Anspruch 16, wobei das Proteinprodukt ein Bakterienenzym ist, insbesondere ein amylolytisches Enzym, wie eine alpha-Amylase, eine beta-Amylase, eine Glucoamylase, eine beta-Galactosidase, ein cellulytisches Enzym, ein lipolytisches Enzym, ein xylanolytisches Enzym, ein proteolytisches Enzym, eine Oxidoreduktase, wie eine Peroxidase oder eine Laccase, eine Pektinase oder eine Cutinase. Verfahren nach einem der Ansprüche 7 bis 17, wobei das Proteinprodukt ein Precursorprotein ist, d.h. ein Zymogen, ein Hybridprotein, ein Protein, das als Pro-Sequenz oder Pre-Pro-Sequenz oder in unreifer Form erhalten wurde.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com