PatentDe  


Dokumentenidentifikation DE69637047T2 27.12.2007
EP-Veröffentlichungsnummer 0000838025
Titel UNABHÄNGIGES GERÄT ZUR EXTRAKTION, AMPLIFIKATION UND NACHWEIS VON NUKLEINSÄUREN
Anmelder Applera Corp., Foster City, Calif., US
Erfinder GERDES, John C., Denver, CO 80206, US;
JANKOVSKY, Lynn D., Greenwood Village, CO 80121, US;
KOZWICH, Diane L., Englewood, CO 80110, US
Vertreter Kador & Partner, 80469 München
DE-Aktenzeichen 69637047
Vertragsstaaten AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LI, LU, MC, NL, PT, SE
Sprache des Dokument EN
EP-Anmeldetag 12.07.1996
EP-Aktenzeichen 969237601
WO-Anmeldetag 12.07.1996
PCT-Aktenzeichen PCT/US96/11633
WO-Veröffentlichungsnummer 1997003348
WO-Veröffentlichungsdatum 30.01.1997
EP-Offenlegungsdatum 29.04.1998
EP date of grant 25.04.2007
Veröffentlichungstag im Patentblatt 27.12.2007
IPC-Hauptklasse G01N 21/00(2006.01)A, F, I, 20051017, B, H, EP
IPC-Nebenklasse G01N 33/00(2006.01)A, L, I, 20051017, B, H, EP   B01L 11/00(2006.01)A, L, I, 20051017, B, H, EP   C12Q 1/68(2006.01)A, L, I, 20051017, B, H, EP   C12P 19/34(2006.01)A, L, I, 20051017, B, H, EP   C12M 1/40(2006.01)A, L, I, 20051017, B, H, EP   C12M 1/24(2006.01)A, L, I, 20051017, B, H, EP   G01N 33/53(2006.01)A, L, I, 20051017, B, H, EP   

Beschreibung[de]
Bereich der Erfindung

Diese Erfindung bezieht sich auf die allgemeinen Bereiche der Molekularbiologie und Medizinwissenschaft und speziell auf eine Vorrichtung für die Nukleinsäureextraktion, wobei spezifische Zielsequenzen amplifiziert werden und die amplifizierten Nukleinsäuresequenzen in einer unabhängigen Vorrichtung nachgewiesen werden. Die Anmeldung beschreibt folglich eine unabhängige Vorrichtung, die im Stande ist schnell und genau Zielnukleinsäuresequenzen nachzuweisen.

Hintergrund und Stand der Technik

Die Verwendung von Nukleinsäuresondentests, basierend auf der Hybridisierung, in routinemäßigen klinischen Laborverfahren wird durch einen Mangel an Sensitivität erschwert. Die Befähigung Nukleinsäuren aus klinischen Proben zu amplifizieren hat die Nukleinsäuresondentechnologie stark vorangetrieben, wobei die Sensitivität geboten wird, die in früheren Versionen von nichtisotop Assays fehlte. Die Sensitivität, die durch die Oligonukleotidsondentests erreicht wird, wobei die Nukleinsäureamplifikation verwendet wird, übersteigt nun die von irgendeinem anderen Verfahren. Die Nukleinsäureamplifikationsverfahren können eine einzige Kopie einer spezifischen Nukleinsäuresequenz nachweisen. Der routinemäßige Nachweis und Identifikation von spezifischen Gensequenzen haben in einer Vielzahl von Situationen und Industrien eine extrem breite Anwendung.

Die Hauptbarriere für die Übertragung einer Technologie in das Feld der Routinetests ist das Fehlen einer ökonomischen und einfach zu verwendenden Systems oder Apparats. Um in der heutigen kostenbewussten Umgebung wettbewerbsfähig zu sein muss das genetikbasierte Testen einen hohen Durchsatz bereitstellen, während adäquate Kontrollen und Schutzmaßnahmen umfasst sind, um falschpositive Ergebnisse auf Grund einer Probenkontamination zu verhindern.

Die derzeitige Technologie umfasst mehrere Schritte, obwohl neuste Entwicklungen auf automatisierte Systeme für den Nachweis der amplifizierten Zielsequenz abzielen. Der erste Schritt, die Extraktion der Nukleinsäuren, wird auf einer Vielzahl von Wegen bewerkstelligt, zum Beispiel durch Phenolextraktion, Extraktion durch chaotrope Reagenzien, chromatographische Reinigung (Qiagen, WO 95/01359, Reinigung auf Silicamembranen) und Ultrazentrifugation (Maniatis et al. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Habour Laboratory, Cold Spring Habour, NY). Phenol ist eine gut bekannte gesundheitliche Gefahr und bedarf einer speziellen Handhabung für die Abfallentfernung. Das Extraktionsverfahren ist auch mühsam und arbeitsintensiv. Die Ultrazentrifugation benötigt häufig die Verwendung von teueren und gefährlichen Chemikalien sowie die Verwendung einer komplizierten und teueren Ausstattung. Das Verfahren benötigt häufig lange Laufzeiten und umfasst manchmal einen oder mehrere Tage Zentrifugation. Das einfachste und schnellste Verfahren ist die Trennung unter Verwendung der chromatogaphischen Reinigung.

Der zweite Schritt, die Amplifikation der Zielnukleinsäuresequenz, setzt eine Vielzahl von Enzymen ein, bekannt als Polymerasen und Ligasen. Die Polymerasekettenreaktion (PCR) ist die am häufigsten verwendete Amplifikationstechnik. Die allgemeinen Prinzipien und Bedingungen für die Amplifikation von Nukleinsäuren unter Verwendung der PCR ist im Stand der Technik gut bekannt; die Details dafür werden in zahlreichen Referenzen geliefert, einschließlich in dem Patent der Vereinigten Staaten Nr. 4,683,195, in dem Patent der Vereinigten Staaten Nr. 4,683,202 und in dem Patent der Vereinigten Staaten Nr. 4,965,188, alle von Mullis et al. Folglich sind die Details für die PCR-Technologie hier nicht umfasst. Andere Methoden schließen die Ligasekettenreaktion, Q&bgr;-Replikase, Strangverdrängungsassay, Transcriptionsmediated iso CR Cycling-Probe-Technologie und Nucleic Acid Sequence-based Amplification (NASBA).

Eine derzeitige Proteinnachweistechnologie für Antigen-Antikörper-Assays umfasst die Verwendung von Mikropartikeln. Ferner sind derzeitig eine Vielzahl von Mikropartikelstrategien für dip-stick-Nachweis Antigen-Antikörper-Assays erhältlich, zum Beispiel der vertriebene Schwangerschaftstest für zu Hause (Patent der Vereinigten Staaten Nr. 5,141,850 von Cole et al.). Solche Tests verwenden farbige Partikel, die eine sichtbare Linie in Folge einer spezifischen Antigen-Antikörper-Reaktion bilden. Die vorliegende Erfindung wird durch die Hybridisierung eines Amplikons an Fangoligonukleotide bewerkstelligt, die an Mikropartikel gebunden sind. Das heißt die hierin offenbarte Erfindung weist Nukleinsäureamplikons nach.

Der Nachweis der amplifizierten Nukleinsäure für die klinische Verwendung beruht im Wesentlichen auf der Hybridisierung des amplifizierten Produkts und dem Nachweis mit einer Sonde, die mit einer Vielzahl von Enzymen und lumineszenten Reagenzien markiert ist. Das Patent der Vereinigten Staaten Nr. 5,374,524 von Miller beschreibt einen Nukleinsäuresondenassay, der die Nukleinsäureamplifikation und die Lösungshybridisierung kombiniert, wobei Fang- und Reportersonden verwendet werden. Diese Techniken benötigen mehrere Reagenzien, mehrere Waschschritte und eine spezielle Ausrüstung für den Nachweis der Zielnukleinsäure. Darüber hinaus sind diese Techniken arbeitsintensiv und benötigen technisches Personal mit einem Fachwissen der Molekularbiologie.

Die Verwendung von Sonden, die aus Oligonukleotidsequenzen bestehen, die an Mikropartikel gebunden sind, ist gut bekannt und im Stand der Technik dargestellt. Der Mechanismus für die Bindung der Oligonukleotide an die Mikropartikel in Hybridisierungsassays und für die Reinigung von Nukleinsäuren ist auch gut bekannt. Das europäische Patent Nr. 200133 beschreibt die Bindung von Oligonukleotiden an wasserlösliche Partikel mit einem Durchmesser von weniger als 50 Mikrometern, die in Hybridisierungsassays für die Fang- und Zieloligonukleotide verwendet werden. Das Patent der Vereinigten Staaten Nr. 5,387,512 von Wu beschreibt die Verwendung von Oligonukleotidsequenzen, die kovalent an Mikropartikel gebunden sind, als Sonden, um PCR-amplifizierte Nukleinsäuren einzufangen. Das Patent der Vereinigten Staaten Nr. 5,328,825 von Findlay beschreibt auch ein Oligonukleotid, das mittels eines Proteins oder Kohlenwasserstoffs mit einem wasserlöslichen Partikel verbunden ist. Die Olionukleotidsonde wird kovalent an den Mikropartikel oder ein anderes festes Hilfsmittel gebunden. Die Sensitivität und Spezifität von allen Patenten, auf die oben Bezug genommen wird, basiert auf der Hybridisierung der Oligonukleotidsonde an die Zielnukleotidsequenz.

Die Verwendung von in den Amplifikationsreaktionen umfassten nichtradioaktiven Markierungen für den Nachweis von Nukleinsäuren ist auch im Stand der Technik gut bekannt. Es wurden auch Nukleinsäuren verwendet, die mit Biotin (Patent der Vereinigten Staaten Nr. 4,687,732 von Ward et al.; europäische Patentnr. 063879), Digoxin (europäische Patentnr. 173251) und anderen Haptenen modifiziert werden. Zum Beispiel verwendet das Patent der Vereinigten Staaten Nr. 5,344,757 von Graf eine Nukleinsäuresonde, die wenigsten ein Hapten als Markierung enthält, für die Hybridisierung mit einer komplementären Zielnukleinsäure, die an eine feste Membran gebunden ist. Die Sensitivität und Spezifität dieser Assays basiert auf der Aufnahme einer einzigen Markierung in die Amplifikationsreaktion, welche unter Verwendung eines Antikörpers nachgewiesen werden kann, der für die Markierung spezifisch ist. Der gewöhnlich Fall umfasst einen Antikörper, der an ein Enzym konjugiert ist. Darüber hinaus erzeugt die Zugabe eines Substrates eine kolorimetrische Änderung oder eine Fluoreszenzänderung, die mit einem Instrument nachgewiesen werden kann.

Dennoch sind die oben beschriebenen Methoden mit vielen Schritten und Waschschritten arbeitsintensiv; sie benötigen eine spezielle und teuere Ausrüstung für den Nachweis der Zielnukleinsequenz; sie benötigen angelernte Mitarbeiter; und sie benötigen mehrere Stunden, um sie abzuschließen. Es sind mehrere Patente herausgegeben worden, die sich mit der Automatisierung der Prozesse für die Amplifikation und den anschließenden Amplikonnachweis befassen. Diese Patente verwenden eine spezielle Ausrüstung und basieren immer noch auf dem Prinzip der Hybridisierung und der Immunoassaytechnologie. Zum Beispiel beschreibt das europäische Patent Nr. 320308 ein System, das die Zielnukleotidsequenzen nachweist, die durch eine Ligasekettenreaktion amplifiziert wurden.

Die automatisierten Methoden beseitigen den Bedarf für speziell ausgebildetes Personal, die Kosten für die Apparatur sind jedoch sehr hoch und die Möglichkeit einer Kontamination existiert dennoch, weil viele Proben in derselben Apparatur verarbeitet werden. Um das Problem der Kontamination zu beheben ist es nötig die drei oben behandelten Schritte zu integrieren. Die hierin offenbarte unabhängige Vorrichtung erreicht dieses Ziel, indem die existierenden Nukleinsäureextraktionstechnologie und isothermen Amplifikationstechnologien mit einer innovativen Nachweisstrategie verflochten werden.

Die hierin beschrieben Erfindung stellt einen schnellen und genauen Nachweis von amplifizierten Nukleinsäuresequenzen bereit, wobei eine unabhängige Vorrichtung verwendet wird. Die Möglichkeit der Kontamination wird wegen des hierin beschriebenen „Wegwerf"-Methode behoben. Die Eliminierung einer Kreuzkontamination öffnet die Tür zum Massenscreening, einschließlich einer Automatisierung. Die hohe Sensitivität der Analyse gewährt den frühen Krankheitsnachweis und die Möglichkeit für eine frühe Behandlung. Die vorliegenden Erfindung diagnostiziert die Anwesenheit von Infektionserkrankungen genetischen, bakteriellen oder viralen Ursprungs. Die Analyse durch diese Erfindung kann die Wirksamkeit der Behandlung überwachen, zum Beispiel, um den HI-Virus im Plasma von Patienten zu überwachen, die eine Therapie durchlaufen. Die Analyse entsprechend der hierin offenbarten Erfindung ist einfach und bedarf eine geringe Kenntnis im Fach der Molekularbiologie. Die Kosten sind signifikant weniger als bei anderen Verfahren, die derzeitig in Verwendung sind, um amplifizierte Nukleinsäure nachzuweisen. Der Zeitrahmen für den Nachweis einer amplifizierten Sequenz wird drastisch verringert. Es gibt nicht die Gefahr durch potentiell gefährliche Chemikalien. Die Analyse bedarf keiner speziellen Abfallentsorgungsverfahren. Die Erfordernis von vielen Waschschritten in einer immunometrischen Methode oder einer Hybridisierungsmethode wird behoben. Die unabhängige Vorrichtung benötigt keine spezielle Ausrüstung, außer einem Standardheizblock mit konstanter Temperatur. Die geringe Komplexität der Vorrichtung bietet sich in „Sachen sorgfältiger" Tests in Kliniken und Arztpraxen an. Die Tragbarkeit der Vorrichtung bietet eine Analyse „vor Ort", um Nukleinsäuresequenzen im Bereich der Forensik, Agrarwirtschaft, Umwelt und Nahrungsmittelindustrie nachzuweisen.

Die Nukleinsäuresondentechnologie hat sich in den letzen Jahren schnell entwickelt, weil die wissenschaftliche Gemeinschaft ihren Wert für den Nachweis von verschiedenen Erkrankungen, Organismen oder genetischen Abnormalien entdeckt hat. Die Amplifikationstechniken haben die Sensitivität bereit gestellt, um quantitativ die Anwesenheit von selbst winzigen Nukleinsäuremengen zu bestimmen. Das Manko für eine weit verbreitete Verwendung dieser Technologie ist die Möglichkeit von einer Kreuzkontamination der Proben, weil der Test so sensitiv ist. Die Kosten der nukleinsäurebasierten Tests sind hoch, weil sie hoch qualifiziertes technisches Personal und eine komplizierte Ausrüstung benötigen. Ein Verfahren die Möglichkeit der Übertragung von einer Probe zur einer Anderen zu beseitigen, ist die Verwendung einer vollständig abgeschlossenes Einwegvorrichtung.

Zusammenfassung der Erfindung

Diese Erfindung basiert auf einen neuartigen Konzept für ein Verfahren zum Nachweis spezifischer DNA- oder RNA-Sequenzen. Die vorliegende Erfindung ist durch eine unabhängige Vorrichtung definiert, die die Nukleinsäureextraktions-, Amplifikations- und Nachweismethodiken zusammenfasst.

Die vorliegende Erfindung ist eine unabhängige Vorrichtung, die die Nukleinsäureextraktion, die spezifische Zielamplifikation und den Nachweis in einer einzigen Vorrichtung zusammenfasst, was einen schnellen und genauen Nachweis der Nukleinsäuresequenz erlaubt. Die vorliegende Erfindung ist auf alle Nukleinsäuren und deren Derivate anwendbar. Die vorliegende Erfindung ist für die Identifikation von spezifischen Nukleinsäuresequenzen nützlich, die bestimmten Erkrankungen oder Zuständen entsprechen, sowie für die Überwachung der Behandlungswirksamkeit von ansteckenden Erkrankungen, sie ist aber nicht auf diese Anwendungen beschränkt.

In der Erfindung umfasst die unabhängige Vorrichtung einen ersten hohlen gestreckten Zylinder mit einem einzigen geschlossenen Ende und darin einer Vielzahl von Kammern, einen zweiten hohlen gestreckten Zylinder, der innen durchgehend angrenzend an den ersten Zylinder positioniert ist und zu einer relativen Drehung im Stande ist. Die Probe wird für die Extraktion in den zweiten Zylinder eingeführt. Die extrahierte Nukleinsäure wird an eine Festphasenmembran oder Silica gebunden und dadurch durch die Zugabe des Waschpuffers nicht von der festen Phase eluiert. Die Amplifikation und die Markierung findet in demselben Zylinder statt. Schließlich wird das markierte, amplifizierte Produkt mit Mikropartikeln zur Reaktion gebracht, die mit rezeptorspezifischen Liganden für den Nachweis der Zielsequenz konjugiert sind.

Der zweite hohle gestreckte Zylinder kann Extraktions- und Amplifikationsmittel umfassen.

Die Probe kann in drei separaten und sequentiellen Kammern extrahiert, amplifiziert und nachgewiesen werden.

Andere Merkmale und Vorteile der vorliegenden Erfindung werden durch die folgende detaillierte Beschreibung, in Verbindung mit den begleitenden Figuren, die als Beispiel die Prinzipien der vorliegenden Erfindung darstellen, offensichtlich werden.

Die vorliegende Erfindung bezieht sich im Allgemeinen auf eine unabhängige Vorrichtung, welche die Nukleinsäureextraktion, die spezifische Zielamplifikation und den Nachweis zusammenfasst. Die Erfindung beruht auf den Prinzipien der chromatographischen Nukleinsäureextraktion aus der Probe, der Amplifikation der spezifischen Zielnukleotidsequenzen, was zu einem doppelt markierten Amplifikationsprodukt führt, der Liganden-Rezeptor-Bindung und der Mikropartikeltechnologie für den Nachweis der amplifizierten Nukleinsäure. Darüber hinaus kann die vorliegende Erfindung auf der Nukleinsäurehybridisierung beruhen.

Das Verfahren ist für die Bestimmung aller Nukleinsäurezielsequenzen geeignet. Die Sensitivität und Genauigkeit dieses Verfahrens sind im Vergleich zu den derzeitig verwendeten Verfahren, die von Fachleuten auf dem Gebiet verwendet werden, verbessert. Die Erfindung bietet die Möglichkeit für eine kontaminationsfreie, schnelle und verlässliche Bestimmung der Anwesenheit von spezifischen amplifizierten Zielnukleinsäuren.

Kurze Beschreibung der Figuren

1 ist eine perspektivische Ansicht der unabhängigen Vorrichtung, welche die Nukleinsäureextraktion, -amplifikation und -nachweis zusammenfasst.

2 ist ein Schema des bevorzugten Verschlussmechanismus, welches jede der drei Rotationspositionen der Vorrichtung darstellt: A) geschlossen; B) offen; und C) eluieren.

3 ist eine Querschnittsansicht der oberen und unteren Körpers der Vorrichtung, welche die klappbare Abdeckung in der offenen Position zeigt.

4 ist eine perspektivische Ansicht der klappbaren Abdeckung und der Reaktionskügelchen, die innerhalb einer Reaktionskügelchenkammer enthalten sind, die einer integrierte Messerkante hat.

5 ist eine Querschnittsansicht des Öffnungsteils der zweiten hohlen gestreckten Zylinders.

6 stellt die relative Position des Absorptionsmittelkissens und Streifens dar, welche die Mikropartikel und Fangzonen haben.

7 stellt eine sequentielle perspektivische Ansicht dar, die den Arbeitsablauf der unabhängigen Vorrichtung illustriert.

8 stellt die Reagenzien und ihre entsprechenden Interaktion (entsprechende Interaktion?) in der Ampliflkationskammer der Vorrichtung in einer SDA-Strategie dar.

9 stellt die Reagenzien und ihre entsprechenden Interaktionen in einer alternierenden SDA-Strategie dar.

10 stellt die Reagenzien und ihre entsprechenden Interaktionen in einem Cycling-Probe-Assay dar.

11 stellt die Nachweiseergebnisse der isothermen Amplifikation und den Nachweis mit bifunktional markierten amplifizierten Zielsequenzen unter Verwendung eines Strangverdrängungsassays dar.

12 zeigt die Nachweisergebnisse eines Lateralflussassays.

13 zeigt die Nachweisergebnisse eines anderen Lateralflusses.

14 stellt eine NASBA-Strategie dar.

15 zeigt die Ergebnisse des Nachweises mittels Amplifikation mit einem einzigen markierten Primer, gefolgt von der Hybridisierung mit einer Sonde, die eine einzige Markierung enthält.

1
Erster hohler gestreckter Zylinder
2
Zweiter hohler gestreckter Zylinder
3
klappbare Abdeckung
6
Indizierungsstift
7
Indizierungskerben
9
Absorptionsmittelkissen
10
Streifen
11
Reaktionskügelchen
12
Reaktionskügelchenkammer
13
Öffnung
14
Living-Hinge
15
Dichtungsrand
16
Reservoir
17
feste Oberfläche
18
Messerkante
19
Folie- oder Folie/Polymer-Membran
20
Nachweiskammer
21
Transparentes Sichtfenster
22
Poröse Membran
23
Silicaschlamm
24
farbige Mikropartikel
25
Fangzone für Zielsequenz
26
Fangzone für Kontrollsequenz

Detaillierte Beschreibung der bevorzugten Ausführungsformen

Es ist selbstverständlich, dass sowohl die vorhergehende allgemeine Beschreibung als auch die folgende detaillierte Beschreibung beispielhaft sind und nur der Erklärung dienen und für die Erfindung, wie sie beansprucht wird, nicht einschränkend sind.

Die vorliegende Erfindung stellt eine Vorrichtung für den Nachweis einer amplifizierten Zielnukleinsäuresequenz bereit, die in einer Probe vorhanden ist. Es wird von Fachleuten auf dem Gebiet erkannt werden, dass Assays für ein breites Spektrum an Zielnukleinsäuresequenzen, die in einer Probe vorhanden sind, in Übereinstimmung mit der vorliegenden Erfindung durchgeführt werden können. Die Proben können biologische Proben umfassen, die aus landwirtschaftlichen Quellen, bakteriellen und viralen Quellen oder aus humanen oder anderen tierischen Quellen stammen, sowie andere Proben wie Abfall oder Trinkwasser, landwirtschaftliche Produkte, Nährmittel, Luft, ect. Beispiele schließen Blut, Stuhl, Sputum, Schleim, Serum, Urin, Speichel, Tränen oder eine Biopsieprobe, eine histologische Gewebeprobe, ein Gewebekulturprodukt, ein landwirtschaftliches Produkt, Abfall oder Trinkwasser, Nährmittel, Luft, ect. ein. Die vorliegende Erfindung ist für den Nachweis von Nukleinsäuresequenzen nützlich, die für genetische Defekte oder ansteckende Krankheiten bezeichnend sind.

Die folgenden Definitionen werden für das Verständnis der Beschreibung und der Ansprüche hilfreich sein. Die hierin bereitgestellten Definitionen sollten berücksichtigt werden, wenn diese Begriffe in den folgenden Beispielen und durchwegs in der vorliegenden Anmeldung verwendet werden.

So wie er hierin verwendet wird bezieht sich der Begriff „Ziel"-Nukleinsäuremolekül auf das Nukleinsäuremolekül, das durch die vorliegenden Methoden amplifiziert wird. Das „Ziel"-Molekül kann gereinigt, teilweise gereinigt oder in einem ungereinigten Zustand in der Probe vorhanden sein.

So wie in dieser Erfindung verwendet bezieht sich der Begriff „Amplifikation" auf einen „Template-abhängigen Prozess", der zu einer Konzentrationszunahme von einer Nukleinsäuresequenz relativ zu ihrer Anfangskonzentration führt. Ein „Template-abhängiger Prozess" ist als ein Prozess definiert, der die „Template-abhängige Extension" eines „Primer"-Moleküls umfasst. Ein „Primer"-Molekül bezieht sich auf eine Sequenz einer Nukleinsäure, die zu einem Teil der Ziel- oder Kontrollsequenz komplementär ist und kann oder kann nicht mit einem Hapten markiert sein. Eine „Template-abhängige Extension" bezieht sich auf die Nukleinsäuresynthese von RNA oder DNA, worin die Sequenz des neu synthetisierten Nukleinsäurestrangs durch die Regeln der komplementären Basenpaarung von der Zielnukleinsäure und den Oligonukleotiden bestimmt wird.

Die vorliegende Erfindung bezieht sich auf die Extraktion und Amplifikation von Nukleinsäuren in einer Kammer einer unabhängigen Vorrichtung, gefolgt von dem Nachweis in einer weiteren Kammer und der Sammlung des Abfalls in noch einer weiteren Kammer. Die Reaktionskammern sind funktionell verschieden, sequentiell und kompakt. Die besagten Kammern liefern genaue Volumina, geben Reagenzien ab und sammeln den Abfall ein. All dies geschieht in einer vollständig unabhängigen Vorrichtung mit einfachen, narrensicheren Gebrauchsanweisungen, wie es unten beschrieben ist.

Wie in 1 dargestellt besteht eine Extraktions-, Amplifikations- und Nachweisvorrichtung aus einem ersten hohlen gestreckten Zylinder 1, der ein geschlossenes Ende und eine aufgepresste Abdeckung 3 hat, die an dem entgegengesetzten, offenen Ende hängt, und einem zweiten hohlen gestreckten Zylinder 2 besteht, der innen angrenzend an den ersten Zylinder 1 positioniert ist und der zu einer relativen Rotation in der Lage ist. Die bevorzugte Ausführungsform des zweiten Zylinders 2 ist ein konischer Zylinder, der mit einer Öffnung 13 endet, die einen Dichtungsrand 15 hat. De erste Zylinder 1 besteht ferner aus 2 Kammern: einer Reservoirkammer 16 und einer Nachweiskammer 20, wobei die besagte Nachweiskammer ferner aus einem Kissen 9 und einem Streifen 10 besteht. Der Großteil der Vorrichtung ist aus einem Material zusammengesetzt, das nicht die Bindung von Nukleinsäuren und Proteinen ermöglicht. Das bevorzugte Material ist ein hitze- und kältebeständiges Material, das leicht, starr und stabil ist. Die bevorzugte Größe ist kompakt genug, um in Heizblöcke mit konventioneller Größe zu passen, die Größe kann jedoch entsprechend herauf- oder herabgesetzt werden. Die bevorzugte Ausführungsform setzt die Vorrichtung in einer Umgebung mit konstanter Temperatur ein, wie einen Heizblock, was gestattet die Reaktionen bei den bevorzugten Bedingungen mit einer konstanten Temperatur auszuführen.

Wenn die Probe in die Vorrichtung eingebracht wird, findet die Nukleinsäureextraktion und -amplifikation in dem zweiten Zylinder 2 statt, wobei der besagte erste hohle gestreckte Zylinder 2, der die Nachweiskammer 20 enthält, ein Mittel für den Nachweis hat. Das Reservoir 16 sammelt den in dem Extraktionsprozess und den anschließenden Waschschritten verwendeten Lysepuffer.

Der zweite Zylinder 2 rotiert relativ zu dem ersten Zylinder 1 und rastet in der Position A, Position B oder Position C ein. An dem verjüngtem Ende des zweiten Zylinders 2 gestattet eine Öffnung 13, die einen Dichtungsrand 15 hat, dem zweiten Zylinder 2 entweder mit der Nachweiskammer 20 oder dem Reservoir 16 einzurasten. Der erste Zylinder 1 enthält zwei Kammern, das Reservoir 16 und die Nachweiskammer 20. Das Reservoir 16 wird durch die an den ersten Zylinder 1 angrenzenden Seiten, die Nachweiskammer 20 und eine poröse Membran 22 definiert. Die poröse Membran 22 hat Poren mit einer Größe, die der Abfallflüssigkeit gestatten zu passieren. Die klappbare Abdeckung 3 hat einen Indizierungsstift 6, der für die Arretierung des zweiten Zylinders 2 in den Positionen A, B oder C verwendet wird. Der zweite Zylinder 2 ist in der Position A, der geschlossenen Position, zu dem Reservoir hin geschlossen. In der B-, oder offenen, Position gestattet der zweite Zylinder 2 den Fluss zu dem Reservoir 16. In der C-, oder Elutions-, Position sind das amplifizierte Nukleinsäureziel und die amplifizierte Nukleinsäurekontrolle im Stande in die Nachweiskammer 20 zu gelangen. Die klappbare Abdeckung 3 enthält auch ein Reaktionskügelchen 11 innerhalb einer Reaktionskügelchenkammer 12. Dieses Kügelchen 11 enthält die Reaktionsenzyme und weitere Reagenzien, die für den Amplifikationsschritt benötigt werden. Der zweite Zylinder 2 enthält drei Indizierungskerben 7 für die Einreihung mit dem Indizierungsstift 6 und die Arretierung der relativen Rotation der Zylinder 1 und 2.

In der Position A ist der zweite Zylinder abgedichtet, was dem Extraktionsschritt und dem Amplifikationsschritt ermöglicht statt zu finden. In der Position B ist der zweite Zylinder 2 auf eine Weise offen, dass die Öffnung in dem zweiten Zylinder 2 nicht abgedichtet und über dem Reservoir 16 ist. In der Position C ist der zweite Zylinder 2 auf eine Weise rotiert, dass der zweite Zylinder 2 nicht verschlossen ist und die Öffnung über einem Absorptionsmittelkissen 9 in der Nachweiskammer 20 angeordnet ist. Das Absorptionsmittelkissen 9 sammelt das amplifizierte Produkt und leitet das Produkt auf einen Streifen 10 aus Nylon, Nitrocellulose oder aus einem anderen geeigneten Material. Der Streifen 10 enthält farbige Mikropartikel 24 und Fangzonen für die Zielsequenzen 25 und Kontrollsequenzen 26. Die Nachweiskammer 20 enthält ein transparentes Sichtfenster 21, um die Reaktionsergebnisse zu beobachten.

2 stellt die bevorzugte Ausführungsform des Dichtungsmechanismus der hierin offenbarten Vorrichtung dar. In der offenen Position A ist der zweite Zylinder 2 durch einen Dichtungsrand 15 verschlossen. Der Dichtungsrand 15 besteht aus einem flexiblen Material, dass komprimiert werden kann, wenn es mit einer festen Oberfläche 17 am oberen Ende des ersten Zylinders 1 in Kontakt ist. In der geschlossenen Position B erlaubt die Rotation des zweiten Zylinders 2 relativ zu dem ersten Zylinder 1 den Inhalten des zweiten Zylinders 2 durch eine poröse Membran 22 im Boden des zweiten Zylinders 2 in das Reservoir 16 zu fließen. In dieser Position erstreckt sich der Dichtungsrand 15 über die Kompressionsebene hinaus und gestattet der Flüssigkeit in das Reservoir 16 zu fließen. Der zweite Zylinder 2 kann relativ zu dem ersten Zylinder 1 in der Elutionsposition C gedreht werden. In dieser Position erstreckt sich der Dichtungsrand 15 wieder über die Kompressionsebene hinaus über eine Öffnung, die ein Absorptionsmittelkissen 9 und einen Streifen 10 aus Membran enthält, die für den Nachweisschritt verwendet wird.

Ein Querschnitt des oberen 1 und unteren 2 Körpers der Vorrichtung und der klappbaren Abdeckung 3 in der offenen Position ist in der 3 dargestellt. Der Indizierungsstift 6 ist auf der klappbaren Abdeckung 3 lokalisiert. Die drei Indizierungskerben 7 sind auf dem zweiten Zylinder 2 lokalisiert. Das Reaktionskügelchen 11 enthält lyophilisierte Enzyme und Reagenzien für die Amplifikationsreaktion. Die klappbare Abdeckung 3 enthält eine Messerkante 18, die, wenn genügend Druck angewendet wird, eine Folienmembran 19durchbricht und das Reaktionskügelchen 11 wird in den zweiten Zylinder 2 freigesetzt, wie in 4 gezeigt ist.

Ein Querschnitt des Bodens von dem zweiten Zylinder 2 ist in der 5 dargestellt. Der Dichtungsrand 15 enthält eine poröse Membran 22, welche die extrahierten Nukleinsäuren bindet, oder eine poröse Membran 22, die einen Silicaschlamm 23 in dem zweiten Zylinder 2 hält. In 6 ist ein Streifen 10 dargestellt, der eine Region mit immobilisierten farbigen Mikropartikeln 24 und zwei Fangzonen 25, 26 enthält. Die Mikropartikel 24 sind mit einem Rezeptor beschichtet, der für die Ziel- und Kontrollsequenz spezifisch ist. Die Zielsequenzfangzone 25 enthält Rezeptoren, die spezifisch für Haptene auf der Zielsequenz sind, und die Kontrollsequenzfangzone 26 enthält Rezeptoren, die spezifisch für Haptene auf der Kontrollsequenz sind.

Die folgenden Beispiele dienen dazu die vorliegenden Erfindung zu erklären und darzustellen. Die besagten Beispiele sind nicht dahin auszulegen die Erfindung in irgendeiner Weise einzuschränken. Es verschiedene Modifikationen innerhalb des Bereichs der Erfindung möglich.

Beispiel 1 Probenfluss durch die bevorzugte Ausführungsform einer unabhängigen Vorrichtung

Die bevorzugte Ausführungsform der hierin offenbarten Vorrichtung wird durch zwei hohle gestreckte Zylinder definiert, einen ersten Zylinder, der ein geschlossenes Ende hat, wie in 1 dargestellt, für die Extraktion, Amplifikation und den Nachweis der Nukleinsäuresequenzen. In der geschlossenen Position A wird die Probe in den zweiten Zylinder 2 eingebracht. Der zweite Zylinder 2 enthält trockenen Lysereagenzien für die Extraktion der Nukleinsäuren. Die Probe stellt die Flüssigkeit bereit, die die Lysereagenzien resuspendiert. Nach einer kurzen Inkubationszeit mit der geschlossenen Abdeckung 3 wird der zweite Zylinder 2 in der offene Position B gedreht. Die extrahierte Nukleinsäure verbleibt in der oberen Kammer an die poröse Membran 22 oder den Silicaschlamm 23 gebunden, während die Flüssigkeit in das Reservoir 16 fließt. In dieser Position folgen mehrere Waschschritte mit Puffer oder Wasser. Als nächstes wird der zweite Zylinder 2 in die geschlossene Position A gedreht, sodass der zweite Zylinder 2 abgedichtet ist, es wird Wasser zugegeben und die Abdeckung verschlossen. Wenn ein ausreichender Druck auf die klappbare Abdeckung 3 angewendet wird, wird das Reaktionskügelchen 11 aus der Reaktionskügelchenkammer 12 freigesetzt und zu dem zweiten Zylinder 2 durch das Aufbrechen der Folienmembran 19 mit der Messerkante 18 zugegeben. Das Reaktionskügelchen 11 trägt die Enzyme, die für die Amplifkation notwendig sind, welche in dem Wasser resuspendiert werden, und die Amplifikation findet auf der Membran 22 oder dem Silicaschlamm 23 statt, welche die extrahierten Nukleinsäuren enthalten. Nach einer angemessenen Inkubationszeit wird der zweite Zylinder 2 relativ zu dem ersten Zylinder 1 in die Elutionsposition C gedreht. Die Amplifkationsreationsmischung ist in der Lage die Nachweiskammer 20 einzudringen indem sie auf dem Absorptionsmittelkissen 9 absorbiert wird. Wenn das Kissen 9 eine ausreichende Flüssigkeitsmenge absorbiert, wird die Reaktionsmischung auf den Streifen 10 geleitet. Auf dem Streifen binden die farbigen Mirkopartikel 24 an die Haptene, die sich aus der Amplifikationsreaktion ergeben, und wandern zu der Fangzone auf der Membran, wo sie eine sichtbare Nachweislinie für die Zielsequenz, wenn sie vorhanden ist, und die Kontrollsequenz bilden. Die Nachweislinie wird durch das transparente Sichtfenster 21 betrachtet. Siehe 7.

Der zweite Zylinder 2 hat eine Kapazität von 0,001 bis 25 ml. Die Probe ist Gesamtblut, Sputum, Serum, Plasma, Urin, Fäkalmaterial, ein Gewebe, Teil eines Organs oder irgendeine andere Quelle, die Zielnukleinsäuresequenzen enthalten kann. Die Probe ist von Menschen, Pflanzen oder Tieren oder kann eine Umweltprobe sein.

Das hierin offenbarte Verfahren und der hierin offenbarte Apparat stellen einen extrem schnellen, ökonomischen Nukleinsäurenachweis bereit. Ferner vermindert diese unabhängige Vorrichtung signifikant das Risiko einer Kreuzkontamination, da weder die Amplifikationsreagenzien noch die Amplikons manipuliert werden. Die minimale zusätzliche benötigte Ausstattung, ein Standradheizblock, und die Einfachheit des Protokolls gestatten es den Test einfach, irgendwo und mit einer minimalen Menge an technischer Erfahrung durchzuführen.

Beispiel 2 Mikropartikelauswahl

Die bevorzugten Mikropartikel, die in dieser Erfindung verwendet werden, sind aus polymeren Materialien zusammengesetzt, wie Latex, Polyethylen, Polypropylen, Polymethylmethacrylat oder Polystyrol. Es können jedoch auch eine Vielzahl von anderen synthetischen oder natürlichen Materialien bei der Herstellung der Mikropartikel verwendet werden, zum Beispiel Silikate, paramagnetische Partikel und kolloidales Gold. Die gewöhnliche Form der Mikropartikel besitzt Oberflächensulfatladungsgruppen, die durch die Einführung von funktionellen Gruppen wie Hydroxyl-, Carboxyl-, Amin- und Carboxylatgruppen modifiziert werden können. Die funktionellen Gruppen werden verwendet, um eine große Vielfalt von Liganden und Rezeptoren an die Mikropartikel zu binden. Diese Gruppen werden auf der Basis ihrer Fähigkeit ausgewählt die Bindung mit dem ausgewählten Mitglied des Ligand-Rezeptor-Paar zu unterstützen, entweder durch kovalente Bindung oder durch Adsorption. Das bevorzugte Verfahren zur Befestigung des Rezeptors an den Mikropartikel ist die kovalente Bindung.

Die Größe der Mikropartikel, die in dieser Erfindung verwendet werden, wird ausgewählt, um die Bindung und den Nachweis der markierten Amplikons zu optimieren. Die Mikropartikel sind in einem Größenbereich von 0,01-10,0 &mgr;m im Durchmesser erhältlich. Der bevorzugte Durchmesser für diese Ausführung der Erfindung ist ein Bereich von 0,01-1,0 &mgr;m, wobei spezifisch die Verwendung von entweder größeren oder kleineren Mikropartikeln nicht ausgeschlossen wird, soweit erforderlich bestimmt. Die Mikropartikel werden für die Bindung an den Zielligand mit einem geeigneten Rezeptor aktiviert. Der bevorzugte Mikropartikel in der vorliegenden Erfindung ist aus Latex zusammengesetzt, das einen farbigen Farbstoff enthält.

In der vorliegenden Erfindung sind die mikropartikelgebundenen Rezeptoren spezifisch für diskrete Haptene, die an den Enden der amplifizierten Nukleinsäuresequenzen lokalisiert sind. Die Rezeptoren müssen im Stande sein an ihre spezifischen Bindungspartner (Hapten) zu binden und ferner erfordert die Veränderung der derivatisierten Haptene von dem bevorzugten Biotin und Digoxigenin eine Veränderung in den Rezeptoren. Die Konjugation der Rezeptoren an den Mikropartikel wird durch kovalente Bindung oder in entsprechenden Fällen durch die Adsorption des Rezeptors auf der Oberfläche des Mikropartikels bewerkstelligt. Die Techniken für die Adsorption oder die kovalente Bindung der Rezeptoren auf die Mikropartikel sind im Stand der Technik gut bekannt und bedürfen keiner weiteren Erklärung.

Um die anti-Digoxigenin-beschichteten Mikropartikel herzustellen werden 0,25-1,0 mg/ml anti-Digoxigenin Fab mit einer Suspension inkubiert, die eine Endkonzentration von 1,0% Mikropartikel/ml enthält. Den Mikropartikeln und dem Digoxigenin Fab wird ermöglicht vor der Behandlung mit dem Aktivierungsmittel für die kovalente Bindung für 15 Minuten zu reagieren. Die Mirkopartikel werden mit EDAC (1-Ethyl-3-(3-dimethylaminopropyl)carbodiamid) mit einer Endkonzentration von 0-2,5 mM behandelt. Das Fab und die Mikropartikel werden gemischt und für eine Stunde bei Raumtemperatur inkubiert. Das ungebundene Fab wird durch aufeinanderfolgende Waschschritte entfernt und die beschichteten Mikropartikel werden in Aufbewahrungspuffer resuspendiert.

Die Lateralflussassays werden auf Nylon- oder Nitrocellulosemembranen durchgeführt, die mit Fangzonen aus 1,0 &mgr;l Streptavidin mit Konzentrationen zwischen 0,0 und 1,0 mg/ml ausfindig gemacht werden.

Beispiel 3 Amplifikation

Die vorliegende Erfindung setzt eine Vielzahl verschiedener Enzyme ein, um die Amplifikation der Zielnukleinsäuresequenz zu bewerkstelligen, zum Beispiel Polymersasen und Ligasen. Die Polymerasen sind durch ihre Funktion Nukleosidtriphosphate einzubauen definiert, um einen 3'-Hydroxylterminus eines „Primermoleküls" zu verlängern. Wie hierin verwendet ist ein „Primer" ein Oligonukleotid, dass, wenn es an ein Zielnukleinsäuremolekül hybridisiert wird, einen 3'-Hydroxylterminus, der durch eine Polymerase verlängert werden kann, und eine Haptenmarkierung am oder nahe des 5'-Terminus besitzt. Für die allgemeine Diskussion betreffend Polymerasen siehe Watson, J.D. et al., (1987) Molecular Biology of the Gene, 4. Auflage, W.A. Benjamin, Inc., Menlo Park, CA. Beispiele für Polymerasen, die in Übereinstimmung mit den hierin beschriebenen Verfahren verwendet werden können, schließen die E. coli DNA-Polymerase I, das große proteolytische Fragment der E. coli Polymerase I, allgemein bekannt als „Klenow"-Polymrase, Taq-Polymerase, T7-Polymerase, T4-Polymerase, T5-Polymerase und die reverse Transkriptase ein, sind aber nicht darauf beschränkt. Die allgemeinen Prinzipien und Bedingungen für die Amplifikation von Nukleinsäuren unter Verwendung der Polymerasekettenreaktion wie oben diskutiert sind im Stand der Technik gut bekannt.

Beispiel 4 Isothermer Amplifikationsansatz für den Nachweis mit markierten amplifizierten Zielsequenzen unter Verwendung von NASBA

Die bevorzugte Ausführungsform für die Amplifikation, wobei diese Erfindung verwendet wird, ist eine isotherme Reaktion wie NASBA (Patent der Vereinigten Staaten Nr. 5,130,238) oder ein Strangverdrängungsassay (SDA) (Walker et al. (1992) PNAS 89:392). Das Primärprodukt der NASBA-Reaktion eine einzelsträngige RNA. Die NASBA-Reaktion verwendet einen Primer, der einen T7-Polymeraserpromotor enthält. In Folge der T7-Transkription werden bis zu 100 Kopien der Ziel-RNA hergestellt. Diese Kopien haben dieselbe Sequenz wie die ursprüngliche Ziel-RNA. Sie dienen als Templates, die folglich den Zyklus wieder starten und zu einer millionenfachen Amplifikation des ursprünglichen Templates führen.

Um die NASBA in die hierin offenbarte Vorrichtung zu umfassen wurden Sonden designed, die die Bildung von einem bifunktional haptenisierten Amplifikationsprodukt gestatten. Für die NASBA gibt es zwei mögliche Strategien: 1) das Design von Amplifikationsprimer, die haptenisiert sind; und 2) die Verwendung von zwei haptenisierten Fangoligonukleotiden, die an die Produkt-RNA binden. Siehe zum Beispiel 8 und 9. Das gewählte Modellsystem ist für das HIV POL-Gen.

In der vorliegenden NASBA-Haptenisierungstrategie bindet der T7NASFAM-Haptenisierungsprimer, der einen T7-Transkriptasepromotor und ein angehängtes Fluoreszein enthält, an die Ziel-RNA. Ein reverse Transkriptase transkribiert eine DNA-Kopie der RNA, wie es in Beispiel B der 14 dargestellt ist. Der ursprüngliche RNA-Strang wird durch die RNase H verdaut. Es bindet ein reverser Haptenisierungprimer, P2NASBIO mit einem angehängten Biotin, an die antisense-DNA und wird durch die DNA-Polymeraseaktivität der reversen Transkriptase verlängert. Die Haptenisierungsprimer sind wie folgt.

T7NASFAM (T7-PROMOTORPRIMER):

5'-FLUORESZEIN-AATTCTAATACGACTCACTATAGGGTGCTATGTCACTTCCCCTTGGTTCTCT-3' SEQ ID NR: 1

P2NASBIO (REVERSPRIMER):

5'-BIOTIN-AGTGGGGGGACATCAAGCAGCCATGCAAA-3' SEQ ID NR: 2

Das resultierende doppelsträngige bihaptenisierte DNA-Intermediat ist in dem Beispiel D der 14 dargestellt. Dieser Komplex ergibt ein Signal in einer Lateralfluss- oder Slide-Agglutination. Die T7-RNA-Polymerase bindet an die Promotorregion, um viele Kopien einer minus-sense-RNA herzustelln, wie in dem Beispiel F der 14 gezeigt ist. Diese RNA trägt zu der Herstellung des DNA-Intermediats auf eine ähnliche Weise bei. Die zwei Fangoligonukleotide, wobei jedes ein Hapten aus entweder Fluoreszein oder Biotin hat, binden an die (-)sense-RNAs, was bifunktionale haptenisierte Komplexe ergibt. Diese Komplexe ergeben ein Signal in einer Lateralfluss- oder Slide-Agglutination. Die haptenisierten Fangoligonukleotide, die designed sind, um an das minus-sense-RNA-Produkt zu binden, sind:

5C(-)NASBA:

5'-FLUORESZEIN-TGGCCTGGTGCAATAGGCCC-3' SEQ ID NR: 3

3C(-)NASBA:

5'-CCCATTCTGCAGCTTCCTCA-BIOTIN-3' SEQ ID NR: 4

Beispiel 5 Isothermer Amplifikationsansatz für den Nachweis mit einer bifunktional markierten amplifizierten Zielsequenz unter Verwendung eines Stranverdrängungsassays

Der vorliegende Strangverdrängungsassay (SDA) ist ein Beispiel für eine isotherme Amplifikation, die unter Verwendung von Mikropartikeln und einem bifunktional markierten Produkt nachgewiesen werden kann. Die SDA-Technologie ist in dem Patent der Vereinigten Staaten Nr. 5,455,166 der Becton Dickinson and Company beschrieben. Der SDA ist eine isotherme Amplifikation, der auf der Fähigkeit eines Restriktionsenzyms basiert in den unmodifizierten Strang einer Hämiphosphorthioatform seiner Erkennungsstelle einen Einzelstrangbruch einzufügen und der Fähigkeit der DNA-Polymerase die Replikation an dem Einzelstrangbruch zu iniziieren und den downstream gelegenen Nichttemplatestrang zu verdrängen. Die Primer, welche die Erkennungsstellen für die Einzelstrangbruch einfügenden Restriktionsenzyme enthalten, binden an die entgegengesetzten Stränge der Ziel-DNA an die Positionen, welche die zu amplifizierende Sequenz flankieren. Das Zielfragment wird exponentiell amplifiziert, indem die Sense- und Antisensereaktionen gekoppelt werden, in welchen die Stränge, die von der Sensereaktion verdrängt wurden, als Ziel für die Antisensereaktion und anders herum dienen.

Diese Reihe von Experimenten wird mit Compositextensionsprimern durchgeführt, die mit Biotin, FAM oder Digoxigenin markiert sind. Die Bumperprimer haben dieselbe Sequenz wie sie von Becton Dickinson and Company bereit gestellt werden (Franklin Lakes, New Jersey). Die Sequenzen des Ziels, der Bumperprimer und der Compositextensionsprimer sind wie folgt:

Bumperprimer:

  • B1: 5'-CGATCGAGCAAGCCA SEQ ID NR: 5
  • B2: 5'-CGAGCCGCTCGCTGA SEQ ID NR: 6

Compositextensionsprimer:

  • S1: 5'-fam/dig-ACCGCATCGAATGCATGTCTCGGGTAAGGCGTACTCGACC SEQ ID NR: 7
  • S2: 5'-biotin-CGATTCCGCTCCAGACTTCTCGGGTGTACTGAGATCCCCT SEQ ID NR: 8

Zielsequenz:

  • 5'-TGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGACGTTATCCACCATACGGATAGGGGATCTCAGTACACATCGATCCGGTTCAGCG SEQ ID NR: 9

Die Reaktion wird für das thermophile Strangverdrängungs-Amplifikations (tSDA)-Protokoll aufgesetzt, das von Becton Dickinson and Co. entwickelt wurde. Der Zielorganismus ist Mycobacterium tubercolosis. Für die Teststudien wurde ein künstliches Zieltemplate verwendet, bestehend aus einer 91nt Sequenz des M. tuberculosis-Genoms, die durch die äußeren (Bumper)-Primer von Becton Dickinson definiert ist. Die verwendeten Amplifikationsbedingungen sind identisch mit jenen, die von Becton Dickinson für den tSDA verwendet wurden.

Die für dieses Verfahren verwendete Membran ist Nitrocellulose, bezogen von der Millipore Corporation, Bedford, MA. Ein Streifen aus Streptavidin mit einer Konzentration von 1 mg/ml wird mit einer Menge von 1 &mgr;l/cm mittels eines linearen Reagenzstripers (IVEK Corporation, No. Springfield, VT) 1 cm vom unteren Rand der Membran aufgetragen. Nach dem Auftragen des Streptavidins wird die Membran getrocknet und dann gegen eine nichtspezifische Bindung mittels 0,5% Casein in 100 mM Tris, pH 7,4, blockiert. Die Membranen werden zweimal mit Wasser (ddH2O) gewaschen und getrocknet. Als Nächstes werden 3 &mgr;l anti-S1 (komplementär zu S1 ohne die Biotinmarkierung) und/oder S2-Pimer (komplementär zu S2 ohne die DIG- oder FAM-Markierung) auf eine zweite Membran gepunktet. Diese Membran wird sandwichartig auf die erste Membran gestapelt, um die freien Primer abzufangen, die mit dem Produkt um die Mikropartikel oder die Streptavidinfangzone konkurrieren. Die Mikropartikel werden wie oben in Beispiel 2 zusammengefasst mit entweder anti-Digoxigenin Fab oder anti-FAM monoklonalem IgG hergestellt. Die Mikropartikel werden 1:2 mit einer 35% Saccharoselösung verdünnt und 3 &mgr;l direkt auf die Membran aufgetragen und getrocknet.

Das Reaktionsprodukt (10 &mgr;l) wird zu 45 &mgr;l SDA-Puffer zugegeben und dann (50 &mgr;l) auf die zuvor bestreifte Membran angewendet. Das Auftragen der Proben benötigt das bifunktional markierte Produkt und die konkurrierenden Primer, um die anti-Primer beschichtete Membran und die getrockneten Mikropartikel zu passieren. Wenn das Ziel vorhanden ist gibt es eine sichtbare Linie auf der Membran. Wenn das Ziel nicht vorhanden ist, fehlt die sichtbare Linie. Die Ergebnisse eines solchen Experiments sind in der 11 gezeigt.

Beispiel 6 Inhibierungsassay: Verlust des sichtbaren Signals auf der Lateralflussmembran

Die Cycling-Probe-Technologie bezieht eine Nukleinsäuresonde ein, die DNA-RNA-DNA-Sequenzen umfasst, die designed sind, um mit den Zielsequenzen zu hybridisieren. Siehe zum Beispiel 10. Die Sonden sind bifunktional mit Biotin und FAM markiert. Wenn die Sonden mit dem Ziel hybridisieren, wobei doppelsträngige Nukleinsäure gebildet wird, schneidet die RNase H in dem Reaktionspuffer die Sonden. Diese Spaltung führt zu einem Signalverlust, wenn auf eine Membran aufgetragen, die eine Fangzone aus Straptavidin- und anti-FAM-beschichteten, farbigen Mikropartikeln enthält. Wenn das Ziel nicht vorhanden ist, gibt es keine sichtbare Linie auf der Membran.

Die spezifische Sonde und das Ziel, die in dem vorliegenden Beispiel eingesetzt werden, sind von ID Biomedical Corporation für die Verwendung beim Nachweis von Mycobacterium tuberulosis designed worden. Die Sonde ist ein chimäres Konstrukt, das sowohl DNA- als auch RNA-Sequenzen mit Markierungen an den 5' (FAM)- und den 3' (Biotin)-Enden des DNA-Teils der Sonde enthält. Die Bindung der Sonde an einen Einzelstrang des Ziels bildet eine doppelsträngige Nukleinsäure, welche mit der RNase H geschnitten wird, was folglich die Bifunktionalität der Sonde beseitigt. Die Sequenz der Sonde ist unten beschrieben:

FARK2S3B-Sonde:

5'-fam AAA GAT GT agag GGT ACA GA-3'biotin SEQ ID NR: 10

(Kleinbuchstaben zeigen Desoxyribonukleosidbasen an)

Die Sequenz des Ziels ist unten beschrieben:

ARK2-T synthetisches Ziel:

5'-AAT CTG TAC CCT CTA CAT CTT TAA-3' SEQ ID NR: 11

Die Reaktion wird unter Berücksichtigung des Protokolls, bereitgestellt von der ID Biomedical Corporation, vervollständigt. Die für dieses Verfahren verwendete Membran ist Nitrocellulose, bezogen von der Millipore Corporation, Bedford, MA. Ein Streifen aus Streptavidin mit einer Konzentration von 1 mg/ml wird mit einer Menge von 1 &mgr;l/cm mittels eines linearen Reagenzstripers (IVEK Corporation, No. Springfield, VT) 1 cm vom unteren Rand der Membran aufgetragen. Nach dem Auftragen des Streptavidins wird die Membran getrocknet und dann gegen eine nichtspezifische Bindung mittels 0,5% Casein in 100 mM Tris, pH 7,4, blockiert. Die Membranen werden zweimal mit Wasser (ddH2O) gewaschen und getrocknet. Die Mikropartikel werden wie oben in Beispiel 2 umrissen hergestellt, wobei der anti-Digoxigenin Fab durch anti-FAM monoklonalem IgG ersetzt wird.

Das Reaktionsprodukt (10 &mgr;l) wird zu 5 &mgr;l 0,1% anti-FAM-beschichteten Mikropartikeln (0,1%) und 35 &mgr;l Wasser zugegeben, und dann auf die vorher bestreifte Membran aufgetragen. Die Bindung der Sonde an das Ziel gefolgt von der Spaltung der Sonde durch die RNase H führt zu einem Bifunktionalitätsverlust der Sonde. Wenn das Ziel vorhanden ist, fehlt eine sichtbare Linie auf der Membran. Wenn das Ziel nicht vorhanden ist, ist die bifunktional markierte Sonde im Stande die anti-FAM-beschichteten Mikropartikel und das an die Membran gebundene Straptavidin zu binden, was zu einer sichtbaren Linie führt. Die Ergebnisse einem solchen Experiments sind in der 12 gezeigt.

Mit der Amplifikation wirken bestimmte Proben hemmend auf die Amplifikation, was falschnegative Ergebnisse liefert. Um dieses Problem zu vermeiden wird eine Positivkontrolle – eine Kontrollnukleinsäure mit Primererkennungsstellen, die an eine vollkommen irrelevante Nukleinsäuresequenz angehängt sind – umfasst. Dieser Positivkontrollenprimer ist ein Bestandteil der Nukleinsäureextraktionsreagenzien in dem zweiten Zylinder der Vorrichtung, was folglich die Probenextraktion und -zulieferung kontrolliert sowie das Versagen der Amplifikation nachweist. Die bevorzugte Ausführungsform der Positivkontrolle ist eine Lambda-DNA-Sequenz. Die Kontrollnukleinsäure wird extrahiert und zusammen mit der Zielnukleinsäure amplifiziert und durch eine Linie aus immobilen Digoxigeninkügelchen auf der festen Nachweisphase nachgewiesen.

Der Zieloligonukleotidprimer und der Kontrolloligonukleotidprimer, die in dieser Erfindung verwendet werden, enthalten wenigstens ein Hapten als Markierung, das an der Primingreaktion nicht beteiligt ist. Das Hapten ist wenigstens an eine Position des Nukleinsäureprimers gebunden. Für die Derivatisierung der Nukleinsäureprimer können verschiedene Verfahren eingesetzt werden. Siehe Maniatis, oben. Die Einführung des Haptens kann enzymatisch, chemisch oder photochemisch erfolgen. Das Hapten kann direkt an das 5'-Ende des Primers derivatisiert werden oder eine Brücke von 1 bis 30 Atomen Länge enthalten. In einer bevorzugten Ausführungsform ist die Brücke linear. In einer anderen Ausführungsform besteht die Brücke aus einer verzweigten Kette mit einem Haptenmolekül an wenigstens einem der Kettenenden. Anhand der Anwesenheit von mehreren Haptenmolekülen an den Enden der verzweigten Kette wird die Nachweissensitivität erhöht. Die bevorzugten Haptene der vorliegenden Erfindung sind Biotin und Digoxigenin, es sind jedoch andere Haptene geeignet, die einen Rezeptor als spezifisches Bindungsreagenz zur Verfügung haben, zum Beispiel Steroide, Halogene und 2,4-Dinitrophenyl.

Beispiel 7 Nachweis des bifunktional markierten amplifizierten Produkts

Die für dieses Verfahren verwendete Membran ist Nitrocellulose, bezogen von der Millipore Corporation, Bedford, MA. Ein Streifen aus Streptavidin mit einer Konzentration von 1 mg/ml wird mit einer Menge von 1 &mgr;l/cm mittels eines linearen Reagenzstripers (IVEK Corporation, No. Springfield, VT) 1 cm vom unteren Rand der Membran aufgetragen. Nach dem Auftragen des Streptavidins wird die Membran getrocknet und dann gegen eine nichtspezifische Bindung mittels 0,5% Casein in 100 mM Tris, pH 7,4, blockiert. Die Membranen werden zweimal mit Wasser (ddH2O) gewaschen und getrocknet.

Das Amplifikationsprodukt wird zu den Membranen mit farbigen rezeptorbeschichteten Kügelchen mit Konzentrationen von 0,001-1,0% Mikropartikeln/ml zugegeben. Dieser Mischung wird ermöglicht in die Membran gesaugt zu werden. Positive Reaktionen führen zu einer farbigen Linie, wo das Fangmaterial aufgetragen ist. Amplifikationsreaktionen, ohne dass die Zielsequenz zu der Reaktion zugegeben wurde, dienen als Negativkontrollen. Die Ergebnisse von einem dieser Experimente sind in der 13 dargestellt.

Wenn die Ziel- und die Kontrollnukleinsäuresequenz vorhanden sind, interagiert der an die Mikropartikel gebundene Rezeptor mit dem Hapten(en), um die amplifizierte Nukleinsäure zu fangen. Das Ergebnis ist eine Linie aus gefärbten Partikeln, die auf der Membran für die Ziel- und die Kontrollnukleinsäuren sichtbar ist. Wenn das Ziel nicht vorhanden ist, werden die gefärbten Partikel nicht gefangen und sind nicht sichtbar. Wenn das Ergebnis der Analyse negativ ist, müssen die Kontrollnukleinsäuresequenzen sichtbar sein, was anzeigt, dass die Extraktion und die Amplifikation korrekt durchgeführt wurden.

Beispiel 8 Nachweis durch die Amplifikation mit einem einfach markierten Primer, gefolgt von der Hybridisierung mit einer Sonde die eine einzige Markierung enthält

Die Zielnukleinsäuresequenz wird mittels PCR amplifiziert, wobei eine 200-1000 mM Primerkonzentration, der GeneAmp EZ rTth RNA PCR-Kit (Perkin Elmer Corp., Alameda, CA) und 106 Kopien/ml der ziel-HIV-RNA-Sequenz verwendet werden. Es wurden 40 PCR-Zyklen ausgeführt, wobei jeder 60°C für 15 Minuten, 95°C für 15 Sekunden und 55°C für 60 Sekunden war.

Die Sequenzen für die Primer sind wie folgt:

SK38 Dig Primer:

5'-DIG ATA ATC CAC CTA TCC CAG TAG GAG AAA T-3' SEQ ID NR: 12

SK39 Primer:

5'-TT TGG TCC TTG TCT TAT GTC CAG AAT GC-3' SEQ ID NR: 13

Die spezifischen PCR-Reaktionsbedingungen sind unten beschrieben: Reagenz Endkonzentration 5X EZ-Puffer 1x Mn(OAc)2 3 mM rTth-Polymerase 5 U dntp's jeweils 240 &mgr;M SK38 1 &mgr;M SK39 1 &mgr;M
die rTth-DNA-Polymerase ist von Perkin Elmer N808-0097

Das SK38 Dig--SK39-Amplikon (5 &mgr;l) wird mit 5 &mgr;l 25 &mgr;M (125 pMol) SK39 Biotin bei 95°C für 1 Minute inkubiert und dann bei 55°C für 1 Minute. Das Amplikon, gebunden an die anti-Digoxigenin-Mikropartikel, wird durch die Membran zu der Streptavidinlinie gesaugt und durch die Interaktion von Biotin und Streptavidin gefangen. Das Ergebnis ist eine sichtbare Linie aus farbigen Mikropartikeln.

In der Negativkontrolle wird das Verfahren wie oben beschrieben durchgeführt, aber ohne die Zugabe der Zielsequenz. Ohne die Anwesenheit der Zielsequenz in der Amplifikationsreaktion wird das bifunktional markierte Amplikon nicht gebildet und die sichtbare Nachweislinie ist nicht vorhanden. Die Ergebnisse von einem solchen Experiment sind in der 15 gezeigt.

Beispiel 9 Extraktion der Nukleinsäuren mit Guanidiumthiocyanat auf Glass (Silicadioxid) und anschließende Amplifikation ohne die Elution von dem Silicadioxid

Es wurde eine Säure konstruiert, wobei eine Ansys 0,4 mm Membran als ein Filter verwendet wurde, um das Silicadioxid zu enthalten, und einen Spritzenapparat, um den Puffer in etwa 15 Sekunden durch die Säule zu ziehen. Es werden 50 &mgr;l Serum, 2 &mgr;l SiO2 (0,5 mg/&mgr;l) und 450 &mgr;l GuSCN-Lysepuffer durch Vortexen gemischt und dann bei Raumtemperatur für 10 Minuten inkubiert. Der spezielle Lysepuffer für die vorliegende Reihe von Experimenten enthält 14,71 g GuSCN (4 M final), 0,61 ml „Triton X-100", 5,5 ml 0,2 M EDTA pH 8,0 und wird q.s. auf 31,11 ml mit 0,1 M Tris-HCl, pH 6,4, aufgefüllt. Das Sicliadioxid wird zweimal mit 500 &mgr;l 70% EtOH gewaschen.

Als Nächstes wird der Filter mit dem SiO2 aus der Säule entfernt und das SiO2 von der Membran unter Verwendung von 20 &mgr;l Wasser (ddH2O) ausgewaschen. Es werden 5 &mgr;l Silicadioxidschlamm zu der PCR-Reaktion unter Verwendung des Standardprotokolls für das HIV-Modelsystem zugegeben, wie es oben im Beispiel 8 detailliert beschrieben ist.

Die vorliegende Erfindung stellt ein schnelles, einfaches und genaues Verfahren zum Nachweis von amplifizierten Zielnukleotidsequenzen mit einer unabhängigen Vorrichtung bereit. Die Sensitivität und Spezifität des Nachweises basieren auf der Markierung des Ziels während dem Amplifikationsprozess, durch die Einführung einer Markierung oder durch die anschließende Hybridisierung mit einer markierten Sonde. Das Verfahren benötigt keine kostenintensive und komplizierte Ausrüstung oder speziell angelerntes Personal, noch stellt es irgendeine Gesundheitsgefahr dar.

Während die oben genannte Beschreibung viele Spezifizitäten enthält, sollten diese nicht als Einschränkungen für den Bereich der Erfindung ausgelegt werden, sondern vielmehr als eine Veranschaulichung der bevorzugten Ausführungsformen davon. Es sind viele andere Variationen möglich, wie die Amplifikation mehrerer Zielproben in derselben Reaktionsmischung, wobei neu entdeckte Polymerasen und Ligasen, ect. verwendet werden. Folglich sollte der Bereich der Erfindung eher durch die beigefügten Ansprüche bestimmt werden als durch das gegebene Beispiel.

SEQUENZLISTE


Anspruch[de]
Unabhängige Vorrichtung für die Extraktion, Amplifikation und den Nachweis von Nukleinsäuresequenzen, welche umfasst:

a) einen ersten hohlen gestreckten Zylinder (1), der ein offenes und ein geschlossenes Ende hat, wobei der besagte Zylinder (1) ferner darin eine Vielzahl von Kammern hat, wobei jede Kammer ein oberes proximales und ein unteres distales Ende hat;

b) einen zweiten hohlen gestreckten Zylinder (2), der innen angrenzend an den besagten ersten Zylinder (1) positioniert ist und der ein oberes distales Ende und ein unteres proximales Ende mit einer eingefügten Öffnung und einem Dichtungsrand (15) hat und der mittels Drehung das besagte untere proximale Ende des zweiten Zylinders (2) mit dem besagten oberen proximalen Ende jeder Kammer des besagten ersten Zylinders (1) verbindet, wobei der besagte zweite Zylinder (2) ferner drei Indizierungskerben (7) hat, die in gleichen Abständen zueinander an dem oberen distalen Ende des Zylinders angeordnet sind; und

c) eine Abdeckung (3), die an dem offenen Ende des ersten Zylinders (1) integriert hängt, wobei die besagte Abdeckung eine Reaktionskügelchenkammer (12) mit einer integrierten Messerkante (18) hat, wobei die besagte Kammer (12) thermisch mit einer Membran (19) verschlossen ist und ein Reaktionskügelchen (11) beherbergt, wobei die besagte Abdeckung (3) ferner einen Indizierungsstift, der diametral zu dem Gelenk angeordnet ist, für die Einreihung mit den besagten Kerben (7) während der Drehung des besagten ersten Zylinders (1) in Relation zu dem besagten zweiten Zylinder (2) hat.
Unabhängige Vorrichtung nach Anspruch 1, worin der besagte zweite hohle gestreckte Zylinder (2) ferner Extraktions- und Amplifikationsmittel umfasst. Unabhängige Vorrichtung nach Anspruch 2, worin das besagte Extraktionsmittel ein trockenes Lysierungsreagenz für die Nukleinsäureextraktion einschließt. Unabhängige Vorrichtung nach Anspruch 2, worin das besagte Amplifikationsmittel Polymersasen oder Ligasen einschließen. Unabhängige Vorrichtung nach Anspruch 1, worin die Kammernvielzahl des besagten ersten hohlen gestreckten Zylinders (1) eine Reservoirkammer (16) und eine Nachweiskammer (20) einschließt. Unabhängige Vorrichtung nach Anspruch 5, worin das besagte Reservoir (16) durch die angrenzenden Seiten des besagten ersten hohlen gestreckten Zylinders (1), die besagte Nachweiskammer (20) und eine poröse Membran definiert ist, wobei die besagte Membran Poren mit einer Größe hat, die der Abfallflüssigkeit ein Durchlaufen erlauben. Unabhängige Vorrichtung nach Anspruch 5, worin die besagte Nachweiskammer (20) ferner ein Nachweismittel umfasst. Unabhängige Vorrichtung nach Anspruch 7, worin das besagte Nachweismittel ein Absorptionsmittelkissen (9) und einen Streifen (10) einschließt, der farbige Mikropartikel (24) und Fangzonen hat. Unabhängige Vorrichtung nach Anspruch 1, worin das Amplifikationsziel irgendeine spezifische Nukleinsäuresequenz ist. Unabhängige Vorrichtung nach Anspruch 1, worin die besagte Membran (19) ausgewählt ist aus der Gruppe bestehend aus Folie und Folie/Polymer.






IPC
A Täglicher Lebensbedarf
B Arbeitsverfahren; Transportieren
C Chemie; Hüttenwesen
D Textilien; Papier
E Bauwesen; Erdbohren; Bergbau
F Maschinenbau; Beleuchtung; Heizung; Waffen; Sprengen
G Physik
H Elektrotechnik

Anmelder
Datum

Patentrecherche

Patent Zeichnungen (PDF)

Copyright © 2008 Patent-De Alle Rechte vorbehalten. eMail: info@patent-de.com