PatentDe  


Dokumentenidentifikation DE69636937T2 22.11.2007
EP-Veröffentlichungsnummer 0000883344
Titel DURCH TRANS-SPALTUNG ERHALTENE THERAPEUTISCHE MOLEKULE
Anmelder Intronn, Inc., Rockville, Md., US
Erfinder MITCHELL, Lloyd G., Bethesda, MD 20814-3956, US
Vertreter Kador & Partner, 80469 München
DE-Aktenzeichen 69636937
Vertragsstaaten AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 13.12.1996
EP-Aktenzeichen 969447606
WO-Anmeldetag 13.12.1996
PCT-Aktenzeichen PCT/US96/19419
WO-Veröffentlichungsnummer 1997022250
WO-Veröffentlichungsdatum 26.06.1997
EP-Offenlegungsdatum 16.12.1998
EP date of grant 28.02.2007
Veröffentlichungstag im Patentblatt 22.11.2007
IPC-Hauptklasse A01N 43/04(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse A61K 31/70(2006.01)A, L, I, 20051017, B, H, EP   C07H 21/02(2006.01)A, L, I, 20051017, B, H, EP   C07H 21/04(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/00(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/09(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/63(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/70(2006.01)A, L, I, 20051017, B, H, EP   C12N 15/74(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Hintergrund der Erfindung Bereich der Erfindung

Die vorliegende Erfindung stellt Nukleinsäuremoleküle für die Expression eines heterologen Gens in einer ausgewählten Untermenge von Zellen bereit. Die Nukleinsäuremoleküle der vorliegenden Erfindung nehmen an einer gezielten oder definierten Trans-Spleißreaktion mit prä-mRNA-Molekülen teil, die in den spezifischen Zielzellen einzigartig exprimiert sind. Die Nukleinsäuremoleküle der Erfindung können RNA, DNA oder andere Nukleinsäuremoleküle sein, wie Peptidnukleinsäuren (PNA). Die in vivo Trans-Spleißreaktion kann ein aktives therapeutisches Molekül bereitstellen, das in den Zielzellen exprimiert werden kann. Das Expressionsprodukt der mRNA kann ein Protein von therapeutischem Wert für die Zelle oder ein Toxin sein, welches die spezifischen Zellen abtötet. Alternativ kann die therapeutische RNA (th-RNA) oder ein anderes Molekül selbst eine therapeutische Funktion ausführen. In einer weiteren Ausführungsform der Erfindung werden mehrere Nukleinsäuremoleküle der Erfindung in Kombination verwendet, um eine therapeutische Wirkung zu erreichen.

Beschreibung des Stands der Technik

Eine der größten Herausforderungen bei der Therapie von vielen lebensbedrohlichen Krankheitszuständen wie Krebs und AIDS ist die Verabreichung eines therapeutischen Moleküls an die spezifischen Zielzellen, ohne dasselbe Molekül an andere Zellen in dem Organismus zu verabreichen. Frühere Anstrengungen dieses Problem zu lösen haben eine Gentherapie mit viralen Vektoren, die Zuführung von Medikamenten oder Toxinen, die mit monoklonalen Antikörpern konjugiert waren, und anderes beinhaltet. Bis heute sind diese Verfahren gänzlich unwirksam.

Das Verfahren der vorliegenden Erfindung benötigt nicht die Zuführung einzig zu den Zielzellen. Das Vorläufermolekül zu dem therapeutischen Molekül kann allen Zellen in dem Organismus zugeführt werden und durch alle Zellen in dem Organismus aufgenommen werden, die therapeutische mRNA wird in vivo aber nur in den spezifischen Zielzellen gebildet. Die Spezifität dieser Therapie beruht auf der einzigartigen (beschränkten) Transkription der Ziel-prä-mRNA in den Zielzellen. Die normalen Zellen (nicht Ziel) werden das Zielgen nicht transkribieren (oder nur minimal transkribieren). Deshalb findet die selektive Bildung des therapeutischen Moleküls nicht in normalen Zellen statt (oder nur zu einem sehr geringen Ausmaß).

Eine wichtige Weise, auf welche sich eukaryotische Zellen in demselben Organismus voneinander unterschieden, trotz der eigentlichen Identität ihres Gengehalts, ist, dass sie unterschiedliche Gene oder Teile jener Gene exprimieren. Diese Regulation der Genexpression arbeitet auf vielen Ebenen; klassische Untersuchungen der Genexpression zeigen die Kontrolle auf der Ebene der Transkription und Translation. Neuere Arbeiten weisen darauf hin, dass die Zellen die Fähigkeit haben die Genregulation durch die Genkopienzahl und die Spleißregulation zu regulieren.

Diese Gene, aufbewahrt als DNA-Sequenzen in den Chromosomen, werden in prä-mRNAs transkribiert, welche die kodierenden Regionen (Exons) und im Allgemeinen auch dazwischen liegende nicht kodierende Regionen (Introns) enthalten. Die prä-mRNA wird in dem Nukleus prozessiert, die Introns entfernt, zusammen mit irgendwelchen nicht gewollten Exons. Die verbleibenden Exons werden zusammen gespleißt, wobei eine mRNA gebildet wird, welche aus dem Nukleus in das Cytoplasma für die Translation in ein Protein durch die Ribosomen exportiert wird. Siehe zum Beispiel Moore, M.J., C.C. Query und P.A. Sharp, Cell, 77:805-815 (1994); Moore, M.J., C.C. Query und P.A. Sharp, The RNA World, Cold Spring Habour Laboratory Präss, 303-358, (1993).

Die Introns werden aus den prä-mRNAs in einem genauen Verfahren, genannt Spleißen, entfernt. Chow, L.T., R.E. Gelinas, T.R. Broker, R.J. Roberts, (1977) Cell, 12, 1-8; und Berget, S.M., C. Moore und P.A. Sharp (1977) Proc. Natl. Acad. Sci. USA 74, 3171-3175. Das prä-mRNA-Spleißen geschieht durch einem zweistufigen Mechanismus. In dem ersten Schritt wird die 5'-Spleißestelle geschnitten, was zu einem „freien" 5'-Exon und einem Lariatintermediat führt. (Moore, M.J. und P.A. Sharp, Nature, 365:364-368, 1993) Das 5'-Nukleotid des Introns (gewöhnlich Guanin) bildet das Lariatintermediat durch eine 2',5'-Phosphodiesterbindung mit dem Branchpoint-Nukleotid (gewöhnlich Adenosin) in dem Intron. In dem zweiten Schritt wird das 5'-Exon an das 3'-Exon mit der Freisetzung des Introns als das Lariatprodukt ligiert. Diese Schritte werden in einem Komplex aus kleinen nuklearen Ribonukleoproteinen und Proteinen katalysiert, der das Spleißeosom genannt wird (Moore et al., The RNA World, Cold Spring Habour Laboratory Press, 1993, 303-357).

Die Spleißreaktionsstellen für die Transesterfizierung sind durch Konsensussequenzen um die 5'- und 3'-Spleißstellen definiert. Die Konsensussequenz an der 5'-Spleißestelle ist AG/GURAGU (worin A = Adenosin, U = Uracil, G = Guanin, C = Cytosin, R = Purin und / = die Spleißestelle ist). Moore et al., The RNA World, Seite 308. Die unterstrichenen Nukleotide sind fast allen prä-mRNA-Introns gemeinsam, wobei es eine seltene Ausnahme ist, wenn GC anstelle von GU substituiert ist. Die 3'-Spleißestelle besteht aus drei separaten Sequenzelementen: dem Branchpoint oder der Branchstelle, einem Polypyrimidintrakt und einer 3'-Konsensussequenz. Diese Elemente definieren locker eine 3'-Spleißestellenregion, die 100 Nukleotide von dem stromaufwärts von der 3'-Spleißestelle gelegenen Intron umfassen kann. Die Branchpoint-Konsensussequenz in Säugetieren ist YNCUGAC (worin N = irgendein Nukleotid und Y = Pyrimidin ist). Das unterstrichene A ist die Stelle der Branch-Bildung (das BPA = Branchpointadenosin). Die 3'-Spleißkonsensussequenz ist YAG/G. Zwischen dem Branchpoint und der Spleißestelle findet man gewöhnlich einen Polypyrimidintrakt, der in den Säugetiersystemen für eine effiziente Branchpointverwendung und die Erkennung der 3'-Spleißstelle wichtig ist (Roscigno, R., M. Weiner und M.A. Garcia-Blanco, J. Biol. Chem. 268, 14, 11222-11229, 1993). Das erste YAG-Dinukleotid stromabwärts von dem Branchpoint und dem Polypyrimidintrakt ist die am häufigsten verwendete 3'-Spleißstelle. Smith, C.W.J., E.B. Porro, J.G. Patton und B. Nadal-Ginand (1989) Nature 342, 243-247.

Cis- versus trans-Spleißen

Gewöhnlich werden Exons in derselben prä-mRNA miteinander ligiert, cis-Spleißen, und nicht mit Exons in anderen prä-mRNAs, trans-Spleißen. Es ist jedoch möglich in vitro effizientes trans-Spleißen zu beobachten, indem zwei Hälften von einer prä-mRNA vergebunden werden, wobei komplementäre Sequenzen verwendet werden. Diese bilden stabile doppelsträngige Stämme über eine „Watson-Crick"-artige Basenpaarung. Konarska, M.M., R.A. Padget und P.A. Sharp (1985), Cell 42, 165-171. Dieser trans-Spleißtyp wurde in vivo nicht eindeutig beobachtet.

Der Mechanismus der Spleißstellenannäherung "über den Abstand" ist von dem Intron zwischen den Spleißstellen unabhängig, zum Beispiel bei dem trans-Spleißen, das gewöhnlich in Trypanosoma und Nematoden beobachtet wird. Sutton, R.E: und J.C. Boothroyd, Cell 47, 527-535 (1986); Murphy, W.J. et al., Cell 47, 517.525 (1986); Krause, M. und D. Hirsh, Cell 49, 753-761 (1987). In diesen sehr speziellen Fällen bildet die 5'-Spleißestelle, die kurze Leader(SL)-RNA enthält, einen small nuclear Ribonukleoprotein-Partikel (snRNP), der mit dem 3'-Ende des Introns in der größeren prä-mRNA interagiert (Bruzik, J.P. und J.A. Steitz, Cell 62, 889-899 (1990); Bruzik, J.P. und T. Maniatis, Nature 360, 692-695 (1992). Es wurde nicht beobachtet, dass dieser Spleißtyp natürlich in Säugetierzellen vorkommt.

Konarska et al. (1985), D. Solnik (1985) Cell 42, 157-164 wiesen trans-Spleißen in vitro unter Verwendung von RNAs nach, die nicht den SL RNAs ähnlich waren. Die RNA-RNA Sekundärstrukturen, welche die Vorläufer verbinden, erhöhten die Effizienz der trans-Spleißreaktion signifikant (von <1% auf 15-30% der wildtyp cis-Spleißeffizienz).

Komplementäre RNA- oder DNA-Sequenzen können spezifisch mit einzigartige RNA- oder DNA-Zielsequenzen basenpaaren. Die Bindungsspezifität wird durch die Sequenz beeinflusst, die Länge der komplementären Region und von irgendwelchen Sekundärstrukturen an der Bindungsstelle. Um eine Bindungsspezifität zu erhalten wird eine einzigartige Sequenz als das Ziel ausgewählt. Es wurde eine Kettenlänge von 17 Nukleotiden als ausreichend berechnet, um eine Bindungsspezifität zu erhalten, das heißt das statistische einmalige Auftreten einer einzigartigen Polynukleotidziel in dem humanen haploiden Genom von 3 × 109 Basenpaaren. M. Smith, Methods of DNA and RNA Sequencing, ed. S.M. Weissman, Praeger, New York, NY, USA, S. 39 (1983). Die Duplexstabilität ist von der Länge der komplentären Sequenzen, die länger als 200 Nukleotide sind, unabhängig [Steiner, R.F. und Beers, R.J. Jr. (1986)]. In Polynucleotides, (Elsevier, Amsterdam). Längere komplementäre Sequenzen erhöhen die Stabilität der Duplex, aber sehr lange Regionen können mit mehreren mRNAs über Basenpaarung interagieren, welche nur 5-10 durchgehende Basen mit einbeziehen, was folglich deren Spezifität verringert. Die komplementären Sequenzen können nicht bindende RNA- oder DNA-Sequenzen oder andere Nukleinsäureanalogons oder chemische Gruppen an entweder ihren 5'- und/oder 3'-Enden haben. Die Bindung kann auch über andere Mechanismen erreicht werden, zum Beispiel durch die Bildung einer Trippelhelix und Protein-Nukleinsäureinteraktionen, wie jene zwischen Genpromotoren und DNA. Beispiele für gewebespezifische Promotoren schließen den Immunglobulinpromotor ein, der von Brinster et al., Nature, 306:332-336 (1983) beschrieben wurde, und den Insulinpromotor, der von Bucchini et al., PNAS, 83:2511-2515 (1986) beschrieben wurde. Es können andere Mittel zur Bindung verwendet werden, welchen Fachleuten auf dem Gebiet bekannt sind.

Sehr potent sind Toxine wie das Diphterietoxin (DT), Ricin, das Pseudomonastoxin, das Shigatoxin und das Choleratoxin. Ein einziges Molekül DT kann eine Zelle durch eine enzymatische Wirkung in dem Cytosol töten. Yamaizumi, M., E. Mekada, T. Uchida und Y. Oxada, Cell 15, 245-250 (1978). Diese Toxine scheinen eine ähnliche Basisstruktur zu haben, bestehend aus einer A- und einer B-Untereinheit, worin die B-Untereinheit an die Zelloberfläche bindet und die Translokation des A-Untereinheit in die Zelle erleichtert, und die A-Untereinheit besitzt die enzymatische Toxinaktivität. Collier, R. und J. Kondel, Biol. Chem. 246, 1496-1503 (1971; und Gill, D. und A. Pappenheimer, J. Biol. Chem. 246, 1492-1495 (1971). Die A-Untereinheit des DTs (DT-A) katalysiert den Transfer von ADP-Ribose von NAD auf eine ungewöhnliche Aminosäure (Diphthamid) in dem Elongationsfaktor 2. Honjo, T., Y. Nishizuka und O. Hayaishi, J. Biol. Chem. 243, 3553-3555 (1968); und Gill, D., A. Pappenheimer, R. Brown und J. Kurnick, J. of Experimental Medicine 129, 1-21 (1969). Eine solche Bindung stoppt die Proteinsynthese in der Zelle und für diese Zelle letal. Es gibt eine Vielzahl von therapeutischen Strategien, die versuchen die DT-A innerhalb ausgewählter Zellen zu exprimieren oder es dorthin zu liefern, einschließlich der transkriptionellen Regulation der DT-A-Genexpression. (Robinson, D.F., T.H. Maxwell, Hum. Gene Ther., 6(2), 137-145, 1995; Cook D.R. et al., Cancer Biother., 9(2), 131-141, 1994; Curiel, T.J. et al., Hum Gene Ther., 4(6), 741-747, 1993).

Bruzik und Maniatis, Proc. Natl. Acad. Sci. USA 92: 7056-7059, Juli 1995, beschreiben das trans-Spleißen von normalen cis-gespleißten Fragmenten von Drosophila melanogaster in Zellkernextrakten von HeLa (Säugetier) Zellen, wobei die Spleißmaschinerie von diesen Zellnuklei verwendet wurde.

Zusammenfassung der Erfindung

Die vorliegende Erfindung stellt ein Nukleinsäuremolekül bereit, das für die Verwendung beim trans-Spleißen einer Ziel-prä-mRNA geeignet ist, die innerhalb einer Zielzelle exprimiert ist und die durch nukleare Spleißbestandteile innerhalb der Zielzelle erkannt werden kann, wobei die Nukleinsäure umfasst:

  • a) ein oder mehrere Zielbindungsdomänen, die die Bindung des Nukleinsäuremoleküls an die Ziel-prä-mRNA steuern;
  • b) (1) eine 3'-Spleißregion, die einen Branchpoint, einen Pyrimidintrakt und eine 3'-Spleißstelle umfasst;
  • c) eine Spacerregion, die die 3'-Spleißregion beziehungsweise 5'-Spleißstelle von der Zielbindungsdomäne trennt; und
  • d) eine Nukleinsäuresequenz, die zu der Ziel-prä-mRNA trans-gespleißt wird.

Die Erfindung stellt auch ein Nukleinsäuremolekül für die Verwendung bei der Erkennung durch zelluläre nukleäre Spleißbestandteile bereit, um eine chimäre RNA herzustellen, die therapeutisch nützlich ist oder als Marker dient.

Das Nukleinsäuremolekül der vorliegenden Erfindung ermöglicht die kontrollierte Expression eines heterologen Genprodukts in einer gewünschten Zielzelle, indem eine einzigartige mRNA durch einen trans-Spleißmechanismus gebildet wird. Die einzigartige mRNA hat eine der folgenden Funktionen: sie kodiert für ein Protein, das eine therapeutische Wirkung hat, sie tötet selektiv Zielzellen ab, sie dient als ein Marker oder sie stellt eine neuartiges Genprodukt bereit, das normalerweise nicht in der Zielzelle vorhanden ist.

In einer Ausführungsform ist die RNA, DNA oder das Nukleotidanalog, welches für das trans-Spleißen verwendet wird, eines, dessen Expressionsprodukt nach dem trans-Spleißen zum Zelltod führt (zum Beispiel wird die Expression von einem Molekül der Diphterietoxinuntereinheit A ein humane Zelle töten). In einer weiteren Ausführungsform wird das Expressionsprodukt von der Zelle sekretiert. In einer weiteren Ausführungsform führt die therapeutische RNA selbst eine gewünschte Funktion in der Zelle aus.

Kurze Beschreibung der Zeichnungen

Die 1A, 1B und 1C zeigen die Struktur von prä-therapeutischen Molekülen (PTMs oder prä-th-RNAs) der Erfindung. Diese Strukturen haben 5 Hauptmerkmale:

(a) ZIELBINDUNGSDOMÄNENREGION:

Eine oder zwei Bindungsdomänen von wenigsten 15 bis 30 (bis zu mehreren hundert) Nukleotiden, welche komplementär und in anti-sense Orientierung zu der Zielregion der ausgewählten prä-mRNA sind (eine zweite Bindungsregion kann an dem 3'-Ende des Moleküls lokalisiert sein). Andere Bindungsdomänen können in den PTM umfasst sein. Die Bindungsdomänen mit Merkmalen verbessert sein wie der Fähigkeit, Stellen, die benötigt werden, um stromabwärts gelegene Exons in der Ziel-mRNA zu spleißen, abzudecken oder zu blockieren, wie das Branchpointadenosin, die Spleißosombindungsstellen, den Polypyrimidintrakt oder die Spleißstellen.

(b) 3'-SPLEISSREGION UND/ODER 5'-SPLEISSSTELLE:

Die 3'-Spleißregion umfasst einen Branchpoint, einen Polypyrimidintrakt und einen 3'-Spleißstelle.

(c) SPACERREGION

Eine Spacerregion, um die Spleißstelle der therapeutischen RNA von der Zielbindungsdomäne zu trennen. Die Splacerregion kann Merkmale wie Stopcodons, welche jegliche Translation einer ungespleißten therapeutischen RNA blockieren würden, und Sequenzen haben, die das Spleißen zu dem Ziel steigern.

Es kann eine „Sicherheit" für das prä-therpeutische Molekül (PTM) in den Spacer, in der Bindungsdomäne oder sonst wo in dem PTM umfasst sein (1-8). Dies ist eine Region des PTMs, welche die Elemente der 3'- und/oder 5'-Spleißstelle des PTMs durch relativ schwache komplementäre Basenpaarung abdeckt, wobei sie ein nicht spezifisches trans-Speißen verhindert. Nach der Hybridisierung der Bindung/Zielteil(e) des PTM ist die 3'-Spleißstelle ungedeckt und wird vollständig aktiv (siehe 1-C).

Die „Sicherheit" besteht aus einem oder mehreren komplemtären Abschnitten der cis-Sequenz (oder kann ein zweiter, separater Nukleisäurestrang sein), der schwach an eine oder beide Seiten von dem Branchpoint, dem Pyrimidinabschnitt und/oder der 3'Spleißstelle (Spleißelemente) des PTMs bindet oder könnte an Teile der Spleißelemente selbst binden. Diese „Sicherheits"-Bindung hindert die Spleißelemente daran aktiv zu sein (das heißt blockiert die U2 snRNP oder andere Spleißfaktoren sich an die PTM-Spleißstellenerkennungselemente anzulagern). Die Bindung der „Sicherheit" kann durch die Bindung der Zielbindungsregion von dem PTM an die Ziel-prä-mRNA unterbrochen werden, wodurch folglich die PTM-Spleißelemente exponiert und aktiviert werden (was diese für das trans-Spleißen zu der Ziel-prä-mRNA verfügbar macht).

(d) THERAPEUTISCHES GEN:

Ein oder mehrere therapeutische Gene, wie das Diphtherietoxin, welches (welche) in die Ziel-mRNA gespleißt werden soll (sollen) und welches (welche) anschließend exprimiert werden kann (können), wobei eine therapeutische Wirkung hervorgebracht wird, wie der Zelltod (ein therapeutisches Gen kann eines sein, das eine Funktion von klinischer Nützlichkeit liefert, zum Beispiel die Wiederherstellung einer fehlenden Funktion, die Wirkung als ein Marker oder das Abtöten von nicht gewollten Zellen); und optional

(e) SEQUENZEN, DIE DAS SPLEISSEN UND DIE TRANSLOKATION MODULIEREN:

Es können zusätzliche Merkmale zu dem Molekül nach (oder vor) dem Toxingen zugefügt werden, wie Polyadenylierungsignale oder 5'-Spleißsequenzen, um das Spleißen zu verbessern, zusätzliche Bindungsregionen, „Sicherheits"-selbstkomplementäre Regionen, zusätzliche Spleißstellen oder Schutzgruppen, um die Stabilität des Moleküls anzupassen (Vorbeugung vor Abbau).

2 zeigt die Bindung der prä-therpeutischen RNA und das trans-Spleißen

2a) Das cis-Spleißprodukt von der A-B-prä-mRNA in die A-B-mRNA, was für die Zelle der normale Weg ist, um anschließend das Protein A-B zu exprimieren.

2b) Ein prä-th-RNA-Molekül, welches durch komplementäre Basenpaarung an eine A-B-prä-mRNA gebunden hat. In diesem Beispiel blockiert die Bindungsregion das cis-Branchpointadenosin und der 5'-Überhang kann teilweise mit dem cis-Pyrimidinabschnitt interferieren. Dies stört das cis-Spleißen von Exon B und präsentiert das prä-th-RNA-Toxingen als einen Kandidaten für das trans-Spleißen zu Exon A.

2c) Ein trans-gespleißtes Produkt der A-B-pä-mRNA und einer prä-th-RNA. Das Exon A ist mit einem Toxingen verbunden, welches nun zu einem voll funktionsfähigen heterologen therapeutischen RNA-Molekül (th-RNA) exprimiert werden kann. Die Translation dieser mRNA veranlasst die exprimierende Zelle zu sterben.

3 zeigt die Karte und die Sequenz des Diphtherietoxins. Die kodierende Region für die Untereinheit A reicht von den Nukelotiden 312-890.

4 zeigt die Konstruktion der prä-therapeutischen Moleküle der Erfindung.

5 zeigt die Karte und die Sequenz von beta-HCG.

Die 6A und B zeigen die Ergebnisse der trans-Spleißreaktion. Die 6A zeigt ein Agarosegel der RT-PCR-Produkte und die 6B zeigt die Nukleotidsequenz des trans-gespleißten Produkts.

7 zeigt die Ergebnisse des Transfektionstoxiditätsassays von Beispiel 5.

Detaillierte Beschreibung der Erfindung

Wie oben angegeben, bezieht sich die vorliegende Erfindung auf die Verwendung von Ziel-prä-messenger-RNA(prä-mRNA)-trans-Spleißen als ein Mittel zur Herstellung eines therapeutischen Moleküls in der Zelle. Das therapeutische Molekül kann selbst eine gewünschte Funktion bereitstellen oder kann ein Genprodukt in dem spezifischen Zelltyp herstellen. Die Genprodukte können von irgendeinem Gen sein, einschließlich von Genen, die einen klinischen Nutzen haben, zum Beispiel therapeutische oder Markergene, und Toxine. In einer Ausführungsform der Erfindung ist das eingebrachte Gen ein Toxingen, wonach die Expression von einem Molekül für die Zelle, die die Ziel-prä-mRNA enthält, letal ist.

In einer Ausführungsform ist die Erfindung auf ein Verfahren zur Herstellung einer spezifischen mRNA gerichtet, um die Expression eines therapeutischen Toxingens innerhalb der ausgewählten Zellpopulation zu verursachen, wodurch jene spezifischen Zellen zerstört werden. Die Zielzellen können jene umfassen, sind aber nicht darauf beschränkt, die mit viralen oder anderen infektiösen Mitteln infiziert sind, benigne oder maligne Neoplasmen oder Bestandteile des Immunsystems, welche mit Autoimmunerkrankungen oder Gewebeabstoßung verbunden sind. Eine Spezifität wird durch die Modifikation der Bindungsdomäne des PTMs, um an das Ziel zu binden, erreicht.

Die Schritte, die eine Ausführungsform von dem Verfahren der vorliegenden Erfindung umfassen, sind:

  • i) Einbringung eine Vorläufermoleküls in den Nukleus der Zellen, welches Molekül irgendeine Form haben kann, die von einem Fachmann auf dem Gebiet verwendet wird, ein therapeutisches RNA-Molekül (oder ein DNA-Vektor, der in RNA oder ein synthetisches Analogon transkribiert wird), wobei die Vorläufer-therapeutische-RNA (prä-th-RNA) eine Bindungsregion, die durch verschiedene Mechanismen an die Ziel-prä-mRNA bindet, eine Spleißstelle und ein therapeutisches Gen enthält und Polyadenylierungssigenale, Enhancer oder andere Modulierungssequenzelemente enthalten kann [siehe 1, Teil A, B und C];
  • ii) trans-Spleißen des Vorläufer-therapeutische-RNA-Moleküls mit einer Ziel-prä-mRNA, um eine translatierbare therapeutische mRNA zu bilden [siehe 2b]; und
  • iii) Expression (Translation) der trans-gespeißten therapeutischen mRNA innerhalb der Zielzelle(n) [siehe 2c].

Die Zielzellen können irgendwelche Zellen sein, von denen bekannt ist, dass sie eine einzigartige Population an prä-mRNAs exprimieren, wobei diese prä-mRNAs als Substrate für die trans-Spleißreaktion verwendet werden können. Die einzigartige Population kann 1 einziger Typ RNA sein oder mehrere, welche, als eine Gruppe, nicht zusammen in irgendeinem anderen Zelltyp exprimiert werden. Die Vorläufer-therapeutische-RNA enthält Bindungsregionen, die für die Ziel-prä-mRNA spezifisch ist.

Das prä-therapeutische Molekül kann an die Zellen durch irgendein Zuführungsverfahren verabreicht werden, zum Beispiel viral vermittelt, Elektroporation, Mirkoinjektion, Kalziumphosphat-vermittelte Transfektion, Liposomen, Cytofectine oder direkt. Das prä-therapeutische Molekül kann in Mengen verabreicht werden, die wirksam sind, um die gewünschte Menge des therapeutischen Moleküls selbst herzustellen. Die genaue verabreichte Menge wird abhängig von den Details des Zuführungssystems variieren. Die wirksame Menge wird auch abhängig davon variieren, ob das therapeutische Molekül eine fehlende Funktion (wie bei der Therapie einer genetischen Erkrankung), den Zelltod (wie bei der Krebstherapie) oder die Zellregulation (welche bei verschieden Erkrankungstypen verwendet werden kann) unterstützt. Die wirksame Menge kann von 0,001 pg oder sogar weniger bis 1,0 g Nukleinsäure/kg Körpergewicht des Patienten reichen.

Ein therapeutisches Molekül kann eines sein, dass irgendeine klinisch nützliche Funktion bereitstellt, zum Beispiel die Wiederherstellung einer fehlenden Funktion, die Wirkung als ein Marker oder das Abtöten nicht gewollter Zellen.

In einer Ausführungsform ist das prä-therapeutische RNA-Molekül eine nicht translatierbare einzelsträngige RNA mit vier Hauptmerkmalen: 1) Ein oder zwei Bindungsdomänen mit wenigstens 15 bis 30 Nukleotiden (und bis zu mehreren hundert Nukleotiden oder mehr), welche zu der Zielregion der einzigartigen prä-mRNA komplementär und in antisense Orientierung sind. Dieses gewährt die Spezifität der Bindung und verankert die prä-therapeutische RNA in großer Nähe, so dass die spleißosomale Prozessierungsmaschinerie des Nukleus sie in die Ziel-prä-mRNA trans-speißen kann. Die Bindungsdomänen können mit Merkmalen verstärkt sein, wie der Fähigkeit Stellen abzudecken oder zu blockieren, die für das cis-Speißen der stromabwärts gelegenen Exons in der Ziel-prä-mRNA benötigt werden, wie das Branchpointadenosin, die Spleißosombindungsstellen, der Polypyrimidindtrakt oder die authentischen 3'- und 5'-Speißstellen. 2) Eine Spacerregion, um die prä-therapeutische RNA-Spleißstelle mit dem Ziel abzugleichen. Die Spacerregion kann Merkmale wie Stopkodons, die irgendeine Translation einer nicht gespleißten prä-therapeutischen RNA blockieren würden, und Sequenzen enthalten, die das Speißen zum Ziel verbessern. Der Spacer dient auch dazu die Bindungsdomäne von der Spleißstelle zu trennen (und kann eine „Sicherheits"-Domäne enthalten). 3) Eine 3'-Spleißstelle. 4) Ein oder mehrere therapeutische Gene, wie das Diphtherietoxin, welches in die Ziel-mRNA gespleißt und anschließend exprimiert wird (werden), wobei eine therapeutische Wirkung hergestellt wird, wie der Zelltod, welche wünschenswert ist, wenn ein bösartiger Tumor behandelt wird. Es können nach dem Toxingen (offener Leseramen) wenn nötig zusätzliche Merkmale dem Molekül beigefügt werden, wie Polyadenylierungssignale oder 5'-Spleißsequenzen, um das Speißen und die Schritte, die zur Translation und Expression führen, zu verbessern. In einer Ausführungsform der Erfindung, worin die gespleißte RNA selbst das therapeutische Molekül ist, kann es kein therapeutisches Gen geben, sondern eher eine RNA mit der gewünschten Wirkung. Das trans-Spleißen kann durch irgendeinen bekannten Mechanismus vermittelt werden (Gruppe I, Gruppe II oder Spleißosom).

Die vorliegende Erfindung hat eine enorme klinische Anwendung bei der Behandlung von Krebs, HIV/AIDS oder anderen ernsten viralen Infektionen, Autoimmunfehlfunktionen und anderen pathologischen Konditionen, bei welchen die Veränderung oder die Eliminierung eines spezifischen Zelltyps von Nutzen sein würde. Beispiele dafür schließen eine benigne Prostatahypertrophie und andere prä-maligne Konditionen ein. Zusätzlich kann sie verwendet werden, um vererbte genetische Fehlfunktionen zu behandeln, wie Morbus Gaucher, wo die Expression einer kleinen Menge des fehlenden oder mutierten Genprodukts einen normalen Phänotyp herstellt.

In einer weiteren Ausführungsform ist das PTM eine nicht translatierbare einzelsträngige RNA mit den oben genannten Merkmalen: 1) Ein oder mehrere Bindungsdomänen; 2) Spacerregion; 3) Eine 5'-Spleißstelle und 4) Ein oder mehrere therapeutische Gene, und es können zusätzliche Sequenzen dort sein, die zusätzliche Merkmale verleihen (wie in den anderen Beispiel erwähnt). Das trans-Spleißen in dieser Erfindung ist spleißosomvermittelt; im Gegensatz zu dem von Gruppe I-Introns, welche Ribozyme verwenden, wie in WO 92/13089 und 92/13090.

Maximierung des trans-Speißens

  • 1. Die prä-th-RNAs sind so konstruiert, dass sie 5' und 3' von dem Branchpointandenosin binden und komplementär dazu sind und können oder können nicht das Branchpointadenosin enthalten (blockieren es). Die erlaubt die optimale Lokalisierung der antisense Bindungsdomäne.
  • 2. Die PTMs sind mit oder ohne das Branchpointadenosin in der prä-th-RNA hergestellt, um zu bestimmen, ob die Einbeziehung des BPAs zu nicht selektivem Spleißen führt (in Nichtziel-mRNA's).
  • 3. Die PTMs sind mit oder ohne Stopkodons oder andere Elemente in der Region zwischen der Bindungsdomäne und der Spleißstelle hergestellt, um zu bestimmen, ob solche Elemente die Expression von ungespleißter prä-th-RNA völlig verhindern.
  • 4. Die PTMs sind mit oder ohne ein starkes Polyadenylierungssignal oder stromabwärts Enhancer oder 5'-Spleißelemente, stromabwärts von dem Toxingen, hergestellt, um zu bestimmen, ob diese Elemente das trans-Spleißen fördern.
  • 5. Die PTMs sind mit oder ohne eine zweite antisense Bindungsdomäne stromabwärts von dem Toxingen hergestellt, um zu bestimmen, ob ein solches Element die Bindung an das 3'-Zielexon fördert und die Extension begünstigt, um die authentische cis-3'-Spleißstelle zu blockieren (U5-und/oder U1-Bindungsstellen). Die PTMs können auch so hergestellt werden, dass sie ein zweites trans-Spleißen für die Expression des trans-gespleißten Produkts benötigen.
  • 6. Ferner sind Elemente wie eine 3'-Haarnadelstruktur, zirkularisierte RNA, eine Nukleotidbasenmodifikation oder ein synthetisches Analog in die Konstrukte inkorporiert, um die nukleare Lokalisation und die Inkorporation in das Spleißosom und die intrazelluläre Stabilität zu fördern oder zu erleichtern.
  • 7. Das therapeutische Endkonstrukt muss von der äußeren Zellmembran angeliefert werden und in den Nukleus übergehen, um in das Spleißosom der Ziel-prä-mRNA inkorporiert zu werden, oder es muss von der Zelle selbst aus einem Vorläufermolekül (DNA-Vektor, RNA-Virus, ect.) hergestellt werden.

Einbringungssysteme

Die vorliegende Erfindung kann irgendein bekanntes Zuführungssystem verwenden, das für andere Genbehandlungs- oder Antisenseverfahren entwickelt wurde. Die prä-therapeutische RNA muss hergestellt, verpackt und für die Zellinkorporation getestet werden. Die chemische Synthese der vollängen prä-th-RNA ist derzeitig nicht durchführbar, weil die chemische Synthese auf etwa 100 Nukleotide beschränkt ist, könnte aber möglich sein. Die vollängen prä-th-RNA wird von PCR-amplifizierten Templates (unter Verwendung von high fidelity Enzymen) oder von geklonter DNA mit einem inkorporierten geeigneten Promotor transkribiert. Es gibt auch RNA-Amplifikationsverfahren wie die Q-&bgr;-Amplifikation, welche verwendet werden können. Die gespleißte th-RNA wird gereinigt und mittels Sequenzierung getestet oder durch die Fähigkeit das Ziel trans-zuspleißen und ein Toxin oder einen Marker zu produzieren in einem in vitro System gestestet.

Liposomen, Elektroporation und Cytofektionen sind Verfahren RNA direkt in die Zellen einzuführen. Sie werden weit verbreitet in antisense RNA-Einbringungsprotokollen verwendet. Es können auch virale Einbringungssysteme verwendet werden; obwohl sie im Wachstum und der Manipulation teurer sind und von der Öffentlichkeit möglicherweise nicht bereitwillig akzeptiert werden. Virale Vektoren mit einer transienten Expression, so wie Adenoviren und adenoassoziierte Viren, die nicht in das Genom integrieren, sind möglicherweise weniger problematisch. Es können auch Nukleisäurepolymere eingebracht werden, indem sie an die leeren Hüllen von replikationsunfähigen Viren angehängt werden. Cook, D. R. et al. Cancer Biother. 9(2), 131-141 (1994).

Beispiel 1: Auswahl des therapeutischen Gens

Ein therapeutisches Gen ist irgendein Gen, das irgendeine neuartige Funktion bereitstellt, einschließlich klinischer Nützlichkeit, zum Beispiel die Wiederherstellung einer fehlenden Funktion, die Wirkung als ein Marker oder das Abtöten ungewollter Zellen. Gene für die Wiederherstellung fehlender Funktionen können Gene sein, die für Genprodukte kodieren, die in bekannten genetischen Erkrankungen fehlen oder verändert sind. Markergene können Gene sein, die die Expression von spezifischen heterologen Proteinen oder Peptiden hervorrufen, die verwendet werden können, um Zellen zu identifizieren oder darzustellen. Gene für das Abtöten von Zellen können einfach Toxine sein oder andere Gene, die irgendeine Funktion bereitstellen, die die Empfindlichkeit der Zellen gegenüber anschließenden Behandlungen erhöhen, wie einer Bestrahlung oder Chemotherapie.

Das Diphtherietoxin ist ein gutes Beispiel für ein einfaches Toxin. Das native DT ist aus einer A- und einer B-Untereinheit zusammengesetzt. Die Diphtherietoxinuntereinheit A enthält die enzymatische Toxinaktivität und wird wirken, wenn sie in humanen Zellen exprimiert wird oder in humane Zellen eingebracht wird. Die B-Untereinheit wird für die Transmembranbewegung in die humanen Zellen benötigt. Die A-Untereinheit kann nicht in intakte Zellen selbst eindringen. Alleine hat die Untereinheit A eine sehr geringe Toxizität, weil sie den Lipidbilayer der Zellemebran ohne die B-Untereinheit nicht passieren kann. Donovon, J. M. Simon und M. Montal, J. Bio. Chem. 260, 8817-8823 (1985). Die A-Untereinheit kann in mehreren Konformationen vorhanden sein. Das Gen für die Diphtherietoxinuntereinheit A hat eine Länge grade unter 600 nt. Greenfield, L., M. Bjorn, G. Horn, D. Fong, G. Buck, R. Collier und D. Kaplan, Proc. Natl. Acad. Sci. USA 80 6853-6857 (1993) siehe 3. Das DT-A-Peptid kann mit angehängten heterologen Peptidsequenzen aktiv sein. Leckett, B. und R. J. Germinario, Cytotechnology 10(2), 125-136 (1992). Als eine zusätzliche Sicherheitsmaßnahme ist eine Immunisierung gegen in die extrazelluläre Umgebung freigesetztes DT-A möglich. Barbieri, J. T., D. Armellini, J. Molkentin und R. Rappuoli, Infect. Immun. 60(12) 5071-5077 (1992). Es gibt eine Vielzahl von anderen bekannten Toxinen, die in der vorliegenden Erfindung verwendet werden können.

Beispiel 2: Konstruktion von prä-therapeutischen Molekülen

Es wird ein in vitro Modell verwendet, um die Parameter von dem prä-therapeutischen Molekül und der Ziel-mRNA für das effizienteste trans-Spleißen zu bestimmen.

1. Demonstration des trans-Spleißens: experimentell

Es werden prä-th-RNA-Moleküle (PTMs) (siehe 4 und Legende), die komplementäre antisense Bindungsdomänen zu der prä-mRNA enthalten (welche das Branchpointadenosin (BPA) des Ziels umfasst; dadurch wird das Spleißen des cis-Downstreamexons blockiert), verschiedene Spacerregionen, die ein exponiertes BPA enthalten, eine 3'-Spleißstelle und ein Markergen (Diphtheritoxinuntereinheit A-(DTA)) zu einem in vitro System zugegeben, das alle nukleären Spleißbestandteile und eine Ziel-prä-mRNA (beta-HCG) enthält, siehe 5. Das trans-Spleißen wird durch eine reverse Transkription Polymersekettenreaktion (RT-PCR) demonstriert, wobei ein Primer verwendet wird, der zu dem 5'-Exon 1 des beta-HCG komplementär ist, und ein zweiter (reverser) Primer, der zu dem Markergen (DTA) komplementär ist. Die PCR-Produkte wurden sequenziert, um das richtige trans-Spleißprodukt von dem stromaufwärts 5'-Exon und dem Markergen nachzuweisen.

Die 6-A zeigt, dass das PTM + Spacer (PTM 2) wesentlich mehr trans-gespleißtes HGC/DTA-Produkt nach 60 min produzierte als PTM 1 (PTM +) oder PTM 4 (TB + Spacer), und nach 90 min Reaktion in einer HeLa Kernextrakt-Spleißingreaktion fünffach mehr trans-gespleißtes HCG/DTA als PTM 1 oder PTM 4 herstellte. PTM 1 und PTM 4 stellten nach 90 Minuten Inkubation annäherungsweise gleiche Mengen an trans-gespleißtem Produkt her. Dieses Experiment zeigt, dass eine 18 nt Bindungsregion signifikant die Spezifität des trans-Speißens erhöht, wenn sie in Verbindung mit einer Spacerregion zwischen der Bindungsdomäne und der Branchstelle verwendet wird. Das Fehlen von einem gesteigerten trans-Spleißen von PTM 1 über PTM 3 (Daten nicht gezeigt) oder PTM 4 ist auf Grund der Nähe der Bindungsdomäne zu dem Branchpoint in dem PTM 1, wo die Bindung an des Zielgen den Zugang der Spleißfaktoren zu dem angrenzenden Branchpoint blockiert, weil es nur 6 nt gibt, die die Stellen voneinander trennen. Die kleine Menge beobachtetes Nichtziel-trans-Spleißen zwischen der beta-HCG prä-mRNA und PTM 3 oder PTM 4 war nicht erwartet, weil die PTM-Konstrukte 1-4 unter Verwendung der Hefekonsensus-Branchstelle (UACUAAC) hergestellt wurden, welche eine größere Aktivität hat, als der verhältnismäßig schwächere Säugetierkonsensus, YNVURAC (wo das A die Stelle der Branchbildung ist, V = Pyrimidin, N = irgendein Nukleotid und R = Purin). Zusätzlich enthalten die PTM-Konstrukte 1-4 einen sehr starken Pyrimidintrakt. Zusammen führt diese Primidintrakt-Brachstellen-Kombination zu PTMs mit einer großen Neigung Spleißfaktoren zu binden, wie U2 AF und U2 snRNP, und zu sehr wirkungsvollem Spleißen. Darüber hinaus sind die Konzentrationen der Ziel-beta-HCG-prä-mRNA und prä-therapeutischen Moleküle in diesem Experiment supraphysiologisch, was die Wahrscheinlichkeit für Nichtziel(tethered)-trans-Spleißen.

PTM 5 und PTM 6 wurden hergestellt, um den Pyrimidintrakt und die 3'-Spleißstelle zu entfernen, um zu zeigen, dass die Verbindung von einem PTM mit dem Exon 1 des beta-HCG auf Grund des trans-Spleißens ist. PTM 7 wurde hergestellt, um nur die 3'-AG-Spleißstelle zu entfernen. Patterson B. und Guthrie C. Cell 64: 181-7 (1991). PTM 5-7 werden in transfektierten Gewebekulturexperimenten getestet, weil die Spezifität in intakten Zellen für die therapeutische Anwendung relevanter ist.

Das experimentelle Modellintron ist in einen Abschnitt der Adenovirus 2 major late promotor Leader 1 und Leader 2 Spleißeinheit kloniert, die eine 5'-Spleißstelle, einen Branchpoint, einen Pyrimidintrakt und eine 3'-Spließstelle enthält. Diese Sequenz ist in einen Expressionsvektor wie pcDNA3,1 (Invitrogen Corp.) mit einem stromaufwärtsgelegenen T7-RNA-Promotor (Stratagene) kloniert, sodass die RNA der Spleißeinheit transkribiert unter Verwendung des T7 RNA-Polymerse werden kann. Die Nukleotid(DNA)-Sequenz von einem solchen Insert ist:

Schlüssel:

  • * = 5'-Spleißstelle; CATACT .. = Zielregion für die Bindung; BPA = Branchpointadenosin; # = Py-Trakt; ** = 3'-Spleißstelle

Der 3'-Terminus des Modellintrons enthält eine Markersequenz wie den Sp6-Promoter oder exprimierbare Peptidselektionsmarker, sodass ein ordentlich gespleißtes Produkt durch elektrophoretische Auftrennung als eine kürzere mRNA-Sequenz als das ungespleißte T7-Transkript nachweisbar ist. Das gespleißte Produkt ist auch mittels PCR-Amplifikation unter Verwendung von Primern für die T7- und Sp6-Sequenzen nachweisbar (oder von geeigneten Primern für den verwendeten Marker).

Es sind mehrere Regionen der prä-therapeutischen RNA-Moleküle hinsichtlich der Fähigkeit variiert und getestet worden spezifisch trans-zuspleißen und die Häufigkeit des trans-Spleißens zu bestimmen.

  • a) Bindungsdomäne – Abzielen auf den Pyrimidintrakt und den Branchpoint:

    CATACTTATCCTGGGCCCTTTT = ZIEL-Sequenz des Adenovirus 2 major late Promotors in 5'- nach 3'-Orientierung

    3'-TTTTCCCGGGTCCTATTCATAC-5' Zielsequenz in reverser Orientierung

Modell-prä-th-RNA-Molekül

Schlüssel:

  • AAAAGG .. = Zielregion für die Bindung; +++++ = Spacerregion; BPA = Branchpointadenosin; # = Py-Trakt; ** = 3'-Spleißstelle; ACCCAG ... = HSV-Proteinmarker; CACCAC ... = Histidinproteinmarker; ! = Stopkodon

Die Einbeziehung eines Histidinproteinmarkers berücksichtigt den Nachweis, wobei eine Metallchelatchromatographie verwendet wird, und die Einbeziehung eines HSV-Proteinmarker den Nachweis unter Verwendung von monoklonalen Antikörpern. Diese Reagenzien sind von Novagen, Inc. erhältlich.

  • b) Es werden zusätzliche Modell-prä-therapeutischen RNA-Moleküle hergestellt, welche zu den oben genannten ähnlich sind, mit unterschiedlichen komplementären Bindungsregionen, die verschoben sind, um entweder weiter 5' oder 3' in dem Zielmolekül zu binden, um sicherzustellen, dass auf die optimale Region abgezielt/blockiert wird, und die trans-Spleißreaktion zu steigern. Andere Sequenzelemente, die das Spleißen modulieren, werden zugegeben, um die trans-Spleißeffizienz zu steigern oder zu vermindern.

Beispiel 3: In vitro Spleißreaktion

Diese DNA-Sequenzen wurden in Expressionsplasmide und Wirte kloniert. Die Sequenzen wurden durch Sanger Didesoxy-DNA-Sequenzierung verifiziert. Die RNAs werden von Plasmid-DNA oder PCR-amplifizierten Templates hergestellt und transkribiert, wobei die T7-RNA-Polymerse verwendet wird. Entweder wird das Ziel oder die prä-th-RNA in der Anwesenheit von &agr;32P-UTP synthetisiert. Die vollängen prä-rRNAs und Ziele werden mittel Gelelektrophorese gereinigt. Jaminson, S.F., A. Crow und M. A. Garcia-Blanco, Mol. Cell Biol. 12, 4279-4287 (1992).

Es wurden unter Verwendung des Verfahrens von Dignam, J. D. et al., (Nucl. Acid Res., 11, 1475-1487, 1983), bezogen von Promega, Kernextrakte hergestellt. Die in vitro Spleißassays wurden wie bei Garcia-Blanco, M. A., S. F. Jamison. P. A Sharp hergestellt (Genes and Dev., 3, 1874-1886, 1989). Die Spleißreaktionen werden über verschiedene Zeiträume inkubiert. Nach Beendigung werden die Reaktionsprodukte mittels Gelelektrophorese auf Polyacrylamidgelen getrennt. Die Spleißkomplexe werden auf nicht denaturierenden Acrylamidgelen elektrophoretisch aufgetrennt und durch Autoradiographie visualisiert. Die in vitro Spleißprodukte werden auf denturierenden Acrylamidgelen analysiert. Jamison et al., Mol. Cell Biol. 12, 4279-4287 (1992).

Die Spleißprodukte werde durch reverse Transkription PCR (RT-PCR) in getrennten Reaktionen analysiert, wobei Primer verwendet werden, die für entweder das native cis-gespleißte Produkt oder die das hybride trans-gespleißte Produkt spezifisch sind, wobei der 5'-Primer zu dem Ziel-mRNA 5'-Exon und der 3'-Primer zu dem trans-gespleißten Marker- oder therapeutische Gen komplementär ist. Derselbe 5'-Primer wurde verwendet, um das cis- und trans-gespleißte Produkt nachzuweisen. Es gibt ein erhöhtes trans-Spleißen, welches durch die Spezifität der Bindungsdomäne verliehen wird. (Siehe Gel, 6A).

Die gespleißten Produkte können auch unter bestimmten Bedingungen, das heißt, wenn die trans-Spleißrate hoch genug ist, um eine ausreichende Konzentrationen des Markerproteins für den Nachweis herzustellen, in einem zellfreien Translationssystem exprimiert werden, wobei das trans-gespleißte Produkt durch Westernblot oder Proteinsequenzierung nachweisbar ist.

Beispiel 4: Kompetitive Spleißreaktion in vitro

Dieses Beispiel ist mit dem Beispiel 3 identisch, mit der Ausnahme, dass es eine Mischung aus prä-mRNA-Molekülen mit nur einer beschränkten Menge von der Ziel-prä-mRNA enthält. Dies erlaubt die Demonstration der trans-Spleißreaktion in der Anwesenheit von einer wahrscheinlich bevorzugten cis-Spleißreaktion. Es wird eine RT-PCR verwendet, um die Spezifität des trans-Spleißens zwischen der Ziel-prä-mRNA und der prä-th-RNA in der Anwesenheit von kompetitierenden Nichtziel-prä-mRNAs zu bestimmen. Es werden zusätzliche RT-PCR-Amplifikationen durchgeführt, um mögliche zufällige trans-Spleißereignisse nachzuweisen, wobei ein Primer für die Markersequenz und Primer, die für die Nichtziel-prä-mRNAs spezifisch sind, verwendet werden.

Beispiel 5: trans-Spleißreaktion in humanen Lungenkrebskulturzellen

Es wurde ein Zellkulturmodell eines humanen Lungenkrebs verwendet, um zu zeigen, dass das therapeutische Entfernen (Abtöten) von Zielzellen, die ein einzigartiges Gen exprimieren (prä-mRNA) bewerkstelligt wird, indem die prä-therapeutischen Toxinmoleküle der Erfindung verwendet werden. Siehe 7. Es werden Gemischtzellexperimente verwendet, um zu zeigen, dass nur die Zielzellen eliminiert werden. Es wurden erfolgreiche prä-th-RNA-Konstrukte, die während den in vitro Experimenten identifiziert wurden, entsprechend für die Verwendung in den Zellkulturexperimenten modifiziert. Die Experimente laufen derzeit, um die die Spezifität für die Zelltötung zu verbessern, wie die Hinzufügung einer „Sicherheit".

Vorläufige Untersuchungen legen nahe, dass die erste Generation von PTMs eine hohe Rate von Nichtziel(promisken)-trans-Spleißen haben. Dies war kein unerwartetes Ergebnis, weil die erste Generation von PTMs konstruiert war die Spleißeffizienz zu maximieren. Es wurden mehrere Modifikationen versucht, um die Spezifität zu verbessern. Diese schließen ein:

  • 1. Hinzufügen einer „Sicherheit", um einige oder alle Spleißelemente des PTMs abzudecken.
  • 2. Veränderung der Sequenzen des Branchpoints und des Pyrimidintrakts, sodass sie weniger wirkungsvolle Spleißelemente sind.
  • 3. Veränderung des 3'-Endes von dem PTM, sodass es kein Polyadenylierungssignal enthält, es aber in der Lage ist eine zweite trans-Spleißreaktion zu durchlaufen, wobei es als die 5'-Donorspleißstelle zu der 3'-Spleißstelle des terminalen Exons auf dem beta-HCG wirkt, wodurch es das Polyadenylierungssignal erhält, das für den Export in das Cytoplasma und die Translation des chimären therapeutischen Proteins benötigt wird.
  • 4. Klonierung des PTMs in einen induzierbaren Expressionsvektor, wo die Menge an transkribiertem PTM reguliert werden kann (vielleicht ist trans-Spleißen ein häufiges Ereignis).

Beispiel 6: trans-Spleißreaktion in humanen Zervixkarzinomzellinien

Die Konstrukte werden hinsichtlich der Stabilität und der Fähigkeit an eine spezifische Stelle zu binden und um zu gewährleisten optimiert, dass das prä-therapeutische Molekül hergestellt werden kann in, transportiert werden kann zu und/oder zu der Stelle in der Zelle gebracht werden kann, wo Spleißen verlangt wird. Vorläufige Untersuchungen wurden gemacht, wobei eukaryotische Expressionsplasmide verwendet wurden, die das prä-th-RNA-Konstrukt innerhalb des Nukleus herstellen, sodass eine spezifische Bindung, gezieltes trans-Spleißen und die Stabilität die Konstruktionsziele für die anfänglichen prä-therapeutischen Moleküle sind. Es kann der Einfachheit halber oder um die Konzentration der PTMs in der Zelle zu regulieren ein Vektor verwendet werden, der einen induzierbaren Promotor enthält. Die Induktion der prä-therapeutischen RNA wird durch die Einführung einer einfachen nicht toxischen Chemikale in das Medium erreicht. Zum Beispiel induziert IPTG die Transkription des Inserts in pOP13 CAT (Stratagene). Ein zusätzlicher selektierbarer Marker wie eine Neomycinresistenz kann auch mit umfasst werden; mit einem solchen Marker werden unter selektiven Wachstumsbedingungen nur Zellen überleben, die den Vektor aufgenommen haben.

Andere mögliche Erkrankungsmodelle mit einzigartigen Genzielen schließen ein: eine humane Zervixkarzinomzellinie, die das Papillomavirus E6- und E7-Protein exprimieren, eine Prostatazellinie, die ein prostataspezifisches Antigen exprimiert, eine humane hepatische Karzinomzellinie, die das CEA-Protein exprimiert, oder andere Zellinien, die ein gewebespezifisches Genprodukt exprimieren (Pankreas, Leber, Brust, Kolon. Melanom) oder ein mit einem bösartigen Tumor assoziiertes Gen wie HCG (humanes Choriongonadotropin), Leukämie mit einem c-abl Fusionsgenprodukt t(9a34;22q11) oder andere chromosomale Translokationsfukionsgene produzieren.

Ein Pappilomavirusmodell kann als nächstes getestet werden. Die Behandlung einer Zervixdysplasie und von Zervixkrebs sind wichtige klinische Probleme. Dieses Modell besitzt die Fähigkeit die Wirksamkeit gegen sowohl einen Krebs als auch eine virale Infektion zu zeigen. Frauen, die mit den Serotypen 16 und 18 des Papillomavirus infiziert sind, die die E6- und E7-Gene exprimieren, haben ein hohes Risiko Zervixkarzinome zu entwickeln.

Die anfängliche Arbeit wird an einer Zellinie gemacht, die mit einem selektierbaren Expressionsplasmid transfektiert ist (so wie die Fähigkeit in der Anwesenheit von einem normalerweise toxischen Antibiotikum zu wachsen, wie eine Hygromycinresistenz, die durch das Plasmid pREP4 verliehen wird (erhältlich von Stratagene), in welches ein zusammenhängende Region eines Papillomavirus Typ 18 kloniert ist, die E6 und E7 enthält, und eine Spleißregion, die eine 5'-Spleißstelle, eine BP, einen Pyrimidintrakt und eine 3'-Spleißstelle für das Ziel (Plasmid 1) enthält.

Demonstration des trans-Spleißens: Die oben genannte Zellinie wird mit einem zweiten Expressionsplasmid (Plasmid 2), das einen unterschiedlichen selektierbaren Marker wie eine G418(Neomycin)-Resistenz, wie sie durch pcDNA I Neo (Stratagene) bereitgestellt wird, und einer Expressionskassette transfektiert, die für eine prä-therapeutische RNA kodiert, hergestellt durch das Expressionsplasmid 1. Wie zuvor hat das prä-th-RNA-Molekül eine antisense Bindungsdomäne, welche das BPA der Ziel-prä-mRNA blockieren kann, eine Spacerregion, einen Branchpoint, einen Pyrimidintrakt, eine 3'-Spleißstelle und ein Marker- oder Toxingen und Spleißmodulationssequenzen. In dem Fall, dass das trans-gespleißte Gen ein Toxingen ist, wird nicht erwartet, dass diese Zellen für sehr lange überleben werden. Das trans-Spleißen wird durch die Expression eines Markerproteins (in dem Fall von einem Markergen) oder eines Toxins demonstriert. Das Toxin kann durch einen Antikörper nachweisbar sein oder es kann die Anwesenheit einer hybrid-mRNA kann durch RT-PCR nachgewiesen werden.

Die transfizierten Zellen wurden mittels eines Wachstumshemmungsassays entsprechend dem Verfahren von El-Deiry, et al, untersucht (Cell 75, 817-825, 1993). Die Zellen wurden mit einem Expressionsplasmid transfektiert. Es werden Kolonien auf der Basis von Wachstum in der Anwesenheit von G418 ausgewählt. Die Zellen wurden vermehrt, in drei Gruppen geteilt und mit Plasmiden tranfektiert, die enthielten: a) eine zielbindende prä-th-RNA mit einem authentischen Toxingen (PTM2), b) eine prä-th-RNA mit einem mutierten oder antisenseorientierten Toxingen (PTM8), c) kein Insert (pc3.1 Vektorkontrolle) oder d) ein nicht zielbindendes (nicht homologes) PTM, PTM4. Die Wachstumshemmung wird als eine Reduktion in der Zahl der gebildeten antibiotikumresistenten Kolonien gemessen. CMV(Cytomegalovirus)-basierte Vektoren erlauben eine konstitutive Expression mit hohen Expressionsleveln des transfektierten Gens in den Zielzellen. Die Ergebnisse sind in der 7 gezeigt. Es kann ein umgekehrtes Experiment durchgeführt werden, ausgehend von Zellen, die als erstes mit dem Plasmid 2 und mit intakten oder mutierten Zielplasmiden (Plasmid 1) transfektiert sind.

Kurze Beschreibung der Doppeltransfektionsexperimente:

Die Zellen werden in Petrischalen ausplattiert und mit einer festen Menge von Plasmid 1 (Ziel mit Hygromycinresistenz), gewöhnlich 2 &mgr;g DNA, und mit verschiedenen Konzentrationen von Plasmid 2 (welches die prä-th-RNA und die G418-Resistenz enthält) transfektiert. Die Selektion auf Kolonien erfolgte durch die Inkubation in G418 und/der Hygromycin für 3-4 Wochen. Die Kolonien werden mit Methylenblau gefärbt und gezählt.

Assayergebnisse – theoretisch:

  • 1. Kontrolle (keine Transfektion – keine Kolonien
  • 2. Kontrolle (2 &mgr;g Plasmid 1) – 200-500 Kolonien
  • 3. Kontrolle (2 &mgr;g Plasmid 2 ohne Toxingen [entweder deletiert oder mutiert], und 2 &mgr;g Plasmid 1) – 200-500 Kolonien
  • 4. 2 &mgr;g Plasmid 1 und 2 &mgr;g Plasmid 2 – 20-50 Kolonien
  • 5. 2 &mgr;g Plasmid 1 und 20 &mgr;g Plasmid 2 – 2-5 Kolonien

Schlußfolgerung: Plasmid 2, welches das funktionale Toxingen in dem prä-th-RNA-Molekül enthält, hemmt das Wachstum von diesen Zellen.

Kurze Beschreibung von einem alternativen Transfektionsexperiment:

Die Zellen werden in Petrischalen ausplattiert und mit einer festen Menge von Plasmid 2 (welches die prä-th-RNA und die G418-Resistenz enthält) mit verschiedenen Konzentrationen transfektiert. Die Selektion auf resistente Kolonien erfolgte durch die Inkubation in G418 und/oder Hygromycin für 3-4 Wochen. Die Kolonien werden mit Methylenblau gefärbt und gezählt.

Assayergebnisse – theoretisch:

  • 1. Kontrolle (keine Transfektion – keine Kolonien
  • 2. Kontrolle (4 &mgr;g Plasmid 1) – 200-500 Kolonien
  • 3. Kontrolle (4 &mgr;g Plasmid 2 ohne Toxingen [entweder deletiert oder mutiert], und 4 &mgr;g Plasmid 1) – 200-500 Kolonien
  • 4. 4 &mgr;g Plasmid 1 und 4 &mgr;g Plasmid 2 – 20-50 Kolonien
  • 5. 4 &mgr;g Plasmid 1 und 20 &mgr;g Plasmid 2 – 2-5 Kolonien

Schlußfolgerung: Plasmid 2, welches das funktionale Toxingen in dem prä-th-RNA-Molekül enthält, hemmt das Wachstum von diesen Zellen.

Die experimentellen Kontrollen werden durchgeführt, um zu zeigen, dass die Zellwachstumshemmung auf Grund der Expression von dem Toxingen ist und nicht auf Grund der Herstellung eines Cytokins wie Interferon, was erwartet werden würde zu geschehen, wenn doppelsträngige RNA innerhalb der Zellen vorhanden ist. In diesen Experimenten wird die Bindungsdomäne so verändert, dass sie nicht länger bindet, oder das Toxingen mutiert ist, sodass es durch die Insertion einer Nonsense-Punktmutation mit Leseramenverschiebung nicht exprimiert werden kann, oder die Insertin von dem Toxingen in Antisense-Orientierung, der Rest des Konstrukts aber unverändert bleibt. Zellen, die mit Plasmid 1 oder Plasmid 2 mit keiner Bindungdomäne oder einem nicht exprimierbaren Toxingen transfektiert sind, sollten wachsen, genauso wie Zellen, die kein prä-th-RNA-Konstrukt enthalten.

Es werden Gemischtzellexperimente gemacht. Diese schließen Untersuchungen ein, wo Zellen, denen das Plasmid 1 fehlt, mit dem Plasmid 2 zusammen mit Zellen, die das Plasmid 1 enthalten, transfektiert werden. Die Endpopulation sollte in der Lage sein in der Anwesenheit von G418 (Resistenz, die durch das Plasmid 2 verliehen wird) gut zu wachsen, sollten aber nicht in der Anwesenheit von dem selektiven Mittel 1 wachsen (Zellen, die beide Plasmide enthalten sollten durch das trans-gespleißte Toxin eliminiert werden). Zusätzliche gemischte Kulturen können durchgeführt werden, um zu zeigen, dass die Expression des Toxins innerhalb von benachbarten Zellen nicht das Überleben von Nichtzielzellen beeinflusst.

Beispiel 7: Tierexperimente Erste Phase (Mäuse)

Es werden transformierte Zellen mit induzierbaren prä-th-RNA-Plasmiden an Mäuse verabreicht. Diese Zellen werden in dem oben beschrieben Zellkulturmodell entwickelt und eine auf diese Weise erhaltene Zellinie ließ mit einem induzierbaren Promotor vor dem trans-spleißbaren Konstrukt die Tiere erkranken. Der Vektor wird dann induziert und die erkrankten Zellen werden durch die Expression des Toxins abgetötet werden und das Tier sollte gesund bleiben. Dieser letztere Punkt ist wichtig, um zu zeigen, dass die Induktion des Toxingens nicht eine generelle negative Auswirkung hat. Einige der erkrankten Zellen werden auch bald nach der Induktion untersucht, um mit Antikörpern nach einen Hinweis für die Toxingenexpression zu suchen und auch um die reverse Transkription PCR durchzuführen, um zu zeigen, dass das trans-Spleißen stattgefunden hat. Die Tiere werden hinsichtlicht des Langzeitüberlebens und einer möglichen Toxizität hin verfolgt. Es können athymische Mäuse verwendet werden, um humane Zellen zu ziehen. Alternativ können die PTMs durch Elektroporation oder Liposomen verabreicht werden.

Zweite Phase – Darstellung des therapeutischen Konzepts

In dieser Phase werden Tiere mit nicht transformierten erkrankten Zellen verwendet (vorzugsweise humane Zellen in athymischen Mäusen). Humane Pankreas- oder Lungekrebszellen, die das beta-HCG exprimieren, können mit den PTMs verwendet werden, die für die zuvor aufgelisteten Experimente entwickelt wurden. Es können humane Zervixkrebszellen, die die Zielregion des Papillomavirustyps 18 enthalten, in dem oben genannten Zellmodell verwendet werden. Es wird athymischen Mäusen mit humanen Pankreakrebs- oder Zervixkrebstumoren die einbringbare Form des prä-th-RNA-Konstrukts injiziert oder ihnen durch Elektroporation eingebracht. Die Kontrolltiere erhalten die prä-th-RNA mit einer expressionsunfähigen Toxingen- oder Schein(keine Zielbindung)-prä-th-RNA. Die Tiere werden wie oben hinsichtlich des Langzeitüberlebens und der Toxizität hin untersucht.


Anspruch[de]
Nukleinsäuremolekül, das für die Verwendung beim trans-Spleißen einer Ziel-prä-mRNA geeignet ist, die innerhalb einer Zielzelle exprimiert ist und die durch nukleäre Spleißbestandteile innerhalb der Zielzelle erkannt werden kann, wobei die Nukleinsäure umfasst:

a) ein oder mehrere Ziel-Bindungsdomänen, die die Bindung des Nukleinsäuremoleküls an die Ziel-prä-mRNA steuern;

b) eine 3'-Spleißregion, die einen Branchpoint, einen Pyrimidintrakt und eine 3'-Spleißstelle umfasst;

c) eine Spacerregion, die die 3'-Spleißregion von der Zielbindungsdomäne trennt; und

d) eine Nukleinsäuresequenz, die zu der Ziel-prä-mRNA trans-gespleißt wird.
Nukleinsäuremolekül, das für die Verwendung beim trans-Spleißen einer Ziel-prä-mRNA geeignet ist, die innerhalb einer Zielzelle exprimiert ist und die durch nukleare Spleißbestandteile innerhalb der Zielzelle erkannt werden kann, wobei die Nukleinsäure umfasst:

a) ein oder mehrere Ziel-Bindungsdomänen, die die Bindung des Nukleinsäuremoleküls an die Ziel-prä-mRNA steuern;

b) eine 5'-Spleißstelle;

c) eine Spacerregion, die die 5'-Spleißregion von der Zielbindungsdomäne trennt; und

d) eine Nukleinsäuresequenz, die zu der Ziel-prä-mRNA trans-gespleißt wird.
Nukleinsäuremolekül nach Anspruch 1, welches ferner eine 5'-Spleißstelle und eine Spacerregion umfasst, die die 5'-Spleißregion von der Zielbindungsdomäne trennt. Nukleinsäuremolekül nach einem der Ansprüche 1 bis 3, welches ferner eine Sicherheitssequenz umfasst, die ein oder mehrere komplementäre Sequenzen umfasst, die an eine oder beide Seiten der 3'-Spleißstelle binden. Nukleinsäuremolekül nach einem der Ansprüche 2 oder 3, welches ferner eine Sicherheitssequenz umfasst, die ein oder mehrere komplementäre Sequenzen umfasst, die an eine oder beide Seiten der 5'-Spleißstelle binden. Nukleinsäuremolekül nach einem der vorhergehenden Ansprüche, welches für ein Protein kodiert, das eine therapeutische Wirkung hat. Nukleinsäuremolekül nach Anspruch 6, worin die therapeutische Wirkung das selektive Abtöten von Zielzellen nach dem trans-Spleißen ist. Nukleinsäuremolekül nach Anspruch 7, worin das kodierte Protein ein Toxin für das Abtöten der Zielzellen ist. Nukleinsäuremolekül nach Anspruch 7, worin das Toxin die Untereinheit A des Diphtherietoxins ist. Nukleinsäuremolekül nach einem der Ansprüche 6, 7 oder 8 oder 9, worin die Spacerregion eine Nukleotidsequenz enthält, die ein Translations-Stopcodon enthält. Nukleinsäuremolekül nach einem der vorhergehenden Ansprüche in Form von DNA. Nukleinsäuremolekül nach einem der vorhergehenden Ansprüche, worin die Ziel-prä-mRNA human ist. DNA-Vektor oder viraler Vektor, der ein Nukleinsäuremolekül exprimiert, definiert in dem Anspruch 1, 3, 4 oder in irgendeinem der Ansprüche 6 bis 12, wenn diese von Anspruch 1, 3 oder 4 abhängig sind. DNA-Vektor oder viraler Vektor, der ein Nukleinsäuremolekül exprimiert, definiert in dem Anspruch 2 oder 5 oder in irgendeinem der Ansprüche 6 bis 12, wenn diese von dem Anspruch 2 oder 5 abhängig sind. Nukleinsäuremolekül nach einem der Ansprüche 1 bis 12 für die Verwendung bei der Erkennung durch zelluläre nukleare Spleißbestandteile, um eine therapeutisch nützliche chimäre RNA herzustellen. Nukleinsäuremolekül nach Anspruch 15, worin die therapeutisch nützliche chimäre RNA für ein Protein kodiert, das eine therapeutische Wirkung hat. Nukleinsäuremolekül nach Anspruch 15, worin die therapeutisch nützliche chimäre RNA selektiv Zielzellen abtötet. Nukleinsäuremolekül nach einem der Ansprüche 1 bis 12 für die Verwendung bei der Erkennung durch zelluläre nukleare Spleißbestandteile, um eine chimäre RNA herzustellen, die als ein Marker dient. Nukleinsäuremolekül nach Anspruch 15, worin die therapeutisch nützliche chimäre RNA ein aktives therapeutisches Molekül bereitstellt, welches in den Zielzellen exprimiert ist. Vektor nach Anspruch 13 oder 14 für die Verwendung bei der Expression eines Nukleinsäuremoleküls, welches durch zelluläre nukleare Spleißbestandteile erkannt wird, um eine therapeutisch nützliche chimäre RNA herzustellen. Vektor nach Anspruch 20, worin die therapeutisch nützliche chimäre RNA für ein Protein kodiert, das eine therapeutische Wirkung hat. Vektor nach Anspruch 20, worin die therapeutisch nützliche chimäre RNA selektiv Zielzellen abtötet. Vektor nach Anspruch 13 oder 14 für die Verwendung bei der Expression eines Nukleinsäuremoleküls, welches durch zelluläre nukleare Spleißbestandteile erkannt wird, um eine chimäre RNA herzustellen, die als ein Marker dient. Vektor nach Anspruch 20, worin die therapeutisch nützliche chimäre RNA ein aktives therapeutisches Molekül bereitstellt, welches in den Zielzellen exprimiert ist.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com